Toxicology and Applied Pharmacology 273 (2013) 672–679
Contents lists available at ScienceDirect
Toxicology and Applied Pharmacology journal homepage: www.elsevier.com/locate/ytaap
Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury Xu Jing a,1, Dongmei Ren b,1, Xinbing Wei a, Huanying Shi a, Xiumei Zhang a, Ruth G. Perez c, Haiyan Lou a,⁎, Hongxiang Lou b a b c
Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012, China Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012, China Health Science Center, Paul L. Foster School of Medicine, Texas Tech University, El Paso, TX, 79905, USA
a r t i c l e
i n f o
Article history: Received 5 August 2013 Revised 5 October 2013 Accepted 18 October 2013 Available online 26 October 2013 Keywords: Eriodictyol-7-O-glucoside Nrf2 Astrocyte Cerebral ischemia
a b s t r a c t Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. © 2013 Elsevier Inc. All rights reserved.
Introduction Oxidative stress is a major contributor to cerebrovascular dysfunction and one of the main causes of tissue damage following ischemic insults in the brain (Chen et al., 2011). Phase II detoxifying and antioxidant enzymes are the primary means by which neuronal cells protect themselves from toxic reactive oxygen species (ROS). The induction of such enzymes is governed by the transcription factor nuclear factor erythroid-2-related factor 2 (Nrf2). Activation of Nrf2 represents a key step in endogenous cellular protection and is
Abbreviations: AEBSF, benzamidine; ARE, antioxidant response element; DCFH-DA, 2′,7′-dichlorodihydrofluorescein diacetate; EAAT3, excitatory amino acid transporter 3; E7G, eriodictyol-7-O-glucoside; GSH, glutathione; γ-GCS, gamma glutamate cysteine ligase; HE, hematoxylin and eosin; HO-1, heme oxygenase-1; ECA, external carotid artery; EDTA, edetic acid; ICA, internal carotid artery; MCAO, middle cerebral artery occlusion; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; NQO-1, NAD(P)H: quinine oxidoreductase 1; Nrf2, nuclear factor erythroid-2-related factor 2; OGD, oxygen and glucose deprivation; PMSF, phenylmethylsulfonyl fluoride; ROS, reactive oxygen species; RT-PCR, reverse transcription-Polymerase chain reaction TTC, 2,3,5-triphenyltetrazolium chloride; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling. ⁎ Corresponding author at: Department of Pharmacology, School of Medicine, Shandong University, No. 44 Wenhua Xi Road, Jinan, Shandong Province, 250012, China. Fax: +86 531 88383146. E-mail address: [email protected] (H. Lou). 1 Xu Jing and Dongmei Ren contribute equally to this work. 0041-008X/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.taap.2013.10.018
becoming a promising therapeutic target for neuroprotection. There is increasing evidence that induction of the Nrf2/Antioxidant response element (ARE) signaling pathway confers protection against cerebral ischemia-reperfusion injury (Alfieri et al., 2011; Son et al., 2010). Astrocytes, the major glial non-neuronal cells, play an important role in the cellular antioxidant defense in the brain. They are the main source of glutathione (GSH) and supply the neurons with substrate for GSH synthesis to improve the neuronal antioxidative reserves (Dringen et al., 1999). ARE-regulated genes are preferentially activated in astrocytes, which consequently have more efficient detoxification and antioxidant defense than neurons. Activation of Nrf2 in astrocytes protects neurons from a wide array of potentially toxic insults. Nrf2 activation in astrocytes has thus been proposed as a novel therapeutic target for neuroprotection (Bell et al., 2011; Escartin et al., 2011; Vargas and Johnson, 2009). Over the past two decades, epidemiological studies have linked the consumption of flavonoid-containing dietary sources to reduced risk of cardiovascular disease and stroke (Arab and Liebeskind, 2010; Leonardo and Dore, 2011). Eriodictyol-7-O-glucoside (E7G), one of the most abundant flavonoids isolated from the Chinese herb Dracocephalum rupestre, has been identified as a novel Nrf2 activator and can confer protection against cisplatin-induced toxicity through activation of the Nrf2 pathway (Hu et al., 2012). Our previous paper also showed that its aglycone eriodictyol protected PC12 cells against
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
H2O2-induced oxidative stress (Lou et al., 2012). However, whether it is also protective in a cerebral ischemic model remains unknown. Based on the previous study, we hypothesized that E7G may confer neuroprotection against cerebral ischemia through Nrf2-coordinated induction of endogenous cytoprotective proteins. The present study reveals that E7G might be beneficial in mitigating cerebral ischemic injury in cellular and animal stroke models by upregulating phase II and antioxidant gene expression via Nrf2 activation. Material and methods Animals and reagents. Adult male Sprague–Dawley (SD) rats (280 g ~ 320 g) were used in the in vivo experiments. Newborn SD rats (day 0–1) were used for primary cortical astrocyte cultures. All experiments were approved by the Institutional Animal Care and Use Committee of Shandong University. E7G was provided by the Department of Natural Products Chemistry of Shandong University (Jinan, China) where its purity was confirmed to be N 98%. Dulbecco's modified Eagle medium (DMEM), penicillin, streptomycin and fetal bovine serum (FBS) were from Invitrogen/Gibco (Carlsbad, CA, USA). Antibodies to Nrf2, HO-1, γ-GCS, NQO-1, caspase-3 and β-actin, anti-mouse-horseradish peroxidase (HRP) IgG, anti-rabbit-HRP-IgG were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies to cleaved caspase-3 and Histone H3 were obtained from Cell Signaling Technology (Beverly, MA, USA). The siRNA reagents for Nrf2 were from Invitrogen/Gibco (Carlsbad, CA, USA). Primary culture and in vitro model of ischemia. Primary astrocyte cultures were obtained from neonatal rats as described previously with some minor modification (Halim et al., 2010). Briefly, cerebral cortices were harvested from neonatal SD rats. The dissociated cells were seeded in poly-D-lysine-coated 75-cm2 flasks and cultured in high-glucose DMEM supplemented with 20% fetal bovine serum. The medium was changed every 3 days. After ~14 days, the confluent cultures were agitated at 37 °C for 12 h to separate astrocytes from the remaining microglia and oligodendroglia. Cells were used between 18 and 21 days in culture when they reach maximal sensitivity to cell death caused by oxygen-glucose deprivation (OGD). To model ischemia-like conditions in vitro, primary cultured astrocytes were exposed to transient OGD for 60 min. Cell death/viability assessment of cultured astrocytes. Cells seeded in 96well plate were pretreated with E7G at the indicated concentrations for 2 h before being exposed to OGD for 60 min and incubated with E7G for an additional 24 h. OGD-induced cell death was quantified using the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay and by random blinded cell counting of Hoechst 33258 stained cells. Intracellular ROS measurement. The level of oxidative stress was determined by measuring intracellular ROS generation. The production of cellular ROS was detected using the 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) fluorescence assay (Tao et al., 2013). Cells were seeded in 6-well plate for 24 h prior to the experiment. On the following day, cells were pretreated with E7G at the indicated concentrations for 2h before being exposed to OGD for 60min, and then incubated with E7G for an additional 24 h. Cells were then washed with PBS and fresh medium containing DCFH-DA (10 μM) were added. After incubating at 37 °C for 30 min, the cells were washed with PBS, trypsinized, and resuspended in PBS. The level of ROS generated was measured using flow cytometry based on the fluorescence intensity of DCF at 525 nm after excitation at 485 nm. Determination of cellular reduced GSH content. Cells were treated either with 20, 40 and 80 μM of E7G for 24 h or with 80 μM of E7G for 0, 2, 4, 8 and 24 h. The intracellular GSH concentration was quantified using
673
the 5,5′-dithiobis(2-nitrobenzoic acid) colorimetric method according to the manufacturer's protocol as previously described (Lou et al., 2012). RNA isolation and real time RT-PCR. Total mRNA was isolated from astrocytes using TRIzol reagent (Invitrogen). The mRNA levels were analyzed by real time quantitative RT-PCR using a Bio-Rad iCycler system (BioRad, Hercules, CA). The specific primers for target genes are listed below. Nrf2: forward (GGTTGCCCACATTCCCAAAC) and reverse (TCCT GCCAAACTTGCTCCAT); HO-1: forward (CGACAGCATGTCCCAGGATT) and reverse (CTGGGTTCTGCTTGTTTCGC); γ-GCS: forward (GCACAG CTGGACTCTGTCAT) and reverse (GGGTTTTACCTGTGCCCACT); NQO-1: forward (AGCGCTTGACACTACGATCC) and reverse (CAATCAGGGCTCT TCTCACC); β-actin: forward (AGCCATGTACGTAGCCATCC) and reverse (ACCCTCATAGATGGGCACAG). Preparation of nuclear extracts. Cells were washed twice with cold PBS and were then scraped from the dishes with 1000 μl of PBS. Cell homogenates were centrifuged at 2000 g for 5 min. The supernatants were discarded, and the cell pellets were allowed to swell on ice for 15min after the addition of hypotonic buffer A containing 150 mM NaCl, 10 mM HEPES-KOH (pH 7.9), 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM edetic acid (EDTA, pH 8.0), 0.6% NP-40. After centrifuge at 6000 g for 10 min at 4 °C, the nuclear pellets were resuspended in buffer B (420 mM NaCl, 20 mM HEPES-KOH, pH 7.9, 0.5 mM PMSF, 0.2 mM EDTA, pH 8.0, 0.5 mM dithiothreitol, 1.2 mM MgCl2, 25% glycerol, 0.5 μg/ml aprotinin) and were left for 30 min on ice with constant agitation. The samples were then centrifuged at 10,000 g for 15 min at 4 °C. The supernatants containing the nuclear proteins were collected and stored in aliquots at −80°C. Nuclear extracts were used for western blot analysis of Nrf2 and Histone H3. Western blot analysis. Western blotting was performed as described previously (Lou et al., 2012). Briefly, cells were exposed to lysis buffer (50 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS with 10 μg/ml leupeptin, 10 μg/ml aprotinin, 1 mM benzamidine and 1 mM AEBSF), and after incubation on ice for 20 min, cells were collected, vortexed, and centrifuged at 14000 g for 10 min at 4 °C. The supernatants were utilized for western blot analysis of HO-1, γ-GCS, NQO-1 and caspase-3. The preparation of nuclear extracts was as described above. Total protein concentration was determined by BCA method (Beyotime, Haimen, China). Protein samples (20 or 30 μg) were separated by SDS-PAGE on 8%-12% Tris-Glycine gels and transferred to nitrocellulose. Equivalent sample loading was confirmed by Ponceau S staining and immunoblotting for β-actin or Histone H3 served as an internal control. Membranes were blocked in 5% milk-TBS and incubated overnight at 4 °C in primary antibody. Signals from HRP-conjugated-secondary antibodies were visualized by an enhanced chemiluminescence detection kit (Pierce, Rockford IL, USA). The blots were re-probed with β-actin or Histone H3 as the loading control. The densitometry of the bands was performed using ImageJ software. RNA interference study. Nrf2-specific short interference RNA (siRNA) was purchased from Invitrogen. Transfection was performed using Lipofectamine 2000 according to the manufacturer's protocol. The two siRNAs against the rat Nrf2 gene were: (1) UACUCACUGGGAGAGUAA GGUUUCC, (2)GGAAACCUUACUCUCCCAGUGAGUA. Briefly, cells were transfected with siRNA directed against Nrf2 or with a nontargeting scramble control siRNA for 48 h, followed by treatment with E7G for the indicated times. Cell samples were then collected for western blot analysis, MTT assay and measurement of intracellular ROS. Model for transient focal cerebral ischemia. Age-matched SD male rats were randomly assigned to various experimental groups. Transient middle cerebral artery occlusion (MCAO) was produced by intraluminal
674
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
occlusion of the left middle cerebral artery as described previously (Lou et al., 2004). Briefly, anesthesia was induced using 10% chloral hydrate. The left common carotid artery, external carotid artery (ECA) and internal carotid artery (ICA) were isolated. A nylon monofilament was introduced into the ECA lumen and advanced into the ICA to block the origin of the MCA. After 2 h of MCAO, the suture was carefully removed to restore blood flow. During and after the surgery, rectal temperature was maintained at 37 °C with a homeothermal blanket. The sham groups received the same surgery procedures except for the occlusion of the MCA. Neurological function evaluation and quantification of infarct volume. Neurological deficits were scored on a 4-point grade scale modified from Longa et al. (1989) 24 h after MCAO: 0, normal function; 1, flexion of the torso and contralateral forelimb on lifting the animal by the
tail; 2, circling to the contralateral side but normal posture at rest; 3, reclination to the contralateral side at rest; 4, absence of spontaneous motor activity. To calculate infarct volume, brains were removed at 24 h after MCAO, the brains were cut into 2 mm thick coronal sections and subjected to 2,3,5-triphenyltetrazolium chloride (TTC) staining. Infarct volume was measured by a blinded observer using digital imaging (Digital Camera, Olympus MDF-382E) and image analysis software (C imaging 1280 system). HE and TUNEL staining. Hematoxylin and eosin (HE) staining was performed to show the morphological features of injured neurons in cerebral cortex. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was performed using an in situ cell death detection kit (Roche Diagnostic, Indianapolis, IN) according to the manufacturer's protocol.
Fig. 1. Eriodictyol-7-O-glucoside induces nuclear expression of Nrf2 and the expression of ARE-regulated genes in primary cultured astrocytes. (A) E7G induced Nrf2 expression in a concentration-dependent manner. Primary cultured astrocytes were treated with indicated concentrations of E7G for 8 h, after which nuclear extracts were prepared to measure the level of Nrf2 protein. (B) E7G-mediated induction of Nrf2 was also time-dependent. Primary cultured astrocytes were treated with 80 μM of E7G for 0, 2, 4 and 8 h, after which nuclear extracts were prepared to analyze the expression of Nrf2. (C) E7G induced the expression of ARE-regulated genes in a concentration-dependent manner. Primary cultured astrocytes were treated with E7G for 24 h and cell lysates were subjected to SDS-PAGE, and immunoblots were evaluated for HO-1, γ-GCS, NQO-1 and β-actin protein levels. (D) E7G increased intracellular GSH levels. Cells were either treated with 20, 40 and 80 μM of E7G for 24 h or with 80 μM of E7G for different time points. Cells were then harvested for total GSH level analysis. All data represent the mean ± S.D. from triplicate independent experiments. *p b 0.05; **p b 0.01 vs. control.
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
675
Statistical analysis. Data are expressed as means with standard deviation (SD). An analysis of the variance using the Tukey test was applied to compare the mean of each group with that of the control group. p b 0.05 was considered statistically significant. Results E7G activates the Nrf2 pathway and stimulates expression of Nrf2-mediated cytoprotective gens in astrocytes Examination of Nrf2 nuclear expression by western blot revealed that E7G induce Nrf2 nuclear translocation in a dose- and timedependent manner (Figs. 1A, B). We next determined whether E7G induces the expression of endogenous ARE-regulated genes. As shown in Fig. 1C, exposure of cells to E7G strongly induced HO-1 (heme oxygenase-1) and gamma glutamate cysteine ligase (γ-GCS) protein expression in a concentration dependent manner with little effect on NAD(P)H:quinine oxidoreductase 1 (NQO-1) expression. We also measured changes in GSH content in astrocytes after incubation with E7G. The data revealed that E7G significantly increased GSH content in a concentration- and time-dependent manner (Fig. 1D). This result was consistent with the noted increased level of γ-GCS, which is the ratelimiting enzyme in GSH synthesis. It has been previously demonstrated that E7G induced the Nrf2 pathway primarily through increasing Nrf2 stability rather than upregulating Nrf2 mRNA expression in MDA-MB-231 cells (Hu et al., 2012). In order to determine whether E7G activate Nrf2 in astrocytes in the same mechanism, the mRNA expression of Nrf2 and its target genes, HO-1, γ-GCS and NQO-1 were measured by real time RT-PCR. As shown in Figs. 2A and B, E7G exposure resulted in significant increase in mRNA levels of Nrf2 in a dose- and time-dependent manner. Similarly, mRNA levels of HO-1, γ-GCS and NQO-1 were upregulated by E7G treatment in a dose-dependent manner (Fig. 2C). E7G protects astrocytes against OGD-induced cell death Activation of the Nrf2/ARE pathway is known to confer resistance of cells to oxidative stress. To test the ability of E7G to prevent oxidative stress-induced cell death, we first performed the MTT assay and Hoechst 33258 staining by challenging primary cultured astrocytes with OGD. MTT assay revealed that E7G can reduce OGD-induced cell damage in a dose-dependent manner (Fig. 3A). This was further confirmed by Hoechst 33258 staining (Fig. 3B). Assessment of intracellular ROS level using DCFH-DA assay showed that E7G effectively reduced OGDinduced intracellular ROS level in a concentration-dependent manner (Fig. 3C). The protective effect of E7G was further confirmed by western blot analysis of cleaved caspase-3 expression. E7G pretreatment also attenuated the cleavage/activation of caspase-3 induced by OGD (Fig. 3D). The neuroprotective effect of E7G involves the Nrf2/ARE pathway To confirm that the protection afforded by E7G requires Nrf2 activation, we transfected astrocytes with either control (si-Control) or Nrf2specific (si-Nrf2) small interfering RNA for 48 h. The efficiency of the Nrf2 siRNA in knocking down Nrf2 was measured by western blot. As shown in Figs. 4A and B, the si-Nrf2 treatment significantly decreased the level of Nrf2 in nuclear extracts from cells treated with E7G, and reduced the up-regulation of its target genes, HO-1 and γ-GCS. We subsequently exposed si-Control or si-Nrf2-treated cells to 80 μM E7G and then subjected these cells to OGD challenge. The results demonstrated that in si-Control conditions, E7G was able to confer a cytoprotective response on OGD-challenged astrocytes, similar to previous data in untransfected cells, but less effective in protecting si-Nrf2-treated cells from OGD-induced cytotoxicity (Fig. 4C–E). These observations strongly suggest that Nrf2 is required for E7G-dependent cytoprotection against oxidative stress.
Fig. 2. E7G induced the Nrf2 signaling pathway through increasing Nrf2 mRNA expression in primary cultured astrocytes. (A) Primary cultured astrocytes were treated with indicated concentrations of E7G for 8 h, mRNA was extracted and quantitative RT-PCR was performed to show the mRNA levels of Nrf2. (B) Primary cultured astrocytes were treated with 80 μM of E7G for 0, 2, 4 and 8 h, mRNA was extracted and quantitative RTPCR was performed to show the mRNA levels of Nrf2. (C) Primary cultured astrocytes were treated with E7G for 24 h and mRNA was extracted and quantitative RT-PCR was performed to show the mRNA levels of HO-1, γ-GCS and NQO-1. All data represent the mean ± S.D. from triplicate independent experiments. *p b 0.05; **p b 0.01 vs. control.
E7G protects rats against cerebral ischemic injury Because E7G protected primary cultured astrocytes against insults relevant to ischemic stroke, we next tested whether Nrf2 activation by E7G may also contribute to neuroprotection in the rat focal cerebral ischemia model. Rats were pretreated with 30mg/kg E7G intraperitoneally for 5days prior to MCAO. As shown in Fig. 5A, Nrf2, HO-1 and γ-GCS levels were barely detectable in sham-operated rat cortex and upregulated at 8 and 24 h after reperfusion. Compared with vehicle-treated group, E7G pretreatment induced the upregulation of Nrf2, HO-1 and γ-GCS early after MCAO. The neurological deficit scores and the degree of brain damage (infarct volume) were assessed 24 h after reperfusion. Both the neurological deficit scores and the infarct volume in rats
676
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
Fig. 3. E7G protects primary cultured astrocytes against OGD-induced cell death. Cells were pretreated with E7G for 2 h before being subjected to 60 min OGD followed at 24 h by the (A) Cell viability assay using MTT; (B) Hoechst 33258 staining of nuclei and assessment of nuclear morphology (a: Control, b: OGD, c: E7G 40 μM + OGD, d: E7G 80 μM + OGD); (C) Intracellular ROS level and (D) Western blot analysis of cleaved-caspase 3. All data represent the mean ± S.D. of triplicate independent experiments. ##p b 0.01 vs. control, *p b 0.05; **p b 0.01 vs. OGD group.
pretreated with E7G were significantly less than the vehicle-treated rats at 24 h after reperfusion (Figs. 5B, C). The protective effect of E7G against cerebral ischemic damage was further confirmed by HE staining and TUNEL staining. Few TUNELpositive cells were seen in the sham group; however, there were numerous TUNEL-positive cells in the vehicle-treated group at 8 h and 24h after reperfusion. E7G pretreatment markedly reduced the number of TUNEL-positive cells and prevented neurons from apoptosis after cerebral ischemic injury (Figs. 5D, E). These data strongly suggest that the neuroprotection afforded by E7G is associated with its activation of Nrf2/ARE signaling pathway. Discussion Stroke is the second most common cause of death and the leading cause of adult disability for which no effective neuroprotective treatment is currently available (Balami et al., 2011; Donnan et al., 2008; Endres et al., 2008; Lopez et al., 2006). Oxidative stress is an important contributing factor in the pathogenesis of stroke, suggesting that therapeutic strategies directed against ROS might be particularly valuable for the prevention of stroke. There is increasing evidence showing that induction of the endogenous Nrf2/ARE antioxidant pathway can confer protection against cerebral ischemia-reperfusion injury. Targeting the Nrf2 pathway using small molecule activators presents an attractive opportunity since this intrinsic cellular pathway can be dynamically modulated (Alfieri et al., 2011). Several studies of stroke highlight the ability of natural plant-derived compounds to protect against stroke via activation of the Nrf2/ARE defense pathway (Shih et al., 2005; Wu et al., 2013; Zhao et al., 2007). E7G was one of the most abundant flavonoids isolated from Chinese herb Dracocephalum rupestre. Studies have shown that it could confer
protection against cisplatin-induced toxicity through activation of Nrf2 pathway (Hu et al., 2012). More recently, we demonstrated that its aglycone eriodictyol could protect neuronal-like PC12 cells against H2O2induced oxidative stress via the Nrf2 pathway (Lou et al., 2012). These data are noteworthy and suggest that specific flavonoids such as E7G could be beneficial for the treatment of ischemic stroke associated with oxidative stress. In this study, we have demonstrated that E7G can activate the Nrf2 pathway both in vitro and in vivo and protects astrocytes against OGD-induced cell death. Furthermore, in vivo studies using a focal cerebral ischemia model have shown that E7G could attenuate ischemic neuronal injury. The protective effect of E7G was blocked when Nrf2 was knocked down with specific Nrf2 siRNA, indicating that E7G-mediated neuroprotection may occur by activation of the transcription factor Nrf2. Taken together, our studies reveal that E7G affords neuroprotection via activation of the Nrf2/ARE pathway and suggest a promising therapeutic strategy for ischemic stroke. Nrf2 is a key regulator in cell survival and its activation can coordinately upregulate expression of several antioxidative enzymes such as HO-1 and γ-GCS, which play important roles in combating oxidative stress. As a phase II enzyme, HO-1 is neuroprotective against stroke, as HO-1 knockout increased infarct size whereas HO-1 overexpression reduced infarct size in mice (Panahian et al., 1999; Shah et al., 2011). ARE-mediated gene transcription has been reported to be more robust in astrocytes than in neurons (Kraft et al., 2004; Shih et al., 2003; Vargas et al., 2006), therefore, we choose primary astrocytes as our in vitro cell model. Consistent with these studies, the current results showed that treatment with E7G resulted in a significant increase in protein expression of Nrf2 and its target genes, HO-1 and γ-GCS, in astrocytes and in rat cortex. Our study also demonstrated that E7G treatment can increase the cellular GSH level in astrocytes consistent with the upregulation of γ-GCS, the rate-limiting enzyme in GSH
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
677
Fig. 4. E7G affords cell protection through the Nrf2/ARE pathway. (A) Cells were transiently transfected with control or Nrf2 siRNA for 48 h, followed by treatment with 80 μM of E7G for an additional 8 h. Nuclear extracts were analyzed for Nrf2 levels, using Histone H3 as an internal control. (B) Representative immunoblots for HO-1 and γ-GCS following 80 μM of E7G treatment for 24 h in control and Nrf2 siRNA-treated cells. (C) Cells were treated for 48 h with control or Nrf2 siRNA, then subjected to 80 μM E7G for 2 h before being subjected to 60 min OGD followed at 24 h by the MTT assay, (D) Intracellular ROS level and (E) Western blot analysis of cleaved-caspase 3. Data are mean ± S.D. of three different experiments. ⁎⁎p b 0.01 vs. control, ##p b 0.01 vs. si-Control + E7G treated group, ▲▲p b 0.01 vs. OGD, and &p b 0.01 vs. E7G-treated OGD group.
biosynthesis. GSH is the main cellular antioxidant against ROS. Neuronal GSH synthesis requires astrocyte release of GSH, extracellular cleavage of GSH to cysteine, and neuronal uptake of cysteine through the excitatory amino acid transporter 3 (EAAT3) (Aoyama et al., 2008; Dringen and Hirrlinger, 2003; Escartin et al., 2011). Nrf2 activation has been shown to increase GSH production and extracellular release of GSH by increasing the expression of enzymes and transporters involved in GSH metabolism (Panahian et al., 1999; Shah et al., 2011). E7G treatment also significantly reduced OGD-induced oxidative stress and apoptosis in primary cultured astrocytes. These findings provide compelling data that E7G prevents oxidative stress and apoptosis in astrocytes by activating Nrf2 signaling. However, while we have demonstrated that E7G treatment increased the protein expression and
activities of HO-1 and γ-GCS in this study, it is noteworthy that it does not imply that the protective effects of E7G are mediated solely by HO-1 and γ-GCS. Other antioxidants induced by Nrf2, which can induce a wide spectrum of antioxidants, may also contribute to the protective effects of E7G. This study provides the first experimental evidence that E7G affords neuroprotection against ischemic stroke via activation of the Nrf2/ARE pathway. The potency of E7G in preventing against focal cerebral ischemia along with the fact that E7G is a natural plant-derived compound makes E7G a promising therapeutic agent for stroke. Nonetheless, several issues still need to be addressed in the future. Examples include whether other signaling pathways contribute to the neuroprotective effects of E7G. Taken together, the results of this study support the
678
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
Fig. 5. E7G protects against cerebral ischemia reperfusion injury in MCAO rats. Rats were intraperitoneally injected with either vehicle (control) or 30 mg/kg of E7G for 5 days before MCAO surgery. (A) Nrf2 and its target gene were induced by E7G in the cortex of MCAO rats but not in control rats. Brain cortex tissues were collected at 8 and 24 h after cerebral ischemia/ reperfusion injury and brain homogenates were evaluated by western blot for Nrf2, HO-1, γ-GCS and actin. (B) TTC staining was used to calculate the infarct volume and (C) Neurological deficit scores were determined at 24 h after ischemia/reperfusion in rats. (D) Representative images of HE staining and TUNEL staining performed on sections from control and ischemic cortex, the percentage of apoptotic cells in the ischemic cortex was shown in (E). #p b 0.05, ##p b 0.01 vs. sham, &p b 0.05 vs. I/R 8 h group, *p b 0.05, **p b 0.01 vs. I/R 24 h group.
hypothesis that pharmacological activation of the Nrf2 pathway can provide neuroprotection against cerebral ischemia/reperfusion injury.
Conflict of interest statement The authors declare that there are no conflicts of interest.
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
Acknowledgment This study was supported by grants from the National Natural Science Foundation of China (No. 81274124, No. 81200982), the Foundation for Excellent Young and Middle-Aged Scientists of Shandong Province (No. BS2010YY036) and the Postdoctoral Innovation Research Program of Shandong Province (No. 201102021). References Alfieri, A., Srivastava, S., Siow, R.C., Modo, M., Fraser, P.A., Mann, G.E., 2011. Targeting the Nrf2-Keap1 antioxidant defence pathway for neurovascular protection in stroke. J. Physiol. 589, 4125–4136. Aoyama, K., Watabe, M., Nakaki, T., 2008. Regulation of neuronal glutathione synthesis. J. Pharmacol. Sci. 108, 227–238. Arab, L., Liebeskind, D.S., 2010. Tea, flavonoids and stroke in man and mouse. Arch. Biochem. Biophys. 501, 31–36. Balami, J.S., Chen, R.L., Grunwald, I.Q., Buchan, A.M., 2011. Neurological complications of acute ischaemic stroke. Lancet Neurol. 10, 357–371. Bell, K.F., Al-Mubarak, B., Fowler, J.H., Baxter, P.S., Gupta, K., Tsujita, T., Chowdhry, S., Patani, R., Chandran, S., Horsburgh, K., Hayes, J.D., Hardingham, G.E., 2011. Mild oxidative stress activates Nrf2 in astrocytes, which contributes to neuroprotective ischemic preconditioning. Proc. Natl. Acad. Sci. U. S. A. 108, E1–E2. Chen, H., Yoshioka, H., Kim, G.S., Jung, J.E., Okami, N., Sakata, H., Maier, C.M., 2011. Oxidative stress in ischemic brain damage: mechanisms of cell death and potential molecular targets for neuroprotection. Antioxid. Redox Signal. 14, 1505–1517. Donnan, G.A., Fisher, M., Macleod, M., Davis, S.M., 2008. Stroke. Lancet 371, 1612–1623. Dringen, R., Hirrlinger, J., 2003. Glutathione pathways in the brain. Biol. Chem. 384, 505–516. Dringen, R., Pfeiffer, B., Hamprecht, B., 1999. Synthesis of the antioxidant glutathione in neurons: supply by astrocytes of CysGly as precursor for neuronal glutathione. J. Neurosci. 19, 562–569. Endres, M., Engelhardt, B., Koistinaho, J., Lindvall, O., Meairs, S., Mohr, J.P., Planas, A., Rothwell, N., Schwaninger, M., Schwab, M.E., Vivien, D., Wieloch, T., Dirnagl, U., 2008. Improving outcome after stroke: overcoming the translational roadblock. Cerebrovasc. Dis. 25, 268–278. Escartin, C., Won, S.J., Malgorn, C., Auregan, G., Berman, A.E., Chen, P.C., Déglon, N., Johnson, J.A., Suh, S.W., Swanson, R.A., 2011. Nuclear factor erythroid 2-related factor 2 facilitates neuronal glutathione synthesis by upregulating neuronal excitatory amino acid transporter 3 expression. J. Neurosci. 31, 7392–7401. Halim, N.D., Mcfate, T., Mohyeldin, A., Okagaki, P., Korotchkina, L.G., Patel, M.S., Jeoung, N.H., Harris, R.A., Schell, M.J., Verma, A., 2010. Phosphorylation status of pyruvate dehydrogenase distinguishes metabolic phenotypes of cultured rat brain astrocytes and neurons. Glia 58, 1168–1176. Hu, Q., Zhang, D.D., Wang, L., Lou, H., Ren, D., 2012. Eriodictyol-7-O-glucoside, a novel Nrf2 activator, confers protection against cisplatin-induced toxicity. Food Chem. Toxicol. 50, 1927–1932.
679
Kraft, A.D., Johnson, D.A., Johnson, J.A., 2004. Nuclear factor E2-related factor 2-dependent antioxidant response element activation by tert-butylhydroquinone and sulforaphane occurring preferentially in astrocytes conditions neurons against oxidative insult. J. Neurosci. 24, 1101–1112. Leonardo, C.C., Dore, S., 2011. Dietary flavonoids are neuroprotective through Nrf2coordinated induction of endogenous cytoprotective proteins. Nutr. Neurosci. 14, 226–236. Longa, E.Z., Weinstein, P.R., Carlson, S., Cummins, R., 1989. Reversible middle cerebral artery occlusion without craniectomy in the rats. Stroke 20, 84–91. Lopez, A.D., Mathers, C.D., Ezzati, M., Jamison, D.T., Murray, C.J., 2006. Global and regional burden of disease and risk factors, 2001: systematic analysis of population health data. Lancet 367, 1747–1757. Lou, H., Zhang, X., Wei, X., Wang, R., Sun, X., 2004. Anti-inflammatory effect of hydroxyethylpuerarin on focal brain ischemia/reperfusion injury in rats. Chin. J. Physiol. 47, 197–201. Lou, H., Jing, X., Ren, D., Wei, X., Zhang, X., 2012. Eriodictyol protects against H(2)O(2)induced neuron-like PC12 cell death through activation of Nrf2/ARE signaling pathway. Neurochem. Int. 61, 251–257. Panahian, N., Yoshiura, M., Maines, M.D., 1999. Overexpression of heme oxygenase-1 is neuroprotective in a model of permanent middle cerebral artery occlusion in transgenic mice. J. Neurochem. 72, 1187–1203. Shah, Z.A., Nada, S.E., Dore, S., 2011. Heme oxygenase 1, beneficial role in permanent ischemic stroke and in gingko biloba (EGB 761) neuroprotection. Neuroscience 180, 248–255. Shih, A.Y., Johnson, D.A., Wong, G., Kraft, A.D., Jiang, L., Erb, H., Johnson, J.A., Murphy, T.H., 2003. Coordinate regulation of glutathione biosynthesis and release by Nrf2expressing glia potently protects neurons from oxidative stress. J. Neurosci. 23, 3394–3406. Shih, A.Y., Li, P., Murphy, T.H., 2005. A small-molecule-inducible Nrf2-mediated antioxidant response provides effective prophylaxis against cerebral ischemia in vivo. J. Neurosci. 25, 10321–10335. Son, T.G., Camandola, S., Arumugam, T.V., Cutler, R.G., Telljohann, R.S., Mughal, M.R., Moore, T.A., Luo, W., Yu, Q.S., Johnson, D.A., Johnson, J.A., Greig, N.H., Mattson, M.P., 2010. Plumbagin, a novel Nrf2/ARE activator, protects against cerebral ischemia. J. Neurochem. 112, 1316–1326. Tao, S., Zheng, Y., Lau, A., Jaramillo, M.C., Chau, B.T., Lantz, R.C., Wong, P.K., Wondrak, G.T., Zhang, D.D., 2013. Tanshinone I activates the Nrf2-dependent antioxidant response and protects against As(III)-induced lung inflammation in vitro and in vivo. Antioxid. Redox Signal. 19, 1647–1661. Vargas, M.R., Pehar, M., Cassina, P., Beckman, J.S., Barbeito, L., 2006. Increased glutathione biosynthesis by Nrf2 activation in astrocytes prevents p75NTRdependent-motor neuron apoptosis. J. Neurochem. 97, 687–696. Vargas, M.R., Johnson, J.A., 2009. The Nrf2-ARE cytoprotective pathway in astrocytes. Expert. Rev. Mol. Med. 11, e17. Wu, J., Li, Q., Wang, X., Yu, S., Li, L., Wu, X., Chen, Y., Zhao, J., Zhao, Y., 2013. Neuroprotection by curcumin in ischemic brain injury involves the Akt/Nrf2 pathway. PLoS One 8, e59843. Zhao, J., Moore, A.N., Redell, J.B., Dash, P.K., 2007. Enhancing expression of Nrf2driven genes protects the blood brain barrier after brain injury. J. Neurosci. 27, 10240–10248.
Contents lists available at ScienceDirect
Toxicology and Applied Pharmacology journal homepage: www.elsevier.com/locate/ytaap
Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury Xu Jing a,1, Dongmei Ren b,1, Xinbing Wei a, Huanying Shi a, Xiumei Zhang a, Ruth G. Perez c, Haiyan Lou a,⁎, Hongxiang Lou b a b c
Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012, China Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012, China Health Science Center, Paul L. Foster School of Medicine, Texas Tech University, El Paso, TX, 79905, USA
a r t i c l e
i n f o
Article history: Received 5 August 2013 Revised 5 October 2013 Accepted 18 October 2013 Available online 26 October 2013 Keywords: Eriodictyol-7-O-glucoside Nrf2 Astrocyte Cerebral ischemia
a b s t r a c t Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. © 2013 Elsevier Inc. All rights reserved.
Introduction Oxidative stress is a major contributor to cerebrovascular dysfunction and one of the main causes of tissue damage following ischemic insults in the brain (Chen et al., 2011). Phase II detoxifying and antioxidant enzymes are the primary means by which neuronal cells protect themselves from toxic reactive oxygen species (ROS). The induction of such enzymes is governed by the transcription factor nuclear factor erythroid-2-related factor 2 (Nrf2). Activation of Nrf2 represents a key step in endogenous cellular protection and is
Abbreviations: AEBSF, benzamidine; ARE, antioxidant response element; DCFH-DA, 2′,7′-dichlorodihydrofluorescein diacetate; EAAT3, excitatory amino acid transporter 3; E7G, eriodictyol-7-O-glucoside; GSH, glutathione; γ-GCS, gamma glutamate cysteine ligase; HE, hematoxylin and eosin; HO-1, heme oxygenase-1; ECA, external carotid artery; EDTA, edetic acid; ICA, internal carotid artery; MCAO, middle cerebral artery occlusion; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide; NQO-1, NAD(P)H: quinine oxidoreductase 1; Nrf2, nuclear factor erythroid-2-related factor 2; OGD, oxygen and glucose deprivation; PMSF, phenylmethylsulfonyl fluoride; ROS, reactive oxygen species; RT-PCR, reverse transcription-Polymerase chain reaction TTC, 2,3,5-triphenyltetrazolium chloride; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling. ⁎ Corresponding author at: Department of Pharmacology, School of Medicine, Shandong University, No. 44 Wenhua Xi Road, Jinan, Shandong Province, 250012, China. Fax: +86 531 88383146. E-mail address: [email protected] (H. Lou). 1 Xu Jing and Dongmei Ren contribute equally to this work. 0041-008X/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.taap.2013.10.018
becoming a promising therapeutic target for neuroprotection. There is increasing evidence that induction of the Nrf2/Antioxidant response element (ARE) signaling pathway confers protection against cerebral ischemia-reperfusion injury (Alfieri et al., 2011; Son et al., 2010). Astrocytes, the major glial non-neuronal cells, play an important role in the cellular antioxidant defense in the brain. They are the main source of glutathione (GSH) and supply the neurons with substrate for GSH synthesis to improve the neuronal antioxidative reserves (Dringen et al., 1999). ARE-regulated genes are preferentially activated in astrocytes, which consequently have more efficient detoxification and antioxidant defense than neurons. Activation of Nrf2 in astrocytes protects neurons from a wide array of potentially toxic insults. Nrf2 activation in astrocytes has thus been proposed as a novel therapeutic target for neuroprotection (Bell et al., 2011; Escartin et al., 2011; Vargas and Johnson, 2009). Over the past two decades, epidemiological studies have linked the consumption of flavonoid-containing dietary sources to reduced risk of cardiovascular disease and stroke (Arab and Liebeskind, 2010; Leonardo and Dore, 2011). Eriodictyol-7-O-glucoside (E7G), one of the most abundant flavonoids isolated from the Chinese herb Dracocephalum rupestre, has been identified as a novel Nrf2 activator and can confer protection against cisplatin-induced toxicity through activation of the Nrf2 pathway (Hu et al., 2012). Our previous paper also showed that its aglycone eriodictyol protected PC12 cells against
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
H2O2-induced oxidative stress (Lou et al., 2012). However, whether it is also protective in a cerebral ischemic model remains unknown. Based on the previous study, we hypothesized that E7G may confer neuroprotection against cerebral ischemia through Nrf2-coordinated induction of endogenous cytoprotective proteins. The present study reveals that E7G might be beneficial in mitigating cerebral ischemic injury in cellular and animal stroke models by upregulating phase II and antioxidant gene expression via Nrf2 activation. Material and methods Animals and reagents. Adult male Sprague–Dawley (SD) rats (280 g ~ 320 g) were used in the in vivo experiments. Newborn SD rats (day 0–1) were used for primary cortical astrocyte cultures. All experiments were approved by the Institutional Animal Care and Use Committee of Shandong University. E7G was provided by the Department of Natural Products Chemistry of Shandong University (Jinan, China) where its purity was confirmed to be N 98%. Dulbecco's modified Eagle medium (DMEM), penicillin, streptomycin and fetal bovine serum (FBS) were from Invitrogen/Gibco (Carlsbad, CA, USA). Antibodies to Nrf2, HO-1, γ-GCS, NQO-1, caspase-3 and β-actin, anti-mouse-horseradish peroxidase (HRP) IgG, anti-rabbit-HRP-IgG were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies to cleaved caspase-3 and Histone H3 were obtained from Cell Signaling Technology (Beverly, MA, USA). The siRNA reagents for Nrf2 were from Invitrogen/Gibco (Carlsbad, CA, USA). Primary culture and in vitro model of ischemia. Primary astrocyte cultures were obtained from neonatal rats as described previously with some minor modification (Halim et al., 2010). Briefly, cerebral cortices were harvested from neonatal SD rats. The dissociated cells were seeded in poly-D-lysine-coated 75-cm2 flasks and cultured in high-glucose DMEM supplemented with 20% fetal bovine serum. The medium was changed every 3 days. After ~14 days, the confluent cultures were agitated at 37 °C for 12 h to separate astrocytes from the remaining microglia and oligodendroglia. Cells were used between 18 and 21 days in culture when they reach maximal sensitivity to cell death caused by oxygen-glucose deprivation (OGD). To model ischemia-like conditions in vitro, primary cultured astrocytes were exposed to transient OGD for 60 min. Cell death/viability assessment of cultured astrocytes. Cells seeded in 96well plate were pretreated with E7G at the indicated concentrations for 2 h before being exposed to OGD for 60 min and incubated with E7G for an additional 24 h. OGD-induced cell death was quantified using the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay and by random blinded cell counting of Hoechst 33258 stained cells. Intracellular ROS measurement. The level of oxidative stress was determined by measuring intracellular ROS generation. The production of cellular ROS was detected using the 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) fluorescence assay (Tao et al., 2013). Cells were seeded in 6-well plate for 24 h prior to the experiment. On the following day, cells were pretreated with E7G at the indicated concentrations for 2h before being exposed to OGD for 60min, and then incubated with E7G for an additional 24 h. Cells were then washed with PBS and fresh medium containing DCFH-DA (10 μM) were added. After incubating at 37 °C for 30 min, the cells were washed with PBS, trypsinized, and resuspended in PBS. The level of ROS generated was measured using flow cytometry based on the fluorescence intensity of DCF at 525 nm after excitation at 485 nm. Determination of cellular reduced GSH content. Cells were treated either with 20, 40 and 80 μM of E7G for 24 h or with 80 μM of E7G for 0, 2, 4, 8 and 24 h. The intracellular GSH concentration was quantified using
673
the 5,5′-dithiobis(2-nitrobenzoic acid) colorimetric method according to the manufacturer's protocol as previously described (Lou et al., 2012). RNA isolation and real time RT-PCR. Total mRNA was isolated from astrocytes using TRIzol reagent (Invitrogen). The mRNA levels were analyzed by real time quantitative RT-PCR using a Bio-Rad iCycler system (BioRad, Hercules, CA). The specific primers for target genes are listed below. Nrf2: forward (GGTTGCCCACATTCCCAAAC) and reverse (TCCT GCCAAACTTGCTCCAT); HO-1: forward (CGACAGCATGTCCCAGGATT) and reverse (CTGGGTTCTGCTTGTTTCGC); γ-GCS: forward (GCACAG CTGGACTCTGTCAT) and reverse (GGGTTTTACCTGTGCCCACT); NQO-1: forward (AGCGCTTGACACTACGATCC) and reverse (CAATCAGGGCTCT TCTCACC); β-actin: forward (AGCCATGTACGTAGCCATCC) and reverse (ACCCTCATAGATGGGCACAG). Preparation of nuclear extracts. Cells were washed twice with cold PBS and were then scraped from the dishes with 1000 μl of PBS. Cell homogenates were centrifuged at 2000 g for 5 min. The supernatants were discarded, and the cell pellets were allowed to swell on ice for 15min after the addition of hypotonic buffer A containing 150 mM NaCl, 10 mM HEPES-KOH (pH 7.9), 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM edetic acid (EDTA, pH 8.0), 0.6% NP-40. After centrifuge at 6000 g for 10 min at 4 °C, the nuclear pellets were resuspended in buffer B (420 mM NaCl, 20 mM HEPES-KOH, pH 7.9, 0.5 mM PMSF, 0.2 mM EDTA, pH 8.0, 0.5 mM dithiothreitol, 1.2 mM MgCl2, 25% glycerol, 0.5 μg/ml aprotinin) and were left for 30 min on ice with constant agitation. The samples were then centrifuged at 10,000 g for 15 min at 4 °C. The supernatants containing the nuclear proteins were collected and stored in aliquots at −80°C. Nuclear extracts were used for western blot analysis of Nrf2 and Histone H3. Western blot analysis. Western blotting was performed as described previously (Lou et al., 2012). Briefly, cells were exposed to lysis buffer (50 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS with 10 μg/ml leupeptin, 10 μg/ml aprotinin, 1 mM benzamidine and 1 mM AEBSF), and after incubation on ice for 20 min, cells were collected, vortexed, and centrifuged at 14000 g for 10 min at 4 °C. The supernatants were utilized for western blot analysis of HO-1, γ-GCS, NQO-1 and caspase-3. The preparation of nuclear extracts was as described above. Total protein concentration was determined by BCA method (Beyotime, Haimen, China). Protein samples (20 or 30 μg) were separated by SDS-PAGE on 8%-12% Tris-Glycine gels and transferred to nitrocellulose. Equivalent sample loading was confirmed by Ponceau S staining and immunoblotting for β-actin or Histone H3 served as an internal control. Membranes were blocked in 5% milk-TBS and incubated overnight at 4 °C in primary antibody. Signals from HRP-conjugated-secondary antibodies were visualized by an enhanced chemiluminescence detection kit (Pierce, Rockford IL, USA). The blots were re-probed with β-actin or Histone H3 as the loading control. The densitometry of the bands was performed using ImageJ software. RNA interference study. Nrf2-specific short interference RNA (siRNA) was purchased from Invitrogen. Transfection was performed using Lipofectamine 2000 according to the manufacturer's protocol. The two siRNAs against the rat Nrf2 gene were: (1) UACUCACUGGGAGAGUAA GGUUUCC, (2)GGAAACCUUACUCUCCCAGUGAGUA. Briefly, cells were transfected with siRNA directed against Nrf2 or with a nontargeting scramble control siRNA for 48 h, followed by treatment with E7G for the indicated times. Cell samples were then collected for western blot analysis, MTT assay and measurement of intracellular ROS. Model for transient focal cerebral ischemia. Age-matched SD male rats were randomly assigned to various experimental groups. Transient middle cerebral artery occlusion (MCAO) was produced by intraluminal
674
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
occlusion of the left middle cerebral artery as described previously (Lou et al., 2004). Briefly, anesthesia was induced using 10% chloral hydrate. The left common carotid artery, external carotid artery (ECA) and internal carotid artery (ICA) were isolated. A nylon monofilament was introduced into the ECA lumen and advanced into the ICA to block the origin of the MCA. After 2 h of MCAO, the suture was carefully removed to restore blood flow. During and after the surgery, rectal temperature was maintained at 37 °C with a homeothermal blanket. The sham groups received the same surgery procedures except for the occlusion of the MCA. Neurological function evaluation and quantification of infarct volume. Neurological deficits were scored on a 4-point grade scale modified from Longa et al. (1989) 24 h after MCAO: 0, normal function; 1, flexion of the torso and contralateral forelimb on lifting the animal by the
tail; 2, circling to the contralateral side but normal posture at rest; 3, reclination to the contralateral side at rest; 4, absence of spontaneous motor activity. To calculate infarct volume, brains were removed at 24 h after MCAO, the brains were cut into 2 mm thick coronal sections and subjected to 2,3,5-triphenyltetrazolium chloride (TTC) staining. Infarct volume was measured by a blinded observer using digital imaging (Digital Camera, Olympus MDF-382E) and image analysis software (C imaging 1280 system). HE and TUNEL staining. Hematoxylin and eosin (HE) staining was performed to show the morphological features of injured neurons in cerebral cortex. Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was performed using an in situ cell death detection kit (Roche Diagnostic, Indianapolis, IN) according to the manufacturer's protocol.
Fig. 1. Eriodictyol-7-O-glucoside induces nuclear expression of Nrf2 and the expression of ARE-regulated genes in primary cultured astrocytes. (A) E7G induced Nrf2 expression in a concentration-dependent manner. Primary cultured astrocytes were treated with indicated concentrations of E7G for 8 h, after which nuclear extracts were prepared to measure the level of Nrf2 protein. (B) E7G-mediated induction of Nrf2 was also time-dependent. Primary cultured astrocytes were treated with 80 μM of E7G for 0, 2, 4 and 8 h, after which nuclear extracts were prepared to analyze the expression of Nrf2. (C) E7G induced the expression of ARE-regulated genes in a concentration-dependent manner. Primary cultured astrocytes were treated with E7G for 24 h and cell lysates were subjected to SDS-PAGE, and immunoblots were evaluated for HO-1, γ-GCS, NQO-1 and β-actin protein levels. (D) E7G increased intracellular GSH levels. Cells were either treated with 20, 40 and 80 μM of E7G for 24 h or with 80 μM of E7G for different time points. Cells were then harvested for total GSH level analysis. All data represent the mean ± S.D. from triplicate independent experiments. *p b 0.05; **p b 0.01 vs. control.
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
675
Statistical analysis. Data are expressed as means with standard deviation (SD). An analysis of the variance using the Tukey test was applied to compare the mean of each group with that of the control group. p b 0.05 was considered statistically significant. Results E7G activates the Nrf2 pathway and stimulates expression of Nrf2-mediated cytoprotective gens in astrocytes Examination of Nrf2 nuclear expression by western blot revealed that E7G induce Nrf2 nuclear translocation in a dose- and timedependent manner (Figs. 1A, B). We next determined whether E7G induces the expression of endogenous ARE-regulated genes. As shown in Fig. 1C, exposure of cells to E7G strongly induced HO-1 (heme oxygenase-1) and gamma glutamate cysteine ligase (γ-GCS) protein expression in a concentration dependent manner with little effect on NAD(P)H:quinine oxidoreductase 1 (NQO-1) expression. We also measured changes in GSH content in astrocytes after incubation with E7G. The data revealed that E7G significantly increased GSH content in a concentration- and time-dependent manner (Fig. 1D). This result was consistent with the noted increased level of γ-GCS, which is the ratelimiting enzyme in GSH synthesis. It has been previously demonstrated that E7G induced the Nrf2 pathway primarily through increasing Nrf2 stability rather than upregulating Nrf2 mRNA expression in MDA-MB-231 cells (Hu et al., 2012). In order to determine whether E7G activate Nrf2 in astrocytes in the same mechanism, the mRNA expression of Nrf2 and its target genes, HO-1, γ-GCS and NQO-1 were measured by real time RT-PCR. As shown in Figs. 2A and B, E7G exposure resulted in significant increase in mRNA levels of Nrf2 in a dose- and time-dependent manner. Similarly, mRNA levels of HO-1, γ-GCS and NQO-1 were upregulated by E7G treatment in a dose-dependent manner (Fig. 2C). E7G protects astrocytes against OGD-induced cell death Activation of the Nrf2/ARE pathway is known to confer resistance of cells to oxidative stress. To test the ability of E7G to prevent oxidative stress-induced cell death, we first performed the MTT assay and Hoechst 33258 staining by challenging primary cultured astrocytes with OGD. MTT assay revealed that E7G can reduce OGD-induced cell damage in a dose-dependent manner (Fig. 3A). This was further confirmed by Hoechst 33258 staining (Fig. 3B). Assessment of intracellular ROS level using DCFH-DA assay showed that E7G effectively reduced OGDinduced intracellular ROS level in a concentration-dependent manner (Fig. 3C). The protective effect of E7G was further confirmed by western blot analysis of cleaved caspase-3 expression. E7G pretreatment also attenuated the cleavage/activation of caspase-3 induced by OGD (Fig. 3D). The neuroprotective effect of E7G involves the Nrf2/ARE pathway To confirm that the protection afforded by E7G requires Nrf2 activation, we transfected astrocytes with either control (si-Control) or Nrf2specific (si-Nrf2) small interfering RNA for 48 h. The efficiency of the Nrf2 siRNA in knocking down Nrf2 was measured by western blot. As shown in Figs. 4A and B, the si-Nrf2 treatment significantly decreased the level of Nrf2 in nuclear extracts from cells treated with E7G, and reduced the up-regulation of its target genes, HO-1 and γ-GCS. We subsequently exposed si-Control or si-Nrf2-treated cells to 80 μM E7G and then subjected these cells to OGD challenge. The results demonstrated that in si-Control conditions, E7G was able to confer a cytoprotective response on OGD-challenged astrocytes, similar to previous data in untransfected cells, but less effective in protecting si-Nrf2-treated cells from OGD-induced cytotoxicity (Fig. 4C–E). These observations strongly suggest that Nrf2 is required for E7G-dependent cytoprotection against oxidative stress.
Fig. 2. E7G induced the Nrf2 signaling pathway through increasing Nrf2 mRNA expression in primary cultured astrocytes. (A) Primary cultured astrocytes were treated with indicated concentrations of E7G for 8 h, mRNA was extracted and quantitative RT-PCR was performed to show the mRNA levels of Nrf2. (B) Primary cultured astrocytes were treated with 80 μM of E7G for 0, 2, 4 and 8 h, mRNA was extracted and quantitative RTPCR was performed to show the mRNA levels of Nrf2. (C) Primary cultured astrocytes were treated with E7G for 24 h and mRNA was extracted and quantitative RT-PCR was performed to show the mRNA levels of HO-1, γ-GCS and NQO-1. All data represent the mean ± S.D. from triplicate independent experiments. *p b 0.05; **p b 0.01 vs. control.
E7G protects rats against cerebral ischemic injury Because E7G protected primary cultured astrocytes against insults relevant to ischemic stroke, we next tested whether Nrf2 activation by E7G may also contribute to neuroprotection in the rat focal cerebral ischemia model. Rats were pretreated with 30mg/kg E7G intraperitoneally for 5days prior to MCAO. As shown in Fig. 5A, Nrf2, HO-1 and γ-GCS levels were barely detectable in sham-operated rat cortex and upregulated at 8 and 24 h after reperfusion. Compared with vehicle-treated group, E7G pretreatment induced the upregulation of Nrf2, HO-1 and γ-GCS early after MCAO. The neurological deficit scores and the degree of brain damage (infarct volume) were assessed 24 h after reperfusion. Both the neurological deficit scores and the infarct volume in rats
676
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
Fig. 3. E7G protects primary cultured astrocytes against OGD-induced cell death. Cells were pretreated with E7G for 2 h before being subjected to 60 min OGD followed at 24 h by the (A) Cell viability assay using MTT; (B) Hoechst 33258 staining of nuclei and assessment of nuclear morphology (a: Control, b: OGD, c: E7G 40 μM + OGD, d: E7G 80 μM + OGD); (C) Intracellular ROS level and (D) Western blot analysis of cleaved-caspase 3. All data represent the mean ± S.D. of triplicate independent experiments. ##p b 0.01 vs. control, *p b 0.05; **p b 0.01 vs. OGD group.
pretreated with E7G were significantly less than the vehicle-treated rats at 24 h after reperfusion (Figs. 5B, C). The protective effect of E7G against cerebral ischemic damage was further confirmed by HE staining and TUNEL staining. Few TUNELpositive cells were seen in the sham group; however, there were numerous TUNEL-positive cells in the vehicle-treated group at 8 h and 24h after reperfusion. E7G pretreatment markedly reduced the number of TUNEL-positive cells and prevented neurons from apoptosis after cerebral ischemic injury (Figs. 5D, E). These data strongly suggest that the neuroprotection afforded by E7G is associated with its activation of Nrf2/ARE signaling pathway. Discussion Stroke is the second most common cause of death and the leading cause of adult disability for which no effective neuroprotective treatment is currently available (Balami et al., 2011; Donnan et al., 2008; Endres et al., 2008; Lopez et al., 2006). Oxidative stress is an important contributing factor in the pathogenesis of stroke, suggesting that therapeutic strategies directed against ROS might be particularly valuable for the prevention of stroke. There is increasing evidence showing that induction of the endogenous Nrf2/ARE antioxidant pathway can confer protection against cerebral ischemia-reperfusion injury. Targeting the Nrf2 pathway using small molecule activators presents an attractive opportunity since this intrinsic cellular pathway can be dynamically modulated (Alfieri et al., 2011). Several studies of stroke highlight the ability of natural plant-derived compounds to protect against stroke via activation of the Nrf2/ARE defense pathway (Shih et al., 2005; Wu et al., 2013; Zhao et al., 2007). E7G was one of the most abundant flavonoids isolated from Chinese herb Dracocephalum rupestre. Studies have shown that it could confer
protection against cisplatin-induced toxicity through activation of Nrf2 pathway (Hu et al., 2012). More recently, we demonstrated that its aglycone eriodictyol could protect neuronal-like PC12 cells against H2O2induced oxidative stress via the Nrf2 pathway (Lou et al., 2012). These data are noteworthy and suggest that specific flavonoids such as E7G could be beneficial for the treatment of ischemic stroke associated with oxidative stress. In this study, we have demonstrated that E7G can activate the Nrf2 pathway both in vitro and in vivo and protects astrocytes against OGD-induced cell death. Furthermore, in vivo studies using a focal cerebral ischemia model have shown that E7G could attenuate ischemic neuronal injury. The protective effect of E7G was blocked when Nrf2 was knocked down with specific Nrf2 siRNA, indicating that E7G-mediated neuroprotection may occur by activation of the transcription factor Nrf2. Taken together, our studies reveal that E7G affords neuroprotection via activation of the Nrf2/ARE pathway and suggest a promising therapeutic strategy for ischemic stroke. Nrf2 is a key regulator in cell survival and its activation can coordinately upregulate expression of several antioxidative enzymes such as HO-1 and γ-GCS, which play important roles in combating oxidative stress. As a phase II enzyme, HO-1 is neuroprotective against stroke, as HO-1 knockout increased infarct size whereas HO-1 overexpression reduced infarct size in mice (Panahian et al., 1999; Shah et al., 2011). ARE-mediated gene transcription has been reported to be more robust in astrocytes than in neurons (Kraft et al., 2004; Shih et al., 2003; Vargas et al., 2006), therefore, we choose primary astrocytes as our in vitro cell model. Consistent with these studies, the current results showed that treatment with E7G resulted in a significant increase in protein expression of Nrf2 and its target genes, HO-1 and γ-GCS, in astrocytes and in rat cortex. Our study also demonstrated that E7G treatment can increase the cellular GSH level in astrocytes consistent with the upregulation of γ-GCS, the rate-limiting enzyme in GSH
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
677
Fig. 4. E7G affords cell protection through the Nrf2/ARE pathway. (A) Cells were transiently transfected with control or Nrf2 siRNA for 48 h, followed by treatment with 80 μM of E7G for an additional 8 h. Nuclear extracts were analyzed for Nrf2 levels, using Histone H3 as an internal control. (B) Representative immunoblots for HO-1 and γ-GCS following 80 μM of E7G treatment for 24 h in control and Nrf2 siRNA-treated cells. (C) Cells were treated for 48 h with control or Nrf2 siRNA, then subjected to 80 μM E7G for 2 h before being subjected to 60 min OGD followed at 24 h by the MTT assay, (D) Intracellular ROS level and (E) Western blot analysis of cleaved-caspase 3. Data are mean ± S.D. of three different experiments. ⁎⁎p b 0.01 vs. control, ##p b 0.01 vs. si-Control + E7G treated group, ▲▲p b 0.01 vs. OGD, and &p b 0.01 vs. E7G-treated OGD group.
biosynthesis. GSH is the main cellular antioxidant against ROS. Neuronal GSH synthesis requires astrocyte release of GSH, extracellular cleavage of GSH to cysteine, and neuronal uptake of cysteine through the excitatory amino acid transporter 3 (EAAT3) (Aoyama et al., 2008; Dringen and Hirrlinger, 2003; Escartin et al., 2011). Nrf2 activation has been shown to increase GSH production and extracellular release of GSH by increasing the expression of enzymes and transporters involved in GSH metabolism (Panahian et al., 1999; Shah et al., 2011). E7G treatment also significantly reduced OGD-induced oxidative stress and apoptosis in primary cultured astrocytes. These findings provide compelling data that E7G prevents oxidative stress and apoptosis in astrocytes by activating Nrf2 signaling. However, while we have demonstrated that E7G treatment increased the protein expression and
activities of HO-1 and γ-GCS in this study, it is noteworthy that it does not imply that the protective effects of E7G are mediated solely by HO-1 and γ-GCS. Other antioxidants induced by Nrf2, which can induce a wide spectrum of antioxidants, may also contribute to the protective effects of E7G. This study provides the first experimental evidence that E7G affords neuroprotection against ischemic stroke via activation of the Nrf2/ARE pathway. The potency of E7G in preventing against focal cerebral ischemia along with the fact that E7G is a natural plant-derived compound makes E7G a promising therapeutic agent for stroke. Nonetheless, several issues still need to be addressed in the future. Examples include whether other signaling pathways contribute to the neuroprotective effects of E7G. Taken together, the results of this study support the
678
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
Fig. 5. E7G protects against cerebral ischemia reperfusion injury in MCAO rats. Rats were intraperitoneally injected with either vehicle (control) or 30 mg/kg of E7G for 5 days before MCAO surgery. (A) Nrf2 and its target gene were induced by E7G in the cortex of MCAO rats but not in control rats. Brain cortex tissues were collected at 8 and 24 h after cerebral ischemia/ reperfusion injury and brain homogenates were evaluated by western blot for Nrf2, HO-1, γ-GCS and actin. (B) TTC staining was used to calculate the infarct volume and (C) Neurological deficit scores were determined at 24 h after ischemia/reperfusion in rats. (D) Representative images of HE staining and TUNEL staining performed on sections from control and ischemic cortex, the percentage of apoptotic cells in the ischemic cortex was shown in (E). #p b 0.05, ##p b 0.01 vs. sham, &p b 0.05 vs. I/R 8 h group, *p b 0.05, **p b 0.01 vs. I/R 24 h group.
hypothesis that pharmacological activation of the Nrf2 pathway can provide neuroprotection against cerebral ischemia/reperfusion injury.
Conflict of interest statement The authors declare that there are no conflicts of interest.
X. Jing et al. / Toxicology and Applied Pharmacology 273 (2013) 672–679
Acknowledgment This study was supported by grants from the National Natural Science Foundation of China (No. 81274124, No. 81200982), the Foundation for Excellent Young and Middle-Aged Scientists of Shandong Province (No. BS2010YY036) and the Postdoctoral Innovation Research Program of Shandong Province (No. 201102021). References Alfieri, A., Srivastava, S., Siow, R.C., Modo, M., Fraser, P.A., Mann, G.E., 2011. Targeting the Nrf2-Keap1 antioxidant defence pathway for neurovascular protection in stroke. J. Physiol. 589, 4125–4136. Aoyama, K., Watabe, M., Nakaki, T., 2008. Regulation of neuronal glutathione synthesis. J. Pharmacol. Sci. 108, 227–238. Arab, L., Liebeskind, D.S., 2010. Tea, flavonoids and stroke in man and mouse. Arch. Biochem. Biophys. 501, 31–36. Balami, J.S., Chen, R.L., Grunwald, I.Q., Buchan, A.M., 2011. Neurological complications of acute ischaemic stroke. Lancet Neurol. 10, 357–371. Bell, K.F., Al-Mubarak, B., Fowler, J.H., Baxter, P.S., Gupta, K., Tsujita, T., Chowdhry, S., Patani, R., Chandran, S., Horsburgh, K., Hayes, J.D., Hardingham, G.E., 2011. Mild oxidative stress activates Nrf2 in astrocytes, which contributes to neuroprotective ischemic preconditioning. Proc. Natl. Acad. Sci. U. S. A. 108, E1–E2. Chen, H., Yoshioka, H., Kim, G.S., Jung, J.E., Okami, N., Sakata, H., Maier, C.M., 2011. Oxidative stress in ischemic brain damage: mechanisms of cell death and potential molecular targets for neuroprotection. Antioxid. Redox Signal. 14, 1505–1517. Donnan, G.A., Fisher, M., Macleod, M., Davis, S.M., 2008. Stroke. Lancet 371, 1612–1623. Dringen, R., Hirrlinger, J., 2003. Glutathione pathways in the brain. Biol. Chem. 384, 505–516. Dringen, R., Pfeiffer, B., Hamprecht, B., 1999. Synthesis of the antioxidant glutathione in neurons: supply by astrocytes of CysGly as precursor for neuronal glutathione. J. Neurosci. 19, 562–569. Endres, M., Engelhardt, B., Koistinaho, J., Lindvall, O., Meairs, S., Mohr, J.P., Planas, A., Rothwell, N., Schwaninger, M., Schwab, M.E., Vivien, D., Wieloch, T., Dirnagl, U., 2008. Improving outcome after stroke: overcoming the translational roadblock. Cerebrovasc. Dis. 25, 268–278. Escartin, C., Won, S.J., Malgorn, C., Auregan, G., Berman, A.E., Chen, P.C., Déglon, N., Johnson, J.A., Suh, S.W., Swanson, R.A., 2011. Nuclear factor erythroid 2-related factor 2 facilitates neuronal glutathione synthesis by upregulating neuronal excitatory amino acid transporter 3 expression. J. Neurosci. 31, 7392–7401. Halim, N.D., Mcfate, T., Mohyeldin, A., Okagaki, P., Korotchkina, L.G., Patel, M.S., Jeoung, N.H., Harris, R.A., Schell, M.J., Verma, A., 2010. Phosphorylation status of pyruvate dehydrogenase distinguishes metabolic phenotypes of cultured rat brain astrocytes and neurons. Glia 58, 1168–1176. Hu, Q., Zhang, D.D., Wang, L., Lou, H., Ren, D., 2012. Eriodictyol-7-O-glucoside, a novel Nrf2 activator, confers protection against cisplatin-induced toxicity. Food Chem. Toxicol. 50, 1927–1932.
679
Kraft, A.D., Johnson, D.A., Johnson, J.A., 2004. Nuclear factor E2-related factor 2-dependent antioxidant response element activation by tert-butylhydroquinone and sulforaphane occurring preferentially in astrocytes conditions neurons against oxidative insult. J. Neurosci. 24, 1101–1112. Leonardo, C.C., Dore, S., 2011. Dietary flavonoids are neuroprotective through Nrf2coordinated induction of endogenous cytoprotective proteins. Nutr. Neurosci. 14, 226–236. Longa, E.Z., Weinstein, P.R., Carlson, S., Cummins, R., 1989. Reversible middle cerebral artery occlusion without craniectomy in the rats. Stroke 20, 84–91. Lopez, A.D., Mathers, C.D., Ezzati, M., Jamison, D.T., Murray, C.J., 2006. Global and regional burden of disease and risk factors, 2001: systematic analysis of population health data. Lancet 367, 1747–1757. Lou, H., Zhang, X., Wei, X., Wang, R., Sun, X., 2004. Anti-inflammatory effect of hydroxyethylpuerarin on focal brain ischemia/reperfusion injury in rats. Chin. J. Physiol. 47, 197–201. Lou, H., Jing, X., Ren, D., Wei, X., Zhang, X., 2012. Eriodictyol protects against H(2)O(2)induced neuron-like PC12 cell death through activation of Nrf2/ARE signaling pathway. Neurochem. Int. 61, 251–257. Panahian, N., Yoshiura, M., Maines, M.D., 1999. Overexpression of heme oxygenase-1 is neuroprotective in a model of permanent middle cerebral artery occlusion in transgenic mice. J. Neurochem. 72, 1187–1203. Shah, Z.A., Nada, S.E., Dore, S., 2011. Heme oxygenase 1, beneficial role in permanent ischemic stroke and in gingko biloba (EGB 761) neuroprotection. Neuroscience 180, 248–255. Shih, A.Y., Johnson, D.A., Wong, G., Kraft, A.D., Jiang, L., Erb, H., Johnson, J.A., Murphy, T.H., 2003. Coordinate regulation of glutathione biosynthesis and release by Nrf2expressing glia potently protects neurons from oxidative stress. J. Neurosci. 23, 3394–3406. Shih, A.Y., Li, P., Murphy, T.H., 2005. A small-molecule-inducible Nrf2-mediated antioxidant response provides effective prophylaxis against cerebral ischemia in vivo. J. Neurosci. 25, 10321–10335. Son, T.G., Camandola, S., Arumugam, T.V., Cutler, R.G., Telljohann, R.S., Mughal, M.R., Moore, T.A., Luo, W., Yu, Q.S., Johnson, D.A., Johnson, J.A., Greig, N.H., Mattson, M.P., 2010. Plumbagin, a novel Nrf2/ARE activator, protects against cerebral ischemia. J. Neurochem. 112, 1316–1326. Tao, S., Zheng, Y., Lau, A., Jaramillo, M.C., Chau, B.T., Lantz, R.C., Wong, P.K., Wondrak, G.T., Zhang, D.D., 2013. Tanshinone I activates the Nrf2-dependent antioxidant response and protects against As(III)-induced lung inflammation in vitro and in vivo. Antioxid. Redox Signal. 19, 1647–1661. Vargas, M.R., Pehar, M., Cassina, P., Beckman, J.S., Barbeito, L., 2006. Increased glutathione biosynthesis by Nrf2 activation in astrocytes prevents p75NTRdependent-motor neuron apoptosis. J. Neurochem. 97, 687–696. Vargas, M.R., Johnson, J.A., 2009. The Nrf2-ARE cytoprotective pathway in astrocytes. Expert. Rev. Mol. Med. 11, e17. Wu, J., Li, Q., Wang, X., Yu, S., Li, L., Wu, X., Chen, Y., Zhao, J., Zhao, Y., 2013. Neuroprotection by curcumin in ischemic brain injury involves the Akt/Nrf2 pathway. PLoS One 8, e59843. Zhao, J., Moore, A.N., Redell, J.B., Dash, P.K., 2007. Enhancing expression of Nrf2driven genes protects the blood brain barrier after brain injury. J. Neurosci. 27, 10240–10248.
