Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
Contents lists available at ScienceDirect
Journal of Steroid Biochemistry & Molecular Biology journal homepage: www.elsevier.com/locate/jsbmb
Estrogen activation of the mitogen-activated protein kinase is mediated by ER-a36 in ER-positive breast cancer cells XinTian Zhang, Hao Deng, Zhao-Yi Wang * Departments of Medical Microbiology and Immunology, Creighton University Medical School, 2500 California Plaza, Omaha, NE, USA
A R T I C L E I N F O
A B S T R A C T
Article history: Received 11 February 2014 Received in revised form 20 May 2014 Accepted 21 June 2014 Available online 25 June 2014
It is well known that there are two estrogen-signaling pathways, genomic estrogen signaling and nongenomic or rapid estrogen signaling. Although both ER-a and ER-b have been suggested to mediate both genomic and non-genomic estrogen signaling, rapid estrogen signaling such as activation of the MAPK/ ERK signaling in ER-positive breast cancer MCF7 cells has been controversial. Previously, our laboratory cloned a 36 kDa variant of ER-a, ER-a36, that is mainly localized at the plasma membrane and is able to mediate rapid estrogen signaling. In this study, we investigated the function and the underlying mechanisms of ER-a36 in rapid estrogen signaling of ER-positive breast cancer cells. ER-positive breast cancer cells MCF7, T47D and H3396 as well as their variants with different levels of ER-a and ER-a36 expression were used to examine estrogen induction of the MAPK/ERK1/2 signaling. The underlying mechanisms were also studied in these cells with the neutralizing antibodies and chemical inhibitors against different growth factors and their receptors. We found that ER-a36 mediated estrogen induction of the MAPK/ERK phosphorylation in ER-positive breast cancer cells while the full-length ER-a failed to do so. The rapid estrogen signaling mediated by ER-a36 involved a orchestrated action of matrix metalloproteinases (MMPs), heparin-binding epidermal growth factor (HB-EGF), amphiregulin, insulin-like growth factor 1 receptor (IGF-1R), epidermal growth factor receptor (EGFR), HER2/Neu and Src. Our results thus indicated that ER-a36 is the estrogen receptor that mediates estrogen induction of the MAPK/ERK signaling in ER-positive breast cancer cells. ã 2014 Elsevier Ltd. All rights reserved.
Keywords: ER-a36 Rapid estrogen signaling ERK1/2 HB-EGF Amphiregulin EGFR HER2 IGF-IR
1. Introduction It has been well established that the diverse estrogen effects are mediated by the estrogen receptors, ER-a and ER-b, both of which are ligand-activated transcription factors [1–3]. However, despite the clarity with which ERs have been shown to act as ligandactivated transcription factors, it became apparent that not all of the physiological effects mediated by estrogens are accomplished through a direct effect on gene transcription. Another signaling pathway (also known as “non-classic”, “non-genomic”, “extranuclear”, “rapid signaling” or “membrane-initiated signaling”) exists that involves cytoplasmic signaling proteins, growth factors and their receptors, and other membrane-initiated signaling pathways [4–6]. Specific plasma membrane binding sites for estrogen were identified in endometrial cells in 1977 [7] and later in breast cancer cells [8]. Several studies indicated that both ER-a
* Corresponding author at: Department of Medical Microbiology and Immunology, Creighton University Medical School, Criss III, Room 352, 2500 California Plaza, Omaha, NE 68178, USA. Fax: +1 402 280 3543. E-mail address: [email protected] (Z.-Y. Wang). http://dx.doi.org/10.1016/j.jsbmb.2014.06.009 0960-0760/ ã 2014 Elsevier Ltd. All rights reserved.
and b are localized at the plasma membrane and are involved in the rapid estrogen signaling [9–12]. However, further evidence indicates that more than one membrane-initiated signaling pathway is associated with estrogen action. A body of evidence from several laboratories using the membrane-impermeable compound 17-b-estradiol (E2b)-bovine serum albumin (E2bBSA) indicates the existence of two functionally distinct rapid estrogen-signaling pathways: one sensitive to antiestrogens and one resistant [13–15]. ER-a/knockout mice retained rapid estrogen-stimulated effects in neurons, which were not blocked by ICI182, 780 [16]. These data suggest that other membrane-based ER(s) or estrogen binding protein(s) may exist since all known ERs are sensitive to ICI-182, 780. The possibility that estrogen binds to other receptors belonging to an entirely different family of proteins has been suggested by the reports that the G-protein-coupled and seven-transmembrane receptor, GPR30, may function as an estrogen receptor that transduces antiestrogen resistant rapid estrogen signaling [17,18]. Accumulating evidence indicated that the rapid estrogen signaling that involves the MAPK/ERK and the PI3K/AKT signaling pathways mediate proliferative and anti-apoptotic effects of estrogen in a variety of normal and cancer cells [4–6]. However,
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
although the rapid estrogen signaling has been reported by many laboratories, the induction of the MAPK/ERK and the PI3K/AKT signaling by E2b in ER-positive breast cancer cells has been continuously questioned. It has been reported that the activation of the MAPK/ERK by E2b is a poorly reproducible event and can be observed also in mock-treated cells [19,20]. Lobenhofer et al. also failed to detect any activation of the MAPK/ERK signaling in MCF7 cells [21,22]. The basis of these conflicting reports regarding the activation of the MAPK/ERK and the PI3K/AKT by E2b has not been well understood although the inherent differences in MCF7 cells sublines, different conditions for maintaining cells, staging cells in E2b-free medium, the ways of treating cells with E2b, lysing cells and assessing activation may contribute the conflicting results of the rapid estrogen signaling in ER-positive breast cancer cells [20]. Previously, our laboratory identified and cloned a 36 kDa variant of ER-a, ER-a36, that is mainly associated with the plasma membrane and mediates rapid estrogen signaling such as the activation of the MAPK/ERK, the PI3K/AKT and the PKC signaling pathways in breast and endometrial cancer cells [23–26]. ER-a36 lacks both transcription activation domains AF-1 and AF-2 of the 66 kDa full-length ER-a (ER-a66), and possesses an intact DNAbinding domain, consistent with the fact that ER-a36 has no intrinsic transcriptional activity but inhibits transcriptional transactivation activities of ER-a66 and ER-b [24]. Here, we demonstrated that ERa36 is the receptor that mediates estrogen induction of the MAPK/ ERK signaling pathway in ER-positive breast cancer cells while the full-length ER-a, ER-a66, failed to do so. We also studied the molecular events in ER-a36-mediated rapid estrogen signaling. 2. Materials and methods 2.1. Chemicals and antibodies 17b-estradiol (E2b) was purchased from Sigma Chemical Co. (St. Louis, MO). The broad-spectrum matrix metalloproteinase (MMP) inhibitor Galardin (GM6001) and the Src inhibitor PP2 were from Tocris Bioscience (Ellisville, MO). The EGFR inhibitor AG1478, the IGF-1R inhibitor AG1024 and the HER2 inhibitor AG825 were purchased from EMD Chemicals (Gibbstown, NJ). Anti-HER2 neutralizing antibody was purchased from CD BioSciences Inc. (Shirley, NY). Neutralizing antibodies for HB-EGF, amphiregulin and IGF-1R were purchased from R&D system (Minneapolis, MN). Anti-EGFR neutralizing antibody was obtained from EMD Millipore (Billerica, MA). Anti-phospho-p44/42 ERK (Thr202/Tyr204) (197G2) mouse monoclonal antibody (mAb), anti-p44/42 ERK (137F5) rabbit mAb, anti-phospho-EGFR (Tyr1045) and -HER2/ ErbB2 (Tyr1221/1222) as well as anti-EGFR and -HER2/ErbB2 (D8F12) antibodies were all purchased from Cell Signaling Technology (Boston, MA). Antibodies of ER-a66 and b-actin as well as normal mouse IgG were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Polyclonal anti-ER-a36 specific antibody was generated and characterized as described before [27]. Briefly, the anti-ER-a36 polyclonal antibody was custom made by Pacific Immunology Corp. (Ramona, CA) which is an affinity purified antibody against the 20 AA (GISHVEAKKRILNLHPKIFG) of the ER-a36 that is unique to ER-a36. 2.2. Cell culture and treatment Relatively low-passage MCF7 cells (75 passages. T47D cells were originally obtained from ATCC. H3396 cells were kindly provided by Dr. Leia Smith at the Seattle Genetics Inc. All parental and derivative cells were maintained at 37 C in a 10% CO2 atmosphere in IMEM without phenol-red and 10% fetal calf serum in a humidified incubator. For estrogen treatment, cells were maintained in phenol red-free media with 2.5% charcoal-stripped fetal calf serum (HyClone, Logan, UT) for three days, and then in serumfree medium for 12 h before experimentation. For ERK activation assays, cells were treated with vehicle (ethanol) and indicated concentrations of E2b for different periods of time. To test the effects of different neutralizing antibodies and chemical inhibitors, antibodies and inhibitors were added 10 min before E2b addition. 2.3. Establishment of stable cell lines MCF7 cells stably transfected with an ER-a36 expression vector, MCF7/ER36, were established as described before [27]. To establish stable cell lines with ER-a36 expression knocked-down, we constructed two ER-a36 specific shRNA expression vectors by cloning the DNA oligonucleotides 50 -GATGCCAATAGGTACTGAATTGATATCCGTTCAGTACCTATTGGCATC-30 and 50 -AACCGTACCACTCTGCTGATTGATATCCGTCAGCAGAGTGGTACGGTT-30 from different potions of the 30 UTR of ER-a36 cDNA (positions 3026– 3044 AND 4261–4278, respectively. Sequence ID: BX640939.1) into the pRNAT-U6.1/Neo expression vector from GenScript Corp. (Piscataway, NJ) and were named as pSi36-1 and pSi36-3, respectively. To establish stable cell lines with ER-a66 expression knocked down, we constructed two ER-a66 specific shRNA expression vectors by cloning the DNA oligonucleotides 50 -ATGCTGTACAGATGCTCCATTGATATCCGTGGAGCATCTGTACAGCATGA-30 and 50 -ACTCATGTGCCTGATGTGGTTGATATCCGCCACATCAGGCACATGAGT-30 from different potions of the ER-a66 cDNA that is unique for ER-a66 (positions 1783–1800 and 1751–1769, respectively. Sequence ID: NM001291241) into the pRNAT-U6.1/ Neo expression vector and were named as pSi66-2 and pSi66-4, respectively. MCF7 cells stably transfected with the empty expression vector, an control vector expressing shRNA for luciferase, Si36-1 and -3, Si66-2 and -4 were cloned and named as MCF7/SiV, MCF7/SiL, MCF7/Si36 (3–1) and MCF7/Si36 (1–7), MCF7/Si66 (2–5) and MCF7/Si66 (4–3). For T47D cells, cells stably transfected with the empty expression vector, the pSi363 or the pSi66-2 expression vectors were selected for three weeks, and more than 20 individual clones of selected cells were pooled and were named as T47D/SiV, T47D/Si36 and T47D/Si66. H3396 cells with knocked-down levels of ER-a36 expression were established as described above with the pSi36-3 expression vector. 2.4. RNA purification and RT-PCR Total RNA was prepared with the “TRIzol” RNA purification reagent. One microgram of total RNA was reversely transcribed using the ProtoScript II RT-PCR kit (New England Biolabs, Ipswich, MA) with random primers at 42 C for 1 h. RT-PCR analysis of ER-a36, ER-a66 and b-actin was performed using gene specific primers as the following:
Gene
Forward primer
Reverse primer
b-Actin ER-a36 ER-a66
TGACGGGGTCACCCACACTGTGCCCATCTA CAAGTGGTTTCCTCGTGTCTAAAG CACTCAACAGCGTGTCTCCGA
CTAGAAGCATTTGCGGTGGACGATGGAGGG TGTTGAGTGTTGGTTGCCAGG CCAATCTTTCTCTGCCACCCTG
436
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
PCR procedure was carried out as described before [32]. PCR products were analyzed by electrophoresis in a 1.5% agarose gel and visualized by ethidium bromide staining under UV illumination. 2.5. Flow cytometry analysis For cell cycle analysis, cells at 70% confluence were harvested and 1 ml of cold 70% ethanol was slowly added to the cell pellet while vortexing. Ethanol-fixed cells were treated with 100 mg/ml RNase A and 50 mg/ml propidium iodide (PI) in PBS at room temperature for 30 min. Flow cytometry analysis of cell cycle distribution was performed using a FACSCalibur flow cytometer (BD-Biosciences). The experiment was repeated three times. 2.6. Immunoblot analysis Western blot analysis was performed as described before [27]. All Western blot experiments were performed at least three times. Band densities on developed films were measured and analyzed using Quantity One 1-D Analysis Software Version 4.6.7 (BIO-RAD Laboratories). 2.7. Statistical analysis Data were summarized as the mean standard error (SE) using the GraphPad InStat software program. Tukey–Kramer Multiple Comparisons Test was also used, and the significance was accepted for P < 0.05. 3. Results 3.1. Estrogen induces ER-a36 expression and a delayed ERK activation in ER-positive breast cancer MCF7 cells First, we examined the steady state levels of ER-a36 expression in three ER-positive breast cancer cell lines, MCF7, T47D and H3396, and found that all cells expressed endogenous ER-a36 with MCF7 cells exhibiting the lowest levels of ER-a36 protein (Fig. 1A). We then examined ER-a36 expression in MCF7 cells treated with 1 nM of 17b-estradiol (E2b) for different time periods. Western blot analysis revealed that ER-a36 expression was upregulated in MCF7 cells treated with E2b; started at 2 h, peaked at 18 h and started to return the basal levels at 36 h. On the contrary, the steady state levels of ER-a66 protein were decreased by E2b in 45 min, and returned to the basal level at 36 h (Fig. 1B), consistent with the previous reports that estrogen destabilizes ER-a66 protein [28,29]. In addition, we also found that the steady state levels of EGFR and HER2 proteins were also upregulated by E2b treatment (Fig. 1B). Previously, we reported that EGFR and HER2 signaling upregulated ER-a36 expression via an Ap1 binding site in the ER-a36 promoter region [30,31]. To examine whether EGFR and HER2 signaling is involved in the induction of ER-a36 expression by E2b, we treated MCF7 cells with the dual kinase inhibitor Lapatinib together with E2b and found that the EGFR/HER2 inhibitor blocked E2b induction of ER-a36 (Fig. 1C). We also noted that EGFR and HER2 expression was also downregulated by Lapatinib (Fig. 1C). Thus, our results demonstrated that E2b treatment upregulated ER-a36 expression presumably through the EGFR and HER2 signaling. To determine whether E2b induces phosphorylation of the MAPK/ERK1/2, a typical rapid estrogen-signaling event, in MCF7 cells, we treated cells with E2b for different time periods. Western blot analysis was performed to assess the phosphorylation levels of the ERK1/2. Fig. 1D shows that in MCF7 cells, E2b elicited a delayed
ERK phosphorylation; started around 2 h after E2b stimulation. Time course analysis in ER-positive breast cancer T47D and H3396 cells, however, revealed that ERK phosphorylation occurred within 5 min after E2b application, peaked at 15–30 min, returned to the basal level at 45 min and then exhibited another more sustained activation at 4 h (Fig. 1D). We then tested E2b-induced ERK phosphorylation in MCF7 cells stably transfected with an ER-a36 expression vector, MCF7/ ER36 cells (Fig. 1A). We found that in MCF7/ER36 cells, E2b induced ERK phosphorylation in 5 min, peaked at 15 min and returned to the basal level at 45 min (Fig. 1D), similar to the patterns observed in T47D and H3396 cells that express high levels of endogenous ER-a36. Our results thus suggested that ER-a36 might mediate estrogen induction of the MAPK/ERK phosphorylation in these cells. To examine the effects of E2b-induced ERK phosphorylation on estrogen-stimulated cell proliferation, we examined estrogenstimulated G1/S phase progression in these ER-positive breast cancer cells. As shown in Fig. 1E, MCF7 cells treated with E2b exhibited a dramatically increased G1/S phase progression with the S phase peaked at 36 h. In T47D and H3396 as well as MCF7/ER36 cells, however, E2b stimulated the G1/S phase progression that peaked at 18 h. Our data thus suggested that breast cancer cells with low levels of endogenous ER-a36 expression exhibited a delayed mitogenic estrogen signaling. 3.2. High passage MCF7 cells express high levels of endogenous ER-a36 and exhibit a rapid estrogen induction of the MAPK/ERK Previously, we observed that ER-a36 was highly expressed in MCF7 cells compared to T47D cells [24]. During our research, we found the MCF7 cells used before were cells with high-passage (>75 passages) compared to the MCF7 cells used in this study. Western blot analysis confirmed that the high passage MCF7 cells expressed high levels of endogenous ER-a36 as well as EGFR and HER2 (Fig. 2A). The high-passage MCF7 cells exhibited a rapid activation of the MAPK/ERK in response to estrogen stimulation in a pattern similar to T47D, H3396 and MCF7/ER36 cells (Fig. 2B). Our results thus provided a molecular explanation to the previous discrepancy of the rapid ERK activation induced by estrogen in MCF7 cells; different MCF7 sub-lines may be used in different laboratories. Our results also suggested that enhanced expression of EGFR and HER2 may be a mechanism of upregulated ER-a36 expression in high passage MCF7 cells. 3.3. ER-a36 mediates estrogen induction of the MAPK/ERK signaling in ER-positive breast cancer cells To determine if ER-a36 is involved in rapid estrogen signaling of ER-positive breast cancer cells, we designed two shRNA expression vectors targeting different regions of the 30 UTR of ER-a36 that is unique to ER-a36, and established two clonal and stable cell lines from MCF7 cells that express these two different shRNAs (MCF7/ Si36 1–10 and 3–8), respectively. MCF7 cells stably transfected with an empty expression vector (MCF7/SiV) or an expression vector for shRNA against firefly luciferase (MCF7/SiL) were used as controls. Both Western blot analysis and RT-PCR demonstrated that the ER-a36 expression was knocked-down about 80% in the MCF7/ Si36 1–10 and 3–8 cell lines compared to parental (MCF7/P) and control cells (MCF7/SiV and MCF7/SiL) (Fig. 3A). However, the expression levels of ER-a66 mRNA and protein were intact (Fig. 3A). E2b (1 nM) treatment failed to induce the MAPK/ERK phosphorylation in the MCF7/Si36 (1–10) and (3–8) cells in 12 h period (Fig. 3B). To exclude the possibility that ER-a66 may have a ligand affinity different from that of ER-a36, we also examined the MAPK/ERK activation in the MCF7/Si36 cells treated with different
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
437
Fig. 1. Estrogen induces ER-a36 expression and a delayed ERK activation in ER-positive breast cancer MCF7 cells. (A) The expression of ER-a variants in MCF7, T47D, H3396 and MCF7/ER-a36 breast cancer cells. (B) The time dependent pattern of E2b-regulated expression of ER-a36 and 66 as well as EGFR and HER2 in MCF7 cells. Starved cells were treated with 1 nM of E2b for indicated time periods. Western blot analysis was performed to assess ER-a variant expression. The representative results are shown, and the band density relative to b-actin is shown below with each point represents the means of three experiments; bars, SE. (C) Western blot analysis of ER-a36, HER2 and EGFR in MCF7 cells treated with 1 nM of E2b alone or together with 5 mM of Lapatinib (Lap) for 18 h. (D) The pattern of E2b-induced ERK phosphorylation in ER-positive breast cancer cells. Starved cells were treated with 1 nM of E2b for indicated time periods. Western blot analysis was performed to assess ERK phosphorylation. The representative results are shown, and the band density relative to total ERK is shown below with each point represents the means of three experiments; bars, SE. (E) The effects of E2b on the G1/S progression in different ER-positive breast cancer cells. Starved cells were treated with 1 nM of E2b for indicated time periods. Flow cytometry analysis was performed to examine cell populations in the S phase of the cell cycle. Each point represents the means of three experiments; bars, SE.
438
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
Fig. 2. High passage MCF7 cells express high levels of endogenous ER-a36 and exhibit a rapid estrogen induction of the MAPK/ERK. (A) Western blot of ER-a36 an d66 as well as EGFR and HER2 expression in MCF7 cells with different passage; low-passage MCF7 cells (75 passages), MCF7high cells. (B) Western blot analysis of the effects of E2b (1 nM) on ERK phosphorylation in different MCF7 cell sublines. (C) The p-ERK intensity relative to total ERK is shown with each point represents the means of three experiments; bars, SE.
concentrations of E2b for 8 h. We still were unable to observe induction of the ERK phosphorylation in these cells (Fig. 3C). To confirm these results, we also established a stable cell line from T47D by stable transfection of one of the shRNA expression vectors for ER-a36 (T47D/Si36) and a control cell line by stable transfection of the empty expression vector (T47D/SiV) (Fig. 3D). E2b failed to activate the MAPK/ERK signaling in the T47D/Si36 cells while the T47D/SiV cells were fully responsive to E2b (Fig. 3E). However, serum was able to induce ERK activation in the MCF7 and T47D cells with knocked-down levels of ER-a36 expression (Supplement Fig. S1), indicating there was no global defect of the MAPK/ERK signaling pathway in cells with ER-a36 expression knocked-down. Similar results were also observed in ER-positive breast cancer H3396 cells with knocked-down levels of ER-a36 (Fig. 3D and E). Altogether, our results indicated that ER-a36 plays a critical role in the rapid estrogen signaling of ER-positive breast cancer cells. 3.4. ER-a66 does not mediate estrogen induction of the MAPK/ERK in ER-positive breast cancer cells We then decided to examine the function of ER-a66 in the rapid estrogen signaling of ER-positive breast cancer cells. This time, we designed two shRNA expression vectors specifically targeting different regions of the 30 UTR of ER-a66 to specifically knock down ER-a66 expression. We established two clonal and stable cell lines from MCF7 cells that express these two different shRNAs (MCF7/ Si66, 2–5 and 4–3), respectively. MCF7/SiV and MCF7/SiL cells were used as controls. Both Western blot analysis and RT-PCR indicated that ER-a66 expression was knocked down about 90% in the MCF7/ Si66 (2–5) and (4–3) cells compared with control cells while the ER-a36 expression was increased modestly (Fig. 4A), consistent with our previous report that ER-a66 suppresses ER-a36 promoter
activity [32]. E2b treatment strongly induced the MAPK/ERK phosphorylation in the MCF7/Si66 cells, in a pattern similar to that of MCF7/ER36 (Fig. 4B). We also established a stable cell line from T47D cells by transfection of one of the ER-a66 specific shRNA expression vectors (T47D/Si66) and a control cell line T47D/SiV. Western blot confirmed that the ER-a66 expression was knocked down more than 80% in the T47D/Si66 cells compared to the T47D/SiV cells (Fig. 4C). E2b potently activated the MAPK/ERK in the T47D/Si66 cells (Fig. 4D). Altogether, our results demonstrated that ER-a36 but not ER-a66 mediates estrogen induction of the MAPK/ERK in ER-positive breast cancer cells. 3.5. HB-EGF, amphiregulin, EGFR, HER2, IGF-1R and Src are involved in ER-a36-mediated rapid estrogen signaling of ER-positive breast cancer cells We then decided to investigate the molecular events in ER-a36mediated rapid estrogen signaling. Western blot analysis was performed to examine estrogen-induced ERK phosphorylation in MCF7/ER36 cells pre-treated with different neutralizing antibodies including anti-HB-EGF, amphiregulin (AREG), EGFR, HER2 and IGF1R antibodies. Fig. 5A shows that in MCF7/ER36 cells pre-treated with mouse IgG, ERK phosphorylation was induced by estrogen within 5 min, peaked at 30 min, returned to the basal level at 45 min (the first peak) and then exhibited another more sustained activation from 2 to 18 h (the second peak). Pre-treatment with the anti-HB-EGF antibody, however, diminished the first and second peaks of ERK phosphorylation and there appeared another peak from 12 to 24 h (Fig. 5A), suggesting that HB-EGF is involved in the first and second peaks of ERK phosphorylation. Anti-AREG antibody pre-treatment only inhibited the second peak, and there appeared another peak from 12 to 18 h, suggesting that AREG
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
439
Fig. 3. ER-a36 mediates rapid and mitogenic estrogen signaling in ER-positive breast cancer cells. (A) Western blot and RT-PCR analyses of ER-a36 and ER-a66 expression in different MCF7 cell variants; parental cells (MCF7/P), control cells (MCF7/SiV, transfected with the empty expression vector; MCF7/SiL transfected with a luciferase shRNA expression vector), and ER-a36 expression knocked-down cells [MCF7/Si36 (1–10) and MCF7/Si36 (3–8)]. (B) Western blot analysis of the effects of E2b (1 nM) on ERK phosphorylation in different MCF7 cell variants. The p-ERK intensity relative to total ERK is shown below with each point represents the means of three experiments; bars, SE. (C) Western blot analysis of the effects of different concentrations of E2b on ERK phosphorylation in different MCF7 cell variants. The p-ERK intensity relative to total ERK is shown below with each point represents the means of three experiments; bars, SE (D) Expression levels of ER-a36 and 66 in control T47D and H3396 cells (T47D/SiV and H3396/SiV, transfected with the empty expression vector) and ER-a36 expression knocked down T47D and H3396 cells (T47D/Si36 and H3396/Si36) analyzed by Western blot analyses. (E) E2b-induced ERK phosphorylation in T47D and H3396 variants.
440
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
Fig. 4. ER-a66 does not mediate rapid and mitogenic estrogen signaling in ER-positive breast cancer cells. (A) Western blot and RT-PCR analyses of ER-a36 and ER-a66 expression in different MCF7 cell variants; parental cells (MCF7/P), control cells (MCF7/SiV and MCF7/SiL), and ER-a66 expression knocked-down cells [MCF7/Si66 (2–5) and MCF7/Si36 (4–3)]. (B) Western blot analysis of the effects of E2b on ERK phosphorylation in different MCF7 cell variants. The p-ERK intensity relative to total ERK is shown below with each point represents the means of three experiments; bars, SE. (C) Expression levels of ER-a36 and 66 in control T47D (T47D/SiV transfected with the empty expression vector) and ER-a66 expression knocked down T47D (T47D/Si66) analyzed by Western blot analyses. (D) E2b induced ERK phosphorylation in T47D variants. The pERK intensity relative to total ERK is shown below with each point represents the means of three experiments; bars, SE.
induced the second peak. Anti-HER2, anti-EGFR and IGF-1R antibodies potently inhibited the first peak of the ERK activation induced by HB-EGF while partially blocked the second peak (Fig. 5A). Similar experiments were also performed in MCF7 cells.
In the MCF7 cells pre-treated with mouse IgG, ERK phosphorylation were induced by E2b peaked at 8 h that was blocked by neutralizing antibodies for HB-EGF and IGF-1R (Fig. 5B) while antibodies for AREG and EGFR had less effects, suggesting that a
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
441
Fig. 5. HB-EGF, Amphiregulin, EGFR, HER2 and IGF-1R are involved in rapid estrogen signaling in ER-positive breast cancer cells. (A and B) Western blot analysis of E2b-induced ERK phosphorylation and total ERK expression in MCF7/ER36 and MCF7 cells pretreated with neutralizing antibodies. Starved cells were pretreated with the control IgG and indicated neutralizing antibodies before E2b treatment for different time periods. Western blot analysis was performed with phospho-specific or non-specific anti-ERK1/2 antibody. The p-ERK intensity relative to total ERK is shown in Supplement Fig. S3. (C) Western blot analysis of E2b-induced ERK phosphorylation and total ERK expression in MCF7/ER36 cells pretreated with different chemical inhibitors. Starved cells were pretreated with vehicle and indicated inhibitors before E2b treatment for different time periods. Western blot analysis was performed with phospho-specific or non-specific anti-ERK1/2 antibody. Representative experiment results are shown. The p-ERK intensity relative to total ERK is shown in Supplement Fig. S4.
delayed HB-EGF activity is involved in the 8 h peak of ERK phosphorylation observed in MCF7 cells. To confirm these results, we performed similar experiments in MCF7/ER36 cells using chemical inhibitors including the EGFR inhibitor AG1478, the IGF-1R inhibitor AG1024, the HER inhibitor AG825, the Src inhibitor PP2 and a broad-spectrum matrix metalloproteinase (MMP) inhibitor Galardin (GM6001). We found that all of the inhibitors potently blocked the first peak of ERK phosphorylation while had less effect on the second peak (Fig. 5C), suggesting that EGFR, IGF-1R, HER2 and Src are all involved in the activities of HBEGF that is presumably released by MMP [33,34]. 4. Discussion The rapid and transient ERK activation is a typical event of the rapid estrogen signaling that has been reported in ER-positive breast cancer MCF7 cells [35] as well as in other types of cells such as endothelial cells, neural cells and osteoblasts [4–6]. However, the induction of the MAPK/ERK signaling by E2b in ER-positive breast cancer cells remains controversial. In this study, we demonstrated that estrogen induced a delayed ERK activation in ER-positive breast cancer MCF7 cells that coincided with estrogen induction of ER-a36 expression. We further found that highpassage MCF7 cells (>75 passages) express high levels of endogenous ER-a36 protein. The high-passage MCF7 cells exhibited a rapid activation of the MAPK/ERK in response to estrogen stimulation in a pattern similar to T47D, H3396 and MCF7/ER36 cells, all of which express high levels of ER-a36. These results thus may provide a molecular explanation to the previous discrepancy of the rapid ERK activation induced by estrogen in MCF7 cells; different MCF7 sub-lines may be used in different laboratories and most experiments were performed within 1 h. During our research, we also observed enhanced ER-a36 expression in cells cultured in high density and fresh serum (data not shown), suggesting that ER-a36 expression is also influenced by conditions of maintaining cells and staging cells in E2b-free medium. Previously, we reported the existence of cross-regulatory loops between ER-a36 and EGFR/HER2 [30,31]; ER-a36 positively regulates EGFR and HER2 expression while EGFR and HER2 upregulate the promoter activity of ER-a36 through an Ap1 binding site located in the 50 flanking sequence of ER-a36 gene. Recently, Li et al., reported that transfection of an ER-a36 expression vector
into MCF7 cells increased EGFR expression [35]. Here, we found that E2b treatment increased the steady state levels of EGFR and HER2 proteins in a pattern similar to ER-a36 and the dual kinase inhibitor Lapatinib diminished estrogen induction of ER-a36. In addition, enhanced expression of EGFR, HER2 and ER-a36 was also found in the high-passage MCF7 cells. Together, our results indicated that EGFR and HER2 signaling is involved in upregulation of ER-a36 expression by estrogen and in the increased ER-a36 expression of the high-passage MCF7 cells. It is worth noting that Lapatinib also blocked induction of EGFR and HER2 by estrogen, suggesting the positive regulatory loops between ER-a36 and EGFR/HER2 is involved in induction of EGFR and HER2 by estrogen. Thus, the fact that both EGFR and HER2 are involved in ER-a36mediated rapid estrogen signaling indicated that coordinated induction of EGFR, HER2 and ER-a36 by estrogen is a pre-requisite for rapid estrogen signaling. Here, we further used the shRNA specifically targeting ER-a66 or 36 to knock-down expression of ER-a66 or 36 individually and found that the cells with ER-a36 expression knocked-down lacked estrogen induction of the MAPK/ERK. On the contrary, the cells with ER-a66 expression knocked-down still responded to rapid estrogen signaling. Thus, our results, for the first time, demonstrated that the estrogen induction of the MAPK/ERK signaling is mediated by ER-a36 in ER-positive breast cancer cells. Previous reports have indicated that ER-a66 and ER-b mediate the rapid estrogen signaling such as the activation of the MAPK/ERK signaling based on experiments involving transfection of these ER cDNAs into reportedly ER-deficient cell lines such as CHO-K1 [9], COS-7 [36], Rat2 fibroblasts [37]. Later, however, Nethrapalli et al. demonstrated that estrogen activated the MAPK/ERK signaling in native, non-transfected CHO-K1, COS-7 and RAT2 fibroblast cells [38]. Previously, we also reported that nontransfected COS-7 cells expressed endogenous ER-a36 and exhibited the rapid estrogen signaling [39]. Together, these results suggested that the cells null for ER-a66 used as models to study the rapid estrogen action may already express endogenous ER-a36 and are able to elicit the rapid estrogen signaling. Previously, Razandi et al. reported that HB-EGF released by matrix metalloproteinases (MMP)-2 and -9 that are activated by the G protein-coupled estrogen receptors via Src signaling is responsible for estrogen-induced activation of the EGFR and the MAPK/ERK in MCF7 cells [33]. Later, Song et al., reported that IGFIR is also involved in the rapid estrogen signaling of MCF7 cells and
442
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
postulated a model that E2b activates a linear pathway involving the sequential activation of IGF-IR, MMP, HB-EGF, EGFR, and MAPK/ ERK [34]. Our current results are in good agreement with the previous findings. Here, we also found that MCF7/ER36 cells exhibited several cycles of ERK activation by E2b. Using neutralizing antibodies and chemical inhibitors, we found that the estrogen-induced first and second peaks of the ERK activation was blocked by the anti-HB-EGF neutralizing antibody while the anti-AREG antibody only blocked the second peak of ERK activation, suggesting HB-EGF is involved in the ERK activation induced by AREG. It has been reported that estrogen induces AREG expression in MCF7 cells [36]. Our results here suggested that it is possible that HB-EGF is involved in estrogen induction of AREG expression. In this study, we also found that in the low-passage MCF7 cells, estrogen induced a delayed ERK activation by E2b; peaked at 4 h after estrogen treatment, which coincided with the time frame of ER-a36 expression induced by estrogen. Again, the anti-HB-EGF antibody blocked the ERK activation at 4 h, indicating that the delayed ERK activation in the low-passage MCF7 cells employs a similar signaling pathway as the rapid ERK activation found in the cells with high levels of ER-a36. Thus, the initiation of the rapid estrogen signaling in ER-positive breast cancer cells is a highly synchronized process that involves a number of growth factors and their receptors, consistent with the view that estrogens act as growth factors [40]. In summary, we demonstrated here that ER-a36 is the estrogen receptor that mediates rapid estrogen signaling in ER-positive breast cancer cells through coordinated actions of different growth factors and their receptors. Our results thus provided a novel mechanism for the functional communication among these signaling pathways. ER-a66, on the other hand, lacks such activities. Thus, ER-a36 is a critical player in rapid estrogen signaling that may play important roles in mammary tumorigenesis and possible in other types of estrogen related tumors as well. Acknowledgements This work was supported by Department of Defense grant DAMD 11-1-0497, and by Nebraska Tobacco Settlement Biomedical Research Program Award LB595 to Z.Y. Wang. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jsbmb.2014.06.009. References [1] S. Nilsson, S. Mäkelä, E. Treuter, M. Tujague, J. Thomsen, G. Andersson, E. Enmark, K. Pettersson, M. Warner, J.A. Gustafsson, Mechanisms of estrogen action, Physiol. Rev. 81 (4) (2001) 1535–1565. [2] B.W. O’Malley, R. Kumar, Nuclear receptor coregulators in cancer biology, Cancer Res. 69 (21) (2009) 8217–8222. [3] N. Heldring, A. Pike, S. Andersson, J. Matthews, G. Cheng, J. Hartrman, M. Tujague, A. Ström, E. Treuter, M. Wanter, et al., Estrogen receptors: how do they signal and what are their targets, Physiol. Rev. 87 (3) (2007) 905–931. [4] M.J. Kelly, E.R. Levin, Rapid actions of plasma membrane estrogen receptors, Trends Endocrinol. Metab. 12 (4) (2001) 152–156. [5] E.R. Levin, Plasma membrane estrogen receptors, Trends Endocrinol. Metab. 20 (10) (2009) 477–482. [6] F. Acconcial, M. Marino, The effects of 17b-estradiol in cancer are mediated by estrogen receptor signaling at the plasma membrane, Front. Physiol. 2 (30) (2011) 1–8. [7] R.J. Pietras, C.M. Szego, Specific binding sites for oestrogen at the outer surfaces of isolated endometrial cells, Nature 265 (5589) (1977) 69–72. [8] Y. Berthois, N. Pourreau-Schneider, P. Gandilhon, H. Mittrea, N. Tubiana, P.M. Martina, Estrodiol membrane binding sites on human breast cancer cell lines. Use of a fluorescent estradiol conjugate to demonstrate plasma membrane binding systems, J. Steroid Biochem. 25 (6) (1986) 963–972.
[9] M. Razandi, A. Pedram, G.L. Greene, E.R. Levin, Cell membrane and nuclear estrogen recptors (ERs) originate from a single transcript: studies of ERalpha and ERbeta expressed in Chinese hamster ovary cells, Mol. Endocrinol. 13 (2) (1999) 307–319. [10] A. Pedram, M. Razandi, E.R. Levin, Nature of functional estrogen receptors at the plasma membrane, Mol. Endocrinol. 20 (9) (2006) 1996–2009. [11] S.R. Hammes, E.R. Levin, Extranuclear steroid receptors: nature and actions, Endocr. Rev. 28 (7) (2007) 726–741. [12] M. Marino, P. Ascenzi, Membrane association of estrogen receptor alpha and beta influences 17beta-estradiol-mediated cancer cell proliferation, Steroids 73 (9–10) (2008) 853–858. [13] Z. Chen, I.S. Yuhanna, Z. Galcheva-Gargova, R.H. Karas, M.E. Mendelsohn, P.W. Shaul, Estrogen receptor a mediates the nongenomic activation of endothelial nitric oxide synthase by estrogen, J. Clin. Investig. 103 (103) (1999) 401–406. [14] K.S. Russell, M.P. Haynes, D. Sinha, E. Clerisme, J.R. Bender, Human vascular endothelial cells contain membrane binding sites for estradiol, which mediate rapid intracellular signaling, Proc. Natl. Acad. Sci. U. S. A. 97 (11) (2000) 5930–5935. [15] J.J. Watters, J.S. Campbell, M.J. Cunningham, E.G. Krebs, D.M. Dorsa, Rapid membrane effects of steroids in neuroblastoma cells: effects of estrogen on mitogen activated protein kinase signaling cascade and c-fos immediate early gene transcription, Endocrinology 138 (9) (1997) 4030–4033. [16] Q. Gu, K.S. Korach, R.L. Moss, Rapid action of 17beta-estradiol on kainiteinduced currents in hippocampal reurons lacking intracellular estrogen receptor, Endocrinology 140 (2) (1999) 660–666. [17] E.J. Filardo, J.A. Qiunn, K.I. Bland, A.R. Frackelton Jr., Estrogen induced activation of Erk-1 and Erk-2 requires the G protein-coupled receptor homolog, GPR30, and occurs via transactivation of the epidermal growth factor receptor through release of HB-EGF, Mol. Endocrinol. 14 (10) (2001) 1649–1660. [18] C.M. Revankar, D.F. Cimino, L.A. Sklar, J.B. Arterburn, E.R. Prossnitz, A transmembrane intracellular estrogen receptor mediates rapid cell signaling, Science 307 (5715) (2005) 1625–1630. [19] S. Caristi, J.L. Galera, F. Matarese, M. Imai, S. Caporali, M. Cancemi, L. Altucci, L. Cicatiello, D. Teti, F. Bresciani, et al., Estrogens do not modify MAP kinasedependent nuclear signaling during stimulation of early G (1) progression in human breast cancer cells, Cancer Res. 61 (17) (2001) 6360–6366. [20] S.L. Brower, J.R. Roberts, J.M. Antonini, M.R. Miller, Difficulty demonstrating estradiol-mediated Erk1/2 phosphorylation in MCF-7 cells, J. Steroid Biochem. Mol. Biol. 96 (5) (2005) 375–385. [21] E.K. Lobenhofer, J.R. Marks, Estrogen-induced mitogenesis of MCF-7 cells does not require the induction of mitogen-activated protein kinase activity, J. Steroid Biochem. Mol. Biol. 75 (1) (2000) 11–20. [22] E.K. Lobenhofer, G. Huper, J.D. Iglehart, J.R. Marks, Inhibition of mitogenactivated protein kinase and phosphatidylinositol 3-kinase activity in MCF-7 cells prevents estrogen-induced mitogenesis, Cell Growth Differ. 11 (2) (2000) 99–110. [23] Z.Y. Wang, X.T. Zhang, P. Shen, B.W. Loggie, Y. Chang, T.F. Deuel, Identification, cloning, and expression of human estrogen receptor-alpha36, a novel variant of human estrogen receptor-alpha66, Biochem. Biophys. Res. Commun. 336 (4) (2005) 1023–1027. [24] Z.Y. Wang, X.T. Zhang, P. Shen, B.W. Loggie, Y. Chang, T.F. Deuel, A variant of estrogen receptor-{alpha}, hER-{alpha}36: transduction of estrogen- and antiestrogen-dependent membrane-initiated mitogenic signaling, Proc. Natl. Acad. Sci. U. S. A. 103 (24) (2006) 9063–9068. [25] S.L. Lin, L.Y. Yan, X.T. Zhang, J. Yuan, M. Li, J. Qiao, Z.Y. Wang, Q.Y. Sun, ERalpha36, a variant of ER-alpha, promotes tamoxifen agonist action in endometrial cancer cells via the MAPK/ERK and PI3K/Akt pathways, PLoS One 5 (2) (2010) e9013. [26] J.S. Tong, Q.H. Zhang, Z.B. Wang, S. Li, C.R. Yang, X.Q. Fu, Y. Hou, Z.Y. Wang, J. Sheng, Q.Y. Sun, ER-a36, a novel variant of ER-a, mediates estrogenstimulated proliferation of endometrial carcinoma cells via the PKCd/ERK pathway, PLoS One 5 (11) (2010) e15408. [27] X.T. Zhang, Z.Y. Wang, Estrogen receptor-a variant, ER-a36, is involved in tamoxifen resistance and estrogen hypersensitivity, Endocrinology 154 (6) (2013) 1990–1998. [28] Z. Nawaz, D.M. Lonard, A.P. Dennis, C.L. Smith, B.W. O’Malley, Proteasomedependent degradation of the human estrogen receptor, Proc. Natl. Acad. Sci. U. S. A. 96 (5) (1999) 1858–1862. [29] C. Mathilde, H. Richard-Foy, Ligand-induced estrogen receptor a degradation by the proteasome: new actors? Nucl. Recept. Signal. 4 (2006) e004. [30] X.T. Zhang, L.G. Kang, L. Ding, S. Vranic, Z. Gatalic, Z.Y. Wang, A positive feedback loop of ER-a36/EGFR promotes malignant growth of ER-negative breast cancer cells, Oncogene 30 (6) (2011) 770–780. [31] L.G. Kang, Y.M. Guo, X.T. Zhang, J. Meng, Z.Y. Wang, A positive cross-regulation of HER2 and ER-a36 controls ALDH1 positive breast cancer cells, J. Steroid Biochem. Mol. Biol. 127 (3) (2011) 262–268. [32] Y. Zou, L. Ding, M. Coleman, Z.Y. Wang, Estrogen receptor-alpha (ER-alpha) suppresses expression of its variant ER-alpha36, FEBS Lett. 583 (8) (2009) 1368–1374. [33] M. Razandi, A. Pedram, S.T. Park, E.R. Levin, Proximal events in signaling by plasma membrane estrogen receptors, J. Biol. Chem. 278 (4) (2003) 2701–2712. [34] R.X. Song, Z. Zhang, Y. Chen, Y. Bao, R.J. Santen, Estrogen signaling via a linear pathway involving insulin-like growth factor I receptor, matrix metalloproteinases, and epidermal growth factor receptor to activate mitogenactivated protein kinase in MCF-7 breast cancer cells, Endocrinology 148 (8) (2007) 4091–4101.
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443 [35] G.L. Li, J. Zhang, K.T. Jin, K.F. He, Y. Zheng, X. Xu, H.H. Wang, H.Y. Wang, Z.Q. Li, X. F. Yu, X.T. Teng, J. Cao, L.S. Teng, Estrogen receptor-a36 is involved in development of acquired tamoxifen resistance via regulating the growth status switch in breast cancer cells, Mol. Oncol. 7 (2013) 611–624. [36] A. Migliaccio, M. Di Domenico, G. Castoria, A. de Falco, P. Bontempo, E. Nola, F. Auricchio, Tyrosine kinase/p21ras/MAP-kinase pathway activation by estradiolreceptor complex in MCF-7 cells, EMBO J. 15 (6) (1996) 1292–1300. [37] C.B. Wade, S. Robinson, R.A. Shapiro, D.M. Dorsa, Estrogen receptor (ER) alpha and ERbeta exhibit unique pharmacologic properties when coupled to activation of the mitogen-activated protein kinase pathway, Endocrinology 142 (6) (2001) 2336–2342.
443
[38] I.S. Nethrapalli, A.A. Tinnikov, V. Krishnan, C.D. Lei, C.D. Toran-Allerand, Estrogen activates mitogen-activated protein kinase in native, nontransfected CHO-K1, COS-7, and RAT2 fibroblast cell lines, Endocrinology 146 (1) (2005) 56–63. [39] I. Martínez-Lacaci, M. Saceda, G.D. Plowman, G.R. Johnson, N. Normanno, D.S. Salomon, R.B. Dickson, Estrogen and phorbol esters regulate amphiregulin expression by two separate mechanisms in human breast cancer cell lines, Endocrinology 136 (9) (1995) 3983–3992. [40] A. Migliaccio, G. Castoria, M. Di Domenico, A. de Falco, A. Bilancio, M. Lombardi, D. Bottero, L. Varricchio, M. Nanayakkara, A. Rotondi, et al., Sex steroid hormones act as growth factors, J. Steroid Biochem. Mol. Biol. 83 (1–5) (2002) 31–35.
Contents lists available at ScienceDirect
Journal of Steroid Biochemistry & Molecular Biology journal homepage: www.elsevier.com/locate/jsbmb
Estrogen activation of the mitogen-activated protein kinase is mediated by ER-a36 in ER-positive breast cancer cells XinTian Zhang, Hao Deng, Zhao-Yi Wang * Departments of Medical Microbiology and Immunology, Creighton University Medical School, 2500 California Plaza, Omaha, NE, USA
A R T I C L E I N F O
A B S T R A C T
Article history: Received 11 February 2014 Received in revised form 20 May 2014 Accepted 21 June 2014 Available online 25 June 2014
It is well known that there are two estrogen-signaling pathways, genomic estrogen signaling and nongenomic or rapid estrogen signaling. Although both ER-a and ER-b have been suggested to mediate both genomic and non-genomic estrogen signaling, rapid estrogen signaling such as activation of the MAPK/ ERK signaling in ER-positive breast cancer MCF7 cells has been controversial. Previously, our laboratory cloned a 36 kDa variant of ER-a, ER-a36, that is mainly localized at the plasma membrane and is able to mediate rapid estrogen signaling. In this study, we investigated the function and the underlying mechanisms of ER-a36 in rapid estrogen signaling of ER-positive breast cancer cells. ER-positive breast cancer cells MCF7, T47D and H3396 as well as their variants with different levels of ER-a and ER-a36 expression were used to examine estrogen induction of the MAPK/ERK1/2 signaling. The underlying mechanisms were also studied in these cells with the neutralizing antibodies and chemical inhibitors against different growth factors and their receptors. We found that ER-a36 mediated estrogen induction of the MAPK/ERK phosphorylation in ER-positive breast cancer cells while the full-length ER-a failed to do so. The rapid estrogen signaling mediated by ER-a36 involved a orchestrated action of matrix metalloproteinases (MMPs), heparin-binding epidermal growth factor (HB-EGF), amphiregulin, insulin-like growth factor 1 receptor (IGF-1R), epidermal growth factor receptor (EGFR), HER2/Neu and Src. Our results thus indicated that ER-a36 is the estrogen receptor that mediates estrogen induction of the MAPK/ERK signaling in ER-positive breast cancer cells. ã 2014 Elsevier Ltd. All rights reserved.
Keywords: ER-a36 Rapid estrogen signaling ERK1/2 HB-EGF Amphiregulin EGFR HER2 IGF-IR
1. Introduction It has been well established that the diverse estrogen effects are mediated by the estrogen receptors, ER-a and ER-b, both of which are ligand-activated transcription factors [1–3]. However, despite the clarity with which ERs have been shown to act as ligandactivated transcription factors, it became apparent that not all of the physiological effects mediated by estrogens are accomplished through a direct effect on gene transcription. Another signaling pathway (also known as “non-classic”, “non-genomic”, “extranuclear”, “rapid signaling” or “membrane-initiated signaling”) exists that involves cytoplasmic signaling proteins, growth factors and their receptors, and other membrane-initiated signaling pathways [4–6]. Specific plasma membrane binding sites for estrogen were identified in endometrial cells in 1977 [7] and later in breast cancer cells [8]. Several studies indicated that both ER-a
* Corresponding author at: Department of Medical Microbiology and Immunology, Creighton University Medical School, Criss III, Room 352, 2500 California Plaza, Omaha, NE 68178, USA. Fax: +1 402 280 3543. E-mail address: [email protected] (Z.-Y. Wang). http://dx.doi.org/10.1016/j.jsbmb.2014.06.009 0960-0760/ ã 2014 Elsevier Ltd. All rights reserved.
and b are localized at the plasma membrane and are involved in the rapid estrogen signaling [9–12]. However, further evidence indicates that more than one membrane-initiated signaling pathway is associated with estrogen action. A body of evidence from several laboratories using the membrane-impermeable compound 17-b-estradiol (E2b)-bovine serum albumin (E2bBSA) indicates the existence of two functionally distinct rapid estrogen-signaling pathways: one sensitive to antiestrogens and one resistant [13–15]. ER-a/knockout mice retained rapid estrogen-stimulated effects in neurons, which were not blocked by ICI182, 780 [16]. These data suggest that other membrane-based ER(s) or estrogen binding protein(s) may exist since all known ERs are sensitive to ICI-182, 780. The possibility that estrogen binds to other receptors belonging to an entirely different family of proteins has been suggested by the reports that the G-protein-coupled and seven-transmembrane receptor, GPR30, may function as an estrogen receptor that transduces antiestrogen resistant rapid estrogen signaling [17,18]. Accumulating evidence indicated that the rapid estrogen signaling that involves the MAPK/ERK and the PI3K/AKT signaling pathways mediate proliferative and anti-apoptotic effects of estrogen in a variety of normal and cancer cells [4–6]. However,
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
although the rapid estrogen signaling has been reported by many laboratories, the induction of the MAPK/ERK and the PI3K/AKT signaling by E2b in ER-positive breast cancer cells has been continuously questioned. It has been reported that the activation of the MAPK/ERK by E2b is a poorly reproducible event and can be observed also in mock-treated cells [19,20]. Lobenhofer et al. also failed to detect any activation of the MAPK/ERK signaling in MCF7 cells [21,22]. The basis of these conflicting reports regarding the activation of the MAPK/ERK and the PI3K/AKT by E2b has not been well understood although the inherent differences in MCF7 cells sublines, different conditions for maintaining cells, staging cells in E2b-free medium, the ways of treating cells with E2b, lysing cells and assessing activation may contribute the conflicting results of the rapid estrogen signaling in ER-positive breast cancer cells [20]. Previously, our laboratory identified and cloned a 36 kDa variant of ER-a, ER-a36, that is mainly associated with the plasma membrane and mediates rapid estrogen signaling such as the activation of the MAPK/ERK, the PI3K/AKT and the PKC signaling pathways in breast and endometrial cancer cells [23–26]. ER-a36 lacks both transcription activation domains AF-1 and AF-2 of the 66 kDa full-length ER-a (ER-a66), and possesses an intact DNAbinding domain, consistent with the fact that ER-a36 has no intrinsic transcriptional activity but inhibits transcriptional transactivation activities of ER-a66 and ER-b [24]. Here, we demonstrated that ERa36 is the receptor that mediates estrogen induction of the MAPK/ ERK signaling pathway in ER-positive breast cancer cells while the full-length ER-a, ER-a66, failed to do so. We also studied the molecular events in ER-a36-mediated rapid estrogen signaling. 2. Materials and methods 2.1. Chemicals and antibodies 17b-estradiol (E2b) was purchased from Sigma Chemical Co. (St. Louis, MO). The broad-spectrum matrix metalloproteinase (MMP) inhibitor Galardin (GM6001) and the Src inhibitor PP2 were from Tocris Bioscience (Ellisville, MO). The EGFR inhibitor AG1478, the IGF-1R inhibitor AG1024 and the HER2 inhibitor AG825 were purchased from EMD Chemicals (Gibbstown, NJ). Anti-HER2 neutralizing antibody was purchased from CD BioSciences Inc. (Shirley, NY). Neutralizing antibodies for HB-EGF, amphiregulin and IGF-1R were purchased from R&D system (Minneapolis, MN). Anti-EGFR neutralizing antibody was obtained from EMD Millipore (Billerica, MA). Anti-phospho-p44/42 ERK (Thr202/Tyr204) (197G2) mouse monoclonal antibody (mAb), anti-p44/42 ERK (137F5) rabbit mAb, anti-phospho-EGFR (Tyr1045) and -HER2/ ErbB2 (Tyr1221/1222) as well as anti-EGFR and -HER2/ErbB2 (D8F12) antibodies were all purchased from Cell Signaling Technology (Boston, MA). Antibodies of ER-a66 and b-actin as well as normal mouse IgG were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Polyclonal anti-ER-a36 specific antibody was generated and characterized as described before [27]. Briefly, the anti-ER-a36 polyclonal antibody was custom made by Pacific Immunology Corp. (Ramona, CA) which is an affinity purified antibody against the 20 AA (GISHVEAKKRILNLHPKIFG) of the ER-a36 that is unique to ER-a36. 2.2. Cell culture and treatment Relatively low-passage MCF7 cells (75 passages. T47D cells were originally obtained from ATCC. H3396 cells were kindly provided by Dr. Leia Smith at the Seattle Genetics Inc. All parental and derivative cells were maintained at 37 C in a 10% CO2 atmosphere in IMEM without phenol-red and 10% fetal calf serum in a humidified incubator. For estrogen treatment, cells were maintained in phenol red-free media with 2.5% charcoal-stripped fetal calf serum (HyClone, Logan, UT) for three days, and then in serumfree medium for 12 h before experimentation. For ERK activation assays, cells were treated with vehicle (ethanol) and indicated concentrations of E2b for different periods of time. To test the effects of different neutralizing antibodies and chemical inhibitors, antibodies and inhibitors were added 10 min before E2b addition. 2.3. Establishment of stable cell lines MCF7 cells stably transfected with an ER-a36 expression vector, MCF7/ER36, were established as described before [27]. To establish stable cell lines with ER-a36 expression knocked-down, we constructed two ER-a36 specific shRNA expression vectors by cloning the DNA oligonucleotides 50 -GATGCCAATAGGTACTGAATTGATATCCGTTCAGTACCTATTGGCATC-30 and 50 -AACCGTACCACTCTGCTGATTGATATCCGTCAGCAGAGTGGTACGGTT-30 from different potions of the 30 UTR of ER-a36 cDNA (positions 3026– 3044 AND 4261–4278, respectively. Sequence ID: BX640939.1) into the pRNAT-U6.1/Neo expression vector from GenScript Corp. (Piscataway, NJ) and were named as pSi36-1 and pSi36-3, respectively. To establish stable cell lines with ER-a66 expression knocked down, we constructed two ER-a66 specific shRNA expression vectors by cloning the DNA oligonucleotides 50 -ATGCTGTACAGATGCTCCATTGATATCCGTGGAGCATCTGTACAGCATGA-30 and 50 -ACTCATGTGCCTGATGTGGTTGATATCCGCCACATCAGGCACATGAGT-30 from different potions of the ER-a66 cDNA that is unique for ER-a66 (positions 1783–1800 and 1751–1769, respectively. Sequence ID: NM001291241) into the pRNAT-U6.1/ Neo expression vector and were named as pSi66-2 and pSi66-4, respectively. MCF7 cells stably transfected with the empty expression vector, an control vector expressing shRNA for luciferase, Si36-1 and -3, Si66-2 and -4 were cloned and named as MCF7/SiV, MCF7/SiL, MCF7/Si36 (3–1) and MCF7/Si36 (1–7), MCF7/Si66 (2–5) and MCF7/Si66 (4–3). For T47D cells, cells stably transfected with the empty expression vector, the pSi363 or the pSi66-2 expression vectors were selected for three weeks, and more than 20 individual clones of selected cells were pooled and were named as T47D/SiV, T47D/Si36 and T47D/Si66. H3396 cells with knocked-down levels of ER-a36 expression were established as described above with the pSi36-3 expression vector. 2.4. RNA purification and RT-PCR Total RNA was prepared with the “TRIzol” RNA purification reagent. One microgram of total RNA was reversely transcribed using the ProtoScript II RT-PCR kit (New England Biolabs, Ipswich, MA) with random primers at 42 C for 1 h. RT-PCR analysis of ER-a36, ER-a66 and b-actin was performed using gene specific primers as the following:
Gene
Forward primer
Reverse primer
b-Actin ER-a36 ER-a66
TGACGGGGTCACCCACACTGTGCCCATCTA CAAGTGGTTTCCTCGTGTCTAAAG CACTCAACAGCGTGTCTCCGA
CTAGAAGCATTTGCGGTGGACGATGGAGGG TGTTGAGTGTTGGTTGCCAGG CCAATCTTTCTCTGCCACCCTG
436
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
PCR procedure was carried out as described before [32]. PCR products were analyzed by electrophoresis in a 1.5% agarose gel and visualized by ethidium bromide staining under UV illumination. 2.5. Flow cytometry analysis For cell cycle analysis, cells at 70% confluence were harvested and 1 ml of cold 70% ethanol was slowly added to the cell pellet while vortexing. Ethanol-fixed cells were treated with 100 mg/ml RNase A and 50 mg/ml propidium iodide (PI) in PBS at room temperature for 30 min. Flow cytometry analysis of cell cycle distribution was performed using a FACSCalibur flow cytometer (BD-Biosciences). The experiment was repeated three times. 2.6. Immunoblot analysis Western blot analysis was performed as described before [27]. All Western blot experiments were performed at least three times. Band densities on developed films were measured and analyzed using Quantity One 1-D Analysis Software Version 4.6.7 (BIO-RAD Laboratories). 2.7. Statistical analysis Data were summarized as the mean standard error (SE) using the GraphPad InStat software program. Tukey–Kramer Multiple Comparisons Test was also used, and the significance was accepted for P < 0.05. 3. Results 3.1. Estrogen induces ER-a36 expression and a delayed ERK activation in ER-positive breast cancer MCF7 cells First, we examined the steady state levels of ER-a36 expression in three ER-positive breast cancer cell lines, MCF7, T47D and H3396, and found that all cells expressed endogenous ER-a36 with MCF7 cells exhibiting the lowest levels of ER-a36 protein (Fig. 1A). We then examined ER-a36 expression in MCF7 cells treated with 1 nM of 17b-estradiol (E2b) for different time periods. Western blot analysis revealed that ER-a36 expression was upregulated in MCF7 cells treated with E2b; started at 2 h, peaked at 18 h and started to return the basal levels at 36 h. On the contrary, the steady state levels of ER-a66 protein were decreased by E2b in 45 min, and returned to the basal level at 36 h (Fig. 1B), consistent with the previous reports that estrogen destabilizes ER-a66 protein [28,29]. In addition, we also found that the steady state levels of EGFR and HER2 proteins were also upregulated by E2b treatment (Fig. 1B). Previously, we reported that EGFR and HER2 signaling upregulated ER-a36 expression via an Ap1 binding site in the ER-a36 promoter region [30,31]. To examine whether EGFR and HER2 signaling is involved in the induction of ER-a36 expression by E2b, we treated MCF7 cells with the dual kinase inhibitor Lapatinib together with E2b and found that the EGFR/HER2 inhibitor blocked E2b induction of ER-a36 (Fig. 1C). We also noted that EGFR and HER2 expression was also downregulated by Lapatinib (Fig. 1C). Thus, our results demonstrated that E2b treatment upregulated ER-a36 expression presumably through the EGFR and HER2 signaling. To determine whether E2b induces phosphorylation of the MAPK/ERK1/2, a typical rapid estrogen-signaling event, in MCF7 cells, we treated cells with E2b for different time periods. Western blot analysis was performed to assess the phosphorylation levels of the ERK1/2. Fig. 1D shows that in MCF7 cells, E2b elicited a delayed
ERK phosphorylation; started around 2 h after E2b stimulation. Time course analysis in ER-positive breast cancer T47D and H3396 cells, however, revealed that ERK phosphorylation occurred within 5 min after E2b application, peaked at 15–30 min, returned to the basal level at 45 min and then exhibited another more sustained activation at 4 h (Fig. 1D). We then tested E2b-induced ERK phosphorylation in MCF7 cells stably transfected with an ER-a36 expression vector, MCF7/ ER36 cells (Fig. 1A). We found that in MCF7/ER36 cells, E2b induced ERK phosphorylation in 5 min, peaked at 15 min and returned to the basal level at 45 min (Fig. 1D), similar to the patterns observed in T47D and H3396 cells that express high levels of endogenous ER-a36. Our results thus suggested that ER-a36 might mediate estrogen induction of the MAPK/ERK phosphorylation in these cells. To examine the effects of E2b-induced ERK phosphorylation on estrogen-stimulated cell proliferation, we examined estrogenstimulated G1/S phase progression in these ER-positive breast cancer cells. As shown in Fig. 1E, MCF7 cells treated with E2b exhibited a dramatically increased G1/S phase progression with the S phase peaked at 36 h. In T47D and H3396 as well as MCF7/ER36 cells, however, E2b stimulated the G1/S phase progression that peaked at 18 h. Our data thus suggested that breast cancer cells with low levels of endogenous ER-a36 expression exhibited a delayed mitogenic estrogen signaling. 3.2. High passage MCF7 cells express high levels of endogenous ER-a36 and exhibit a rapid estrogen induction of the MAPK/ERK Previously, we observed that ER-a36 was highly expressed in MCF7 cells compared to T47D cells [24]. During our research, we found the MCF7 cells used before were cells with high-passage (>75 passages) compared to the MCF7 cells used in this study. Western blot analysis confirmed that the high passage MCF7 cells expressed high levels of endogenous ER-a36 as well as EGFR and HER2 (Fig. 2A). The high-passage MCF7 cells exhibited a rapid activation of the MAPK/ERK in response to estrogen stimulation in a pattern similar to T47D, H3396 and MCF7/ER36 cells (Fig. 2B). Our results thus provided a molecular explanation to the previous discrepancy of the rapid ERK activation induced by estrogen in MCF7 cells; different MCF7 sub-lines may be used in different laboratories. Our results also suggested that enhanced expression of EGFR and HER2 may be a mechanism of upregulated ER-a36 expression in high passage MCF7 cells. 3.3. ER-a36 mediates estrogen induction of the MAPK/ERK signaling in ER-positive breast cancer cells To determine if ER-a36 is involved in rapid estrogen signaling of ER-positive breast cancer cells, we designed two shRNA expression vectors targeting different regions of the 30 UTR of ER-a36 that is unique to ER-a36, and established two clonal and stable cell lines from MCF7 cells that express these two different shRNAs (MCF7/ Si36 1–10 and 3–8), respectively. MCF7 cells stably transfected with an empty expression vector (MCF7/SiV) or an expression vector for shRNA against firefly luciferase (MCF7/SiL) were used as controls. Both Western blot analysis and RT-PCR demonstrated that the ER-a36 expression was knocked-down about 80% in the MCF7/ Si36 1–10 and 3–8 cell lines compared to parental (MCF7/P) and control cells (MCF7/SiV and MCF7/SiL) (Fig. 3A). However, the expression levels of ER-a66 mRNA and protein were intact (Fig. 3A). E2b (1 nM) treatment failed to induce the MAPK/ERK phosphorylation in the MCF7/Si36 (1–10) and (3–8) cells in 12 h period (Fig. 3B). To exclude the possibility that ER-a66 may have a ligand affinity different from that of ER-a36, we also examined the MAPK/ERK activation in the MCF7/Si36 cells treated with different
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
437
Fig. 1. Estrogen induces ER-a36 expression and a delayed ERK activation in ER-positive breast cancer MCF7 cells. (A) The expression of ER-a variants in MCF7, T47D, H3396 and MCF7/ER-a36 breast cancer cells. (B) The time dependent pattern of E2b-regulated expression of ER-a36 and 66 as well as EGFR and HER2 in MCF7 cells. Starved cells were treated with 1 nM of E2b for indicated time periods. Western blot analysis was performed to assess ER-a variant expression. The representative results are shown, and the band density relative to b-actin is shown below with each point represents the means of three experiments; bars, SE. (C) Western blot analysis of ER-a36, HER2 and EGFR in MCF7 cells treated with 1 nM of E2b alone or together with 5 mM of Lapatinib (Lap) for 18 h. (D) The pattern of E2b-induced ERK phosphorylation in ER-positive breast cancer cells. Starved cells were treated with 1 nM of E2b for indicated time periods. Western blot analysis was performed to assess ERK phosphorylation. The representative results are shown, and the band density relative to total ERK is shown below with each point represents the means of three experiments; bars, SE. (E) The effects of E2b on the G1/S progression in different ER-positive breast cancer cells. Starved cells were treated with 1 nM of E2b for indicated time periods. Flow cytometry analysis was performed to examine cell populations in the S phase of the cell cycle. Each point represents the means of three experiments; bars, SE.
438
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
Fig. 2. High passage MCF7 cells express high levels of endogenous ER-a36 and exhibit a rapid estrogen induction of the MAPK/ERK. (A) Western blot of ER-a36 an d66 as well as EGFR and HER2 expression in MCF7 cells with different passage; low-passage MCF7 cells (75 passages), MCF7high cells. (B) Western blot analysis of the effects of E2b (1 nM) on ERK phosphorylation in different MCF7 cell sublines. (C) The p-ERK intensity relative to total ERK is shown with each point represents the means of three experiments; bars, SE.
concentrations of E2b for 8 h. We still were unable to observe induction of the ERK phosphorylation in these cells (Fig. 3C). To confirm these results, we also established a stable cell line from T47D by stable transfection of one of the shRNA expression vectors for ER-a36 (T47D/Si36) and a control cell line by stable transfection of the empty expression vector (T47D/SiV) (Fig. 3D). E2b failed to activate the MAPK/ERK signaling in the T47D/Si36 cells while the T47D/SiV cells were fully responsive to E2b (Fig. 3E). However, serum was able to induce ERK activation in the MCF7 and T47D cells with knocked-down levels of ER-a36 expression (Supplement Fig. S1), indicating there was no global defect of the MAPK/ERK signaling pathway in cells with ER-a36 expression knocked-down. Similar results were also observed in ER-positive breast cancer H3396 cells with knocked-down levels of ER-a36 (Fig. 3D and E). Altogether, our results indicated that ER-a36 plays a critical role in the rapid estrogen signaling of ER-positive breast cancer cells. 3.4. ER-a66 does not mediate estrogen induction of the MAPK/ERK in ER-positive breast cancer cells We then decided to examine the function of ER-a66 in the rapid estrogen signaling of ER-positive breast cancer cells. This time, we designed two shRNA expression vectors specifically targeting different regions of the 30 UTR of ER-a66 to specifically knock down ER-a66 expression. We established two clonal and stable cell lines from MCF7 cells that express these two different shRNAs (MCF7/ Si66, 2–5 and 4–3), respectively. MCF7/SiV and MCF7/SiL cells were used as controls. Both Western blot analysis and RT-PCR indicated that ER-a66 expression was knocked down about 90% in the MCF7/ Si66 (2–5) and (4–3) cells compared with control cells while the ER-a36 expression was increased modestly (Fig. 4A), consistent with our previous report that ER-a66 suppresses ER-a36 promoter
activity [32]. E2b treatment strongly induced the MAPK/ERK phosphorylation in the MCF7/Si66 cells, in a pattern similar to that of MCF7/ER36 (Fig. 4B). We also established a stable cell line from T47D cells by transfection of one of the ER-a66 specific shRNA expression vectors (T47D/Si66) and a control cell line T47D/SiV. Western blot confirmed that the ER-a66 expression was knocked down more than 80% in the T47D/Si66 cells compared to the T47D/SiV cells (Fig. 4C). E2b potently activated the MAPK/ERK in the T47D/Si66 cells (Fig. 4D). Altogether, our results demonstrated that ER-a36 but not ER-a66 mediates estrogen induction of the MAPK/ERK in ER-positive breast cancer cells. 3.5. HB-EGF, amphiregulin, EGFR, HER2, IGF-1R and Src are involved in ER-a36-mediated rapid estrogen signaling of ER-positive breast cancer cells We then decided to investigate the molecular events in ER-a36mediated rapid estrogen signaling. Western blot analysis was performed to examine estrogen-induced ERK phosphorylation in MCF7/ER36 cells pre-treated with different neutralizing antibodies including anti-HB-EGF, amphiregulin (AREG), EGFR, HER2 and IGF1R antibodies. Fig. 5A shows that in MCF7/ER36 cells pre-treated with mouse IgG, ERK phosphorylation was induced by estrogen within 5 min, peaked at 30 min, returned to the basal level at 45 min (the first peak) and then exhibited another more sustained activation from 2 to 18 h (the second peak). Pre-treatment with the anti-HB-EGF antibody, however, diminished the first and second peaks of ERK phosphorylation and there appeared another peak from 12 to 24 h (Fig. 5A), suggesting that HB-EGF is involved in the first and second peaks of ERK phosphorylation. Anti-AREG antibody pre-treatment only inhibited the second peak, and there appeared another peak from 12 to 18 h, suggesting that AREG
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
439
Fig. 3. ER-a36 mediates rapid and mitogenic estrogen signaling in ER-positive breast cancer cells. (A) Western blot and RT-PCR analyses of ER-a36 and ER-a66 expression in different MCF7 cell variants; parental cells (MCF7/P), control cells (MCF7/SiV, transfected with the empty expression vector; MCF7/SiL transfected with a luciferase shRNA expression vector), and ER-a36 expression knocked-down cells [MCF7/Si36 (1–10) and MCF7/Si36 (3–8)]. (B) Western blot analysis of the effects of E2b (1 nM) on ERK phosphorylation in different MCF7 cell variants. The p-ERK intensity relative to total ERK is shown below with each point represents the means of three experiments; bars, SE. (C) Western blot analysis of the effects of different concentrations of E2b on ERK phosphorylation in different MCF7 cell variants. The p-ERK intensity relative to total ERK is shown below with each point represents the means of three experiments; bars, SE (D) Expression levels of ER-a36 and 66 in control T47D and H3396 cells (T47D/SiV and H3396/SiV, transfected with the empty expression vector) and ER-a36 expression knocked down T47D and H3396 cells (T47D/Si36 and H3396/Si36) analyzed by Western blot analyses. (E) E2b-induced ERK phosphorylation in T47D and H3396 variants.
440
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
Fig. 4. ER-a66 does not mediate rapid and mitogenic estrogen signaling in ER-positive breast cancer cells. (A) Western blot and RT-PCR analyses of ER-a36 and ER-a66 expression in different MCF7 cell variants; parental cells (MCF7/P), control cells (MCF7/SiV and MCF7/SiL), and ER-a66 expression knocked-down cells [MCF7/Si66 (2–5) and MCF7/Si36 (4–3)]. (B) Western blot analysis of the effects of E2b on ERK phosphorylation in different MCF7 cell variants. The p-ERK intensity relative to total ERK is shown below with each point represents the means of three experiments; bars, SE. (C) Expression levels of ER-a36 and 66 in control T47D (T47D/SiV transfected with the empty expression vector) and ER-a66 expression knocked down T47D (T47D/Si66) analyzed by Western blot analyses. (D) E2b induced ERK phosphorylation in T47D variants. The pERK intensity relative to total ERK is shown below with each point represents the means of three experiments; bars, SE.
induced the second peak. Anti-HER2, anti-EGFR and IGF-1R antibodies potently inhibited the first peak of the ERK activation induced by HB-EGF while partially blocked the second peak (Fig. 5A). Similar experiments were also performed in MCF7 cells.
In the MCF7 cells pre-treated with mouse IgG, ERK phosphorylation were induced by E2b peaked at 8 h that was blocked by neutralizing antibodies for HB-EGF and IGF-1R (Fig. 5B) while antibodies for AREG and EGFR had less effects, suggesting that a
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
441
Fig. 5. HB-EGF, Amphiregulin, EGFR, HER2 and IGF-1R are involved in rapid estrogen signaling in ER-positive breast cancer cells. (A and B) Western blot analysis of E2b-induced ERK phosphorylation and total ERK expression in MCF7/ER36 and MCF7 cells pretreated with neutralizing antibodies. Starved cells were pretreated with the control IgG and indicated neutralizing antibodies before E2b treatment for different time periods. Western blot analysis was performed with phospho-specific or non-specific anti-ERK1/2 antibody. The p-ERK intensity relative to total ERK is shown in Supplement Fig. S3. (C) Western blot analysis of E2b-induced ERK phosphorylation and total ERK expression in MCF7/ER36 cells pretreated with different chemical inhibitors. Starved cells were pretreated with vehicle and indicated inhibitors before E2b treatment for different time periods. Western blot analysis was performed with phospho-specific or non-specific anti-ERK1/2 antibody. Representative experiment results are shown. The p-ERK intensity relative to total ERK is shown in Supplement Fig. S4.
delayed HB-EGF activity is involved in the 8 h peak of ERK phosphorylation observed in MCF7 cells. To confirm these results, we performed similar experiments in MCF7/ER36 cells using chemical inhibitors including the EGFR inhibitor AG1478, the IGF-1R inhibitor AG1024, the HER inhibitor AG825, the Src inhibitor PP2 and a broad-spectrum matrix metalloproteinase (MMP) inhibitor Galardin (GM6001). We found that all of the inhibitors potently blocked the first peak of ERK phosphorylation while had less effect on the second peak (Fig. 5C), suggesting that EGFR, IGF-1R, HER2 and Src are all involved in the activities of HBEGF that is presumably released by MMP [33,34]. 4. Discussion The rapid and transient ERK activation is a typical event of the rapid estrogen signaling that has been reported in ER-positive breast cancer MCF7 cells [35] as well as in other types of cells such as endothelial cells, neural cells and osteoblasts [4–6]. However, the induction of the MAPK/ERK signaling by E2b in ER-positive breast cancer cells remains controversial. In this study, we demonstrated that estrogen induced a delayed ERK activation in ER-positive breast cancer MCF7 cells that coincided with estrogen induction of ER-a36 expression. We further found that highpassage MCF7 cells (>75 passages) express high levels of endogenous ER-a36 protein. The high-passage MCF7 cells exhibited a rapid activation of the MAPK/ERK in response to estrogen stimulation in a pattern similar to T47D, H3396 and MCF7/ER36 cells, all of which express high levels of ER-a36. These results thus may provide a molecular explanation to the previous discrepancy of the rapid ERK activation induced by estrogen in MCF7 cells; different MCF7 sub-lines may be used in different laboratories and most experiments were performed within 1 h. During our research, we also observed enhanced ER-a36 expression in cells cultured in high density and fresh serum (data not shown), suggesting that ER-a36 expression is also influenced by conditions of maintaining cells and staging cells in E2b-free medium. Previously, we reported the existence of cross-regulatory loops between ER-a36 and EGFR/HER2 [30,31]; ER-a36 positively regulates EGFR and HER2 expression while EGFR and HER2 upregulate the promoter activity of ER-a36 through an Ap1 binding site located in the 50 flanking sequence of ER-a36 gene. Recently, Li et al., reported that transfection of an ER-a36 expression vector
into MCF7 cells increased EGFR expression [35]. Here, we found that E2b treatment increased the steady state levels of EGFR and HER2 proteins in a pattern similar to ER-a36 and the dual kinase inhibitor Lapatinib diminished estrogen induction of ER-a36. In addition, enhanced expression of EGFR, HER2 and ER-a36 was also found in the high-passage MCF7 cells. Together, our results indicated that EGFR and HER2 signaling is involved in upregulation of ER-a36 expression by estrogen and in the increased ER-a36 expression of the high-passage MCF7 cells. It is worth noting that Lapatinib also blocked induction of EGFR and HER2 by estrogen, suggesting the positive regulatory loops between ER-a36 and EGFR/HER2 is involved in induction of EGFR and HER2 by estrogen. Thus, the fact that both EGFR and HER2 are involved in ER-a36mediated rapid estrogen signaling indicated that coordinated induction of EGFR, HER2 and ER-a36 by estrogen is a pre-requisite for rapid estrogen signaling. Here, we further used the shRNA specifically targeting ER-a66 or 36 to knock-down expression of ER-a66 or 36 individually and found that the cells with ER-a36 expression knocked-down lacked estrogen induction of the MAPK/ERK. On the contrary, the cells with ER-a66 expression knocked-down still responded to rapid estrogen signaling. Thus, our results, for the first time, demonstrated that the estrogen induction of the MAPK/ERK signaling is mediated by ER-a36 in ER-positive breast cancer cells. Previous reports have indicated that ER-a66 and ER-b mediate the rapid estrogen signaling such as the activation of the MAPK/ERK signaling based on experiments involving transfection of these ER cDNAs into reportedly ER-deficient cell lines such as CHO-K1 [9], COS-7 [36], Rat2 fibroblasts [37]. Later, however, Nethrapalli et al. demonstrated that estrogen activated the MAPK/ERK signaling in native, non-transfected CHO-K1, COS-7 and RAT2 fibroblast cells [38]. Previously, we also reported that nontransfected COS-7 cells expressed endogenous ER-a36 and exhibited the rapid estrogen signaling [39]. Together, these results suggested that the cells null for ER-a66 used as models to study the rapid estrogen action may already express endogenous ER-a36 and are able to elicit the rapid estrogen signaling. Previously, Razandi et al. reported that HB-EGF released by matrix metalloproteinases (MMP)-2 and -9 that are activated by the G protein-coupled estrogen receptors via Src signaling is responsible for estrogen-induced activation of the EGFR and the MAPK/ERK in MCF7 cells [33]. Later, Song et al., reported that IGFIR is also involved in the rapid estrogen signaling of MCF7 cells and
442
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443
postulated a model that E2b activates a linear pathway involving the sequential activation of IGF-IR, MMP, HB-EGF, EGFR, and MAPK/ ERK [34]. Our current results are in good agreement with the previous findings. Here, we also found that MCF7/ER36 cells exhibited several cycles of ERK activation by E2b. Using neutralizing antibodies and chemical inhibitors, we found that the estrogen-induced first and second peaks of the ERK activation was blocked by the anti-HB-EGF neutralizing antibody while the anti-AREG antibody only blocked the second peak of ERK activation, suggesting HB-EGF is involved in the ERK activation induced by AREG. It has been reported that estrogen induces AREG expression in MCF7 cells [36]. Our results here suggested that it is possible that HB-EGF is involved in estrogen induction of AREG expression. In this study, we also found that in the low-passage MCF7 cells, estrogen induced a delayed ERK activation by E2b; peaked at 4 h after estrogen treatment, which coincided with the time frame of ER-a36 expression induced by estrogen. Again, the anti-HB-EGF antibody blocked the ERK activation at 4 h, indicating that the delayed ERK activation in the low-passage MCF7 cells employs a similar signaling pathway as the rapid ERK activation found in the cells with high levels of ER-a36. Thus, the initiation of the rapid estrogen signaling in ER-positive breast cancer cells is a highly synchronized process that involves a number of growth factors and their receptors, consistent with the view that estrogens act as growth factors [40]. In summary, we demonstrated here that ER-a36 is the estrogen receptor that mediates rapid estrogen signaling in ER-positive breast cancer cells through coordinated actions of different growth factors and their receptors. Our results thus provided a novel mechanism for the functional communication among these signaling pathways. ER-a66, on the other hand, lacks such activities. Thus, ER-a36 is a critical player in rapid estrogen signaling that may play important roles in mammary tumorigenesis and possible in other types of estrogen related tumors as well. Acknowledgements This work was supported by Department of Defense grant DAMD 11-1-0497, and by Nebraska Tobacco Settlement Biomedical Research Program Award LB595 to Z.Y. Wang. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jsbmb.2014.06.009. References [1] S. Nilsson, S. Mäkelä, E. Treuter, M. Tujague, J. Thomsen, G. Andersson, E. Enmark, K. Pettersson, M. Warner, J.A. Gustafsson, Mechanisms of estrogen action, Physiol. Rev. 81 (4) (2001) 1535–1565. [2] B.W. O’Malley, R. Kumar, Nuclear receptor coregulators in cancer biology, Cancer Res. 69 (21) (2009) 8217–8222. [3] N. Heldring, A. Pike, S. Andersson, J. Matthews, G. Cheng, J. Hartrman, M. Tujague, A. Ström, E. Treuter, M. Wanter, et al., Estrogen receptors: how do they signal and what are their targets, Physiol. Rev. 87 (3) (2007) 905–931. [4] M.J. Kelly, E.R. Levin, Rapid actions of plasma membrane estrogen receptors, Trends Endocrinol. Metab. 12 (4) (2001) 152–156. [5] E.R. Levin, Plasma membrane estrogen receptors, Trends Endocrinol. Metab. 20 (10) (2009) 477–482. [6] F. Acconcial, M. Marino, The effects of 17b-estradiol in cancer are mediated by estrogen receptor signaling at the plasma membrane, Front. Physiol. 2 (30) (2011) 1–8. [7] R.J. Pietras, C.M. Szego, Specific binding sites for oestrogen at the outer surfaces of isolated endometrial cells, Nature 265 (5589) (1977) 69–72. [8] Y. Berthois, N. Pourreau-Schneider, P. Gandilhon, H. Mittrea, N. Tubiana, P.M. Martina, Estrodiol membrane binding sites on human breast cancer cell lines. Use of a fluorescent estradiol conjugate to demonstrate plasma membrane binding systems, J. Steroid Biochem. 25 (6) (1986) 963–972.
[9] M. Razandi, A. Pedram, G.L. Greene, E.R. Levin, Cell membrane and nuclear estrogen recptors (ERs) originate from a single transcript: studies of ERalpha and ERbeta expressed in Chinese hamster ovary cells, Mol. Endocrinol. 13 (2) (1999) 307–319. [10] A. Pedram, M. Razandi, E.R. Levin, Nature of functional estrogen receptors at the plasma membrane, Mol. Endocrinol. 20 (9) (2006) 1996–2009. [11] S.R. Hammes, E.R. Levin, Extranuclear steroid receptors: nature and actions, Endocr. Rev. 28 (7) (2007) 726–741. [12] M. Marino, P. Ascenzi, Membrane association of estrogen receptor alpha and beta influences 17beta-estradiol-mediated cancer cell proliferation, Steroids 73 (9–10) (2008) 853–858. [13] Z. Chen, I.S. Yuhanna, Z. Galcheva-Gargova, R.H. Karas, M.E. Mendelsohn, P.W. Shaul, Estrogen receptor a mediates the nongenomic activation of endothelial nitric oxide synthase by estrogen, J. Clin. Investig. 103 (103) (1999) 401–406. [14] K.S. Russell, M.P. Haynes, D. Sinha, E. Clerisme, J.R. Bender, Human vascular endothelial cells contain membrane binding sites for estradiol, which mediate rapid intracellular signaling, Proc. Natl. Acad. Sci. U. S. A. 97 (11) (2000) 5930–5935. [15] J.J. Watters, J.S. Campbell, M.J. Cunningham, E.G. Krebs, D.M. Dorsa, Rapid membrane effects of steroids in neuroblastoma cells: effects of estrogen on mitogen activated protein kinase signaling cascade and c-fos immediate early gene transcription, Endocrinology 138 (9) (1997) 4030–4033. [16] Q. Gu, K.S. Korach, R.L. Moss, Rapid action of 17beta-estradiol on kainiteinduced currents in hippocampal reurons lacking intracellular estrogen receptor, Endocrinology 140 (2) (1999) 660–666. [17] E.J. Filardo, J.A. Qiunn, K.I. Bland, A.R. Frackelton Jr., Estrogen induced activation of Erk-1 and Erk-2 requires the G protein-coupled receptor homolog, GPR30, and occurs via transactivation of the epidermal growth factor receptor through release of HB-EGF, Mol. Endocrinol. 14 (10) (2001) 1649–1660. [18] C.M. Revankar, D.F. Cimino, L.A. Sklar, J.B. Arterburn, E.R. Prossnitz, A transmembrane intracellular estrogen receptor mediates rapid cell signaling, Science 307 (5715) (2005) 1625–1630. [19] S. Caristi, J.L. Galera, F. Matarese, M. Imai, S. Caporali, M. Cancemi, L. Altucci, L. Cicatiello, D. Teti, F. Bresciani, et al., Estrogens do not modify MAP kinasedependent nuclear signaling during stimulation of early G (1) progression in human breast cancer cells, Cancer Res. 61 (17) (2001) 6360–6366. [20] S.L. Brower, J.R. Roberts, J.M. Antonini, M.R. Miller, Difficulty demonstrating estradiol-mediated Erk1/2 phosphorylation in MCF-7 cells, J. Steroid Biochem. Mol. Biol. 96 (5) (2005) 375–385. [21] E.K. Lobenhofer, J.R. Marks, Estrogen-induced mitogenesis of MCF-7 cells does not require the induction of mitogen-activated protein kinase activity, J. Steroid Biochem. Mol. Biol. 75 (1) (2000) 11–20. [22] E.K. Lobenhofer, G. Huper, J.D. Iglehart, J.R. Marks, Inhibition of mitogenactivated protein kinase and phosphatidylinositol 3-kinase activity in MCF-7 cells prevents estrogen-induced mitogenesis, Cell Growth Differ. 11 (2) (2000) 99–110. [23] Z.Y. Wang, X.T. Zhang, P. Shen, B.W. Loggie, Y. Chang, T.F. Deuel, Identification, cloning, and expression of human estrogen receptor-alpha36, a novel variant of human estrogen receptor-alpha66, Biochem. Biophys. Res. Commun. 336 (4) (2005) 1023–1027. [24] Z.Y. Wang, X.T. Zhang, P. Shen, B.W. Loggie, Y. Chang, T.F. Deuel, A variant of estrogen receptor-{alpha}, hER-{alpha}36: transduction of estrogen- and antiestrogen-dependent membrane-initiated mitogenic signaling, Proc. Natl. Acad. Sci. U. S. A. 103 (24) (2006) 9063–9068. [25] S.L. Lin, L.Y. Yan, X.T. Zhang, J. Yuan, M. Li, J. Qiao, Z.Y. Wang, Q.Y. Sun, ERalpha36, a variant of ER-alpha, promotes tamoxifen agonist action in endometrial cancer cells via the MAPK/ERK and PI3K/Akt pathways, PLoS One 5 (2) (2010) e9013. [26] J.S. Tong, Q.H. Zhang, Z.B. Wang, S. Li, C.R. Yang, X.Q. Fu, Y. Hou, Z.Y. Wang, J. Sheng, Q.Y. Sun, ER-a36, a novel variant of ER-a, mediates estrogenstimulated proliferation of endometrial carcinoma cells via the PKCd/ERK pathway, PLoS One 5 (11) (2010) e15408. [27] X.T. Zhang, Z.Y. Wang, Estrogen receptor-a variant, ER-a36, is involved in tamoxifen resistance and estrogen hypersensitivity, Endocrinology 154 (6) (2013) 1990–1998. [28] Z. Nawaz, D.M. Lonard, A.P. Dennis, C.L. Smith, B.W. O’Malley, Proteasomedependent degradation of the human estrogen receptor, Proc. Natl. Acad. Sci. U. S. A. 96 (5) (1999) 1858–1862. [29] C. Mathilde, H. Richard-Foy, Ligand-induced estrogen receptor a degradation by the proteasome: new actors? Nucl. Recept. Signal. 4 (2006) e004. [30] X.T. Zhang, L.G. Kang, L. Ding, S. Vranic, Z. Gatalic, Z.Y. Wang, A positive feedback loop of ER-a36/EGFR promotes malignant growth of ER-negative breast cancer cells, Oncogene 30 (6) (2011) 770–780. [31] L.G. Kang, Y.M. Guo, X.T. Zhang, J. Meng, Z.Y. Wang, A positive cross-regulation of HER2 and ER-a36 controls ALDH1 positive breast cancer cells, J. Steroid Biochem. Mol. Biol. 127 (3) (2011) 262–268. [32] Y. Zou, L. Ding, M. Coleman, Z.Y. Wang, Estrogen receptor-alpha (ER-alpha) suppresses expression of its variant ER-alpha36, FEBS Lett. 583 (8) (2009) 1368–1374. [33] M. Razandi, A. Pedram, S.T. Park, E.R. Levin, Proximal events in signaling by plasma membrane estrogen receptors, J. Biol. Chem. 278 (4) (2003) 2701–2712. [34] R.X. Song, Z. Zhang, Y. Chen, Y. Bao, R.J. Santen, Estrogen signaling via a linear pathway involving insulin-like growth factor I receptor, matrix metalloproteinases, and epidermal growth factor receptor to activate mitogenactivated protein kinase in MCF-7 breast cancer cells, Endocrinology 148 (8) (2007) 4091–4101.
X.T. Zhang et al. / Journal of Steroid Biochemistry & Molecular Biology 143 (2014) 434–443 [35] G.L. Li, J. Zhang, K.T. Jin, K.F. He, Y. Zheng, X. Xu, H.H. Wang, H.Y. Wang, Z.Q. Li, X. F. Yu, X.T. Teng, J. Cao, L.S. Teng, Estrogen receptor-a36 is involved in development of acquired tamoxifen resistance via regulating the growth status switch in breast cancer cells, Mol. Oncol. 7 (2013) 611–624. [36] A. Migliaccio, M. Di Domenico, G. Castoria, A. de Falco, P. Bontempo, E. Nola, F. Auricchio, Tyrosine kinase/p21ras/MAP-kinase pathway activation by estradiolreceptor complex in MCF-7 cells, EMBO J. 15 (6) (1996) 1292–1300. [37] C.B. Wade, S. Robinson, R.A. Shapiro, D.M. Dorsa, Estrogen receptor (ER) alpha and ERbeta exhibit unique pharmacologic properties when coupled to activation of the mitogen-activated protein kinase pathway, Endocrinology 142 (6) (2001) 2336–2342.
443
[38] I.S. Nethrapalli, A.A. Tinnikov, V. Krishnan, C.D. Lei, C.D. Toran-Allerand, Estrogen activates mitogen-activated protein kinase in native, nontransfected CHO-K1, COS-7, and RAT2 fibroblast cell lines, Endocrinology 146 (1) (2005) 56–63. [39] I. Martínez-Lacaci, M. Saceda, G.D. Plowman, G.R. Johnson, N. Normanno, D.S. Salomon, R.B. Dickson, Estrogen and phorbol esters regulate amphiregulin expression by two separate mechanisms in human breast cancer cell lines, Endocrinology 136 (9) (1995) 3983–3992. [40] A. Migliaccio, G. Castoria, M. Di Domenico, A. de Falco, A. Bilancio, M. Lombardi, D. Bottero, L. Varricchio, M. Nanayakkara, A. Rotondi, et al., Sex steroid hormones act as growth factors, J. Steroid Biochem. Mol. Biol. 83 (1–5) (2002) 31–35.
