Gene, 119 (1992) 137-141 0 1992 Elsevier Science Publishers

GENE

B.V. All rights reserved.

137

0378-l 119/92/$05.00

06635

pYLZ vectors: Saccharomyces to analyze yeast promoters

cerevisiae/Escherichia

coli shuttle plasmids

(Recombinant

and single-copy

transcription)

Hannes

DNA;

IucZ gene fusions;

Hermann,

Udo Hacker*,

multicopy

Wolfhard

Bandlow

vectors;

overlapping

and Viktor Magdolen

Institutfiir Genetik und Mikrobiologie der UniversitiitMiinchen, Miinchen, Germany Received

by J. Marmur:

16 April 1992; Accepted:

6 May 1992; Received

at publishers:

1 June 1992

SUMMARY

Two yeast/Escherichiu coli shuttle vectors have been constructed to analyze promoter structures in Saccharomyces cerevisiae: the multicopy vector, pYLZ-2, and the centromere-based vector, pYLZ-6. Both plasmids contain the coding regionof IacZ from E. coli lacking the N-terminal eight amino acids. The truncated reporter gene is preceded by a short polylinker (MCS) suitable for the insertion of promoter fragments. The vectors allow for the study of expression from complete promoters containing UAS and TATA elements, transcriptional start point(s) and the original context of the ATG start codon of a yeast gene. A yeast terminator fragment has been inserted 3’ of the ZacZ coding region. It contains the transcription termination region of the convergently transcribed yeast genes, GCYI and PFYl, together with sequences corresponding to the mapped 3’-ends of the respective mRNAs. As an example, reporter activity was measured with promoter fragments from three yeast genes (GCYI, PFYI and LEOI ). The results demonstrate the efficiency of the plasmids for studying constitutive and regulated transcription, both at high and low levels of expression.

INTRODUCTION

Fusion of promoter sequences of S. cerevisiae to the bacterial ZucZ gene as a reporter (Guarente and Ptashne, 198 1) is often used to analyze transcriptional regulation of yeast genes. Many efficient plasmids have been constructed especially for testing enhancer-like structures. UASelements are inserted 5’ of a minimal yeast promoter fused to the facZ gene from E. coli (Guarente, 1983; Lue and

Correspondence to: Dr. W. Bandlow, ogie der Universitat

Mtinchen,

Institut

fiir Genetik

Maria Ward-Str.

und Mikrobiol-

la, D-8000 Miinchen

Germany. Tel. (49-89)17919840; Fax (49-89)1785633. * Present address: Max-Planck-Institut fur biophysikalische Fassberg, D-3400 Gdttingen, Germany

19,

Chemie, Am

Kornberg, 1987). The minimal promoters without UAS exhibit no expressional activity, whereas insertion of a functional UAS leads to an increase of transcription initiation, dependent on the inserted element (Lue et al., 1989; Larch et al., 1990). These vector systems are less suitable if promoters have not yet been characterized well, or if the TATA element or initiation site region of the gene under consideration interact with transcription factors bound to UAS in a specific ‘nonstandard’ fashion (Struhl, 1987). For exam-

mosome

6; dA,

deoxyadenosine;

cerevisiae gene encoding

aa, amino

acid(s); ARSH4, histone

autonomously

replicating

sequence;

ONP-P-D-galactopyranoside;

gene encoding

p-lactamase;

tary to RNA;

CEN6, minimal

H4 gene-associated,

/?Gal, /?-galactosidase;

bp, base pair(s); centromere

cDNA,

DNA

bla, E. cob

DNA complemen-

segment

of yeast chro-

double

strand(ed);

GCYZ,

kb, kilobase

S.

or 1000

bp; LEOI, S. cerevisiae gene encoding a protein of unidentified function; MCS, multiple cloning site; nt, nucleotide(s); ONP, o-nitrophenol; ONPG, merase chain reaction;

Abbreviations:

ds,

an aldo/keto-reductase;

Klenow (large) fragment UAS, upstream dine 5’-phosphate

ori, origin of DNA replication;

PFYZ, S. cerevisiae gene encoding

activation

of E. coli DNA polymerase

PCR, poly-

profilin; PolIk,

I; S., Saccharomyces;

site; URA.3, S. cerevisiae gene encoding

decarboxylase;

wt, wild type.

oroti-

138 ple, it has been observed that a ‘nonconsensus’ minimal promoter did not respond to regulatory elements (Mahade-

functional /IGal enzyme in various IacZ fusion experiments. Plasmid pYLZ-2 was converted to the single-copy plasmid,

van and Struhl, 1990). To study such interactions and to analyze expression from complete promoter systems, plas-

pYLZ-6, by exchanging a 2.6-kb ScaI fragment (harbouring the 2~ ori of pYLZ-2) for a 1.75-kb ScaI fragment from

mids have to be designed which permit the insertion of the complete yeast promoter in front of the /acZ gene. The aim of this study was to construct multicopy and single-copy plasmids containing a MCS in front of the 1acZ reporter gene. The plasmids are devoid of any yeast promoter sequences to enable characterization of the complete pro-

the centromere plasmid pRS316 (Sikorski and Hieter, 1989). This fragment contained the CEN6/ARSH4 DNA cassette. Insertion in the correct orientation led to the regeneration of the bla and URA3 genes used for selection in E. coli and yeast in both plasmids, pYLZ-2 and pYLZ-6 (Fig. 1). Analogously, pYLZ-2 or pYLZ-6 can be changed easily to an integration vector by replacing the ScaI fragment harbouring either the 2~ ori or the CEN6jARSH4

moter structures including the start codon of yeast genes. In addition, they contain a yeast terminator fragment which was derived from the intergenic region of the convergently transcribed genes PFM and GCYI (Magdolen et Oechsner et al., 1988). This has been inserted IacZ coding region to ensure precise termination scription of the fusion genes. We discuss data with four different promoter fusion genes tested plasmids.

EXPERIMENTAL

al., 1988; 3’ of the of tranobtained in these

AND DISCUSSION

(a) Construction of pYLZ-2 and pYLZ-6 Plasmids pYLZ-2 and pYLZ-6 differ from one another only in the ori region (Fig. 1). The 2p-based vector YEp352 (Hill et al., 1986) served as the backbone for both plasmids. Digestion of YEp352 with PvuII + NarI eliminated all 1acZ coding and noncoding sequences from this vector. The 4.8-kb residual vector fragment was isolated and a ds 84/ 86meric synthetic polylinker inserted which contained a small MCS (EcoRI, HindIII, BamHI and SmaI) followed by the original sequence of the C-terminal 15 triplets of the E. coli 1acZ gene, 3’ of the naturally occurring EcoRI site. The stop codon of the IacZ gene in the polylinker was part of a ClaI site. One end of the linker DNA was blunt (leading to the restoration of a PvuII site immediately adjacent to the EcoRI site of the polylinker, Fig. 1B). The other one was 5’-protruding and complementary to NarI-cleaved DNA. A 82-bp TaqI fragment which contained the transcription termination region of the two convergently transcribed yeast genes, GCYI and PFYI (Fig. lC), was ligated to the C/a1 site of this vector construct to yield pT2. Plasmid pT2 was cut with BamHI + SmaI and a 3.0-kb BamHI-EcoRI fragment from plasmid pMC1871 (Casadaban et al., 1983), which contained most of the bacterial IacZ gene, was inserted (the EcoRI site was made blunt end by PolIk fill-in). The resulting vector, called pYLZ-2, contained the 1acZ gene lacking the N-terminal eight triplets. Two codons preceding the EcoRI site have been changed by the fusion compared to the wt IacZ gene (F,,,,L and QloosG). The restoration of the C-terminal coding region of the 1acZ gene was found to be necessary to yield a

DNA cassette with the 1.25-kb ScaI fragment from the integration vector pRS306 (Sikorski and Hieter, 1989). (b) The transcription terminator The 3’-intergenic region of the convergently transcribed yeast genes GCYl and PFYl comprises only 245 bp (Oechsner et al., 1988). The analysis of PFYl-specific cDNAs (Oechsner et al., 1987) revealed that the 3’ end of the PFYl cDNA mapped only 24 bp downstream the stop codon of the neighbouring GCYl gene. The sequencing of GCYlderived cDNAs showed that all 3’ ends mapped to a single site on genomic DNA which overlapped the 3’ end of the PFYl mRNA by at least 37 nt (Fig. 1C). However, in no case did transcription run into the coding regions of the respective 3’-adjacent gene. Since both GCYl and PFYl cDNAs ended in sequences not particularly rich in dAresidues, they most likely contained the natural ends of the respective mRNAs rather than artefacts caused by erroneous priming of cDNA synthesis. The terminator fragment from the GCYl/PFYl intergenic region (Fig. 1C) was chosen to terminate IacZ transcription in the pYLZ-plasmids due to two desirable properties: (i) It contained the stop codon as well as the genomic sequences corresponding to the 3’ ends of the GCYl mRNA and (ii) The constitutively expressed PFYl (Magdolen et al., 1988) and the galactoseregulated GCYl gene (Magdolen et al., 1990), which are both transcribed at moderately high levels, terminate transcription at specific closely adjacent sites indicating efficient termination. The terminator has been inserted in the orientation of the GCYl gene. (c) Analysis of lad fusion genes in yeast To check the functionality of the pYLZ-plasmids in reporting expression driven by yeast promoters, fragments including 5’-terminal coding sequences from three yeast genes were fused in-frame to the IacZ gene of pYLZ-2 and pYLZ-6, respectively. The genes LEO1 (encoding a protein with unknown function), PFYI (encoding profilin) and GCYI (encoding an aldo/keto-reductase) are located adjacent to one another on chromosome XV, closely linked to ADE2 (Magdolen et al., 1988).

139

Hindlll

Hindlll

I

EOJRI ,

I IBamHl

Pvull

(7073 bp)

B EcoRI

BamHI

..CAGCTGAATTCAAAGCTTAGGATCCCGTCG?TTTA...

PVUII

Val

Hind111

Val

9

C

3 ‘-end

Leu

10

of

11

PFYl

. . .

. . .

.

.

.

.

.

.

1acZ

cDNA

PFYl mRNA

+ CGAAGTATTCAAGTAATTGTTTTTGCGTGTTTCTCGTAT -

GATTGTAATATGTAGATAAATTAAACATAAGTATATC

4

b GCYl Fig. 1. Structure

AAATGT

I

mRNA

3’-end

of the pYLZ vectors.

(A) Restriction

maps of pYLZ-2

tion of transcription of the bacterial genes blu and 1ucZ and of the yeast

and pYLZ-6.

Sites in brackets

URA3 gene are indicated

of

were destroyed

by arrows.

GCYl

cDNA

during construction.

2n, region containing

The direc-

the on’ of the yeast

multicopy plasmid YEp352 (Hill et al., 1986); CEN6, CEN6/ARSH4 DNA cassette of the centromere plasmid pRS316 (Sikorski and Hieter, 1989). The MCS is indicated by shading, the terminator fragment by the black box. (B) Nucleotide sequence of the polylinker sequence of the pYLZ-plasmids in front of the IucZ gene lacking the 5’-terminal codon

of the 1acZ gene. The stop codon

indicated

by vertical

McConaughy, containing

arrows,

the minimum

1983) was screened

identical

sequences

eight codons. overlap

for PFYZ-specific

preceding

(C) Nucleotide

of GCYl is underlined.

the poly(dA)

of transcription (Oechsner

sequence

of the 82-bp terminator

The 3’ ends of the cDNAs is boxed.

Methods.

A yeast cDNA

et al., 1987) and GCYI-specific

tail were isolated

and sequenced.

fragment,

of PFYI (Oechsner cDNAs.

library

which was inserted

3’ of the stop

et al., 1987) and GCYl (this work) are in vector

Three full-length

pMAC561

(McKnight

GCYZ-derived

cDNA

and clones

140 In all cases, expression of BGal in yeast uniformly is about fourfold higher in cells transformed with pYLZ-2 as compared to pYLZ-6 derivates (Table I). These differences are to be expected, since pYLZ-2 occurs in multiple copies in yeast cells, whereas pYLZ-6 represents a low-copynumber plasmid. The promoter fragment from LEO1 (nt -190 to + 24 with the start codon ATG as nt + 1) permits weak expression compared to PFY,! (nt -249 to + 13). This result is consistent with the intensities of signals produced when labeled yeast poly(A) + RNA is hybridized to DNA fragments cont~ning either PFYI- or LEOI-coding sequences (Magdolen et al., 1988). The j3Gal activities in total protein extracts from cells grown on glucose or galactose (Table I) or glycerol (not shown) do not differ significantly either with LEO1 or with PFYI,reflecting that transcription of both genes is not regulated by these carbon sources (although they could be transcriptionally responsive to others). In fact, PFYI was previously shown by Northern blot analysis to be expressed constitutively (Magdolen et al., 1988). In the case of the PFYI gene we analyzed, in addition, a possible influence by the single intron (which is located in the 5’-coding region of the gene) on gene expression by creating a PFYI-ZucZ fusion gene containing the com-

TABLE

plete intron (nt -249 to + 250). The /3Gal activities of the

PFYI-lac.2 fusion genes lacking or containing the intron are about the same, indicating that the intervening sequence is devoid of transcription-activating elements and is correctly spliced from the pre-mRNA of the IacZ fusion (Table I). To test expression regulated by a carbon source, a IucZ fusion was constructed using a promoter fragment from the galactose-regulated GCYl gene (Magdolen et al., 1990). After transformation of yeast cells with either pYLZ-2 or pYLZ-6 harbouring the GCYl promoter-la&? gene fusion, a carbon source-dependent expression of @Gal is observed. The activity is poor on glucose, whereas induction by galactose leads to an increase of expression which is about 20-fold above that found with glucose (Table I). A comparable extent of induction has been observed previously with a similar GCYl/lucZ fusion construct using the same promoter fragment (27-fold; Magdolen et al., 1990). This result demonstrates the reliability of pYLZ-vectors in expression studies. Taken together, the results presented here indicate that plasmids pYLZ-2 and pYLZ-6 allow easy cloning of promoter fra~ents in front of the IacZ reporter gene and can be used successfully to analyze yeast promoter structures.

I

PGal activities in total extracts from yeast transformed

with various IacZ fusions’either

in the multicopy

vector pYLZ-2 or in the centromere

vector pYLZ-6

gGal activities”

Plasmid b

Multicopy Carbon

Single copy vector (pYLZ-6)

vector (pYLZ-2)

source in the growth

medium Glucose

Galactose

Glucose

Galactose

LEQl-1acZ PFYI -1ac 2

12.4 169.1

10.5 173.1

3.0 44.1

PFYI (IflacZ

184.4

178.1

56.3

51.5

GCYI-IacZ pYLZ-2

34.1