Downloaded from gut.bmj.com on July 17, 2014 - Published by group.bmj.com
Gut Online First, published on April 30, 2014 as 10.1136/gutjnl-2013-306347 Oesophagus
ORIGINAL ARTICLE
ER stress induces epithelial differentiation in the mouse oesophagus Sanne L Rosekrans,1 Jarom Heijmans,1 Nikè V J A Büller,1 Jessica Westerlund,1 Amy S Lee,2 Vanesa Muncan,1 Gijs R van den Brink1 ▸ Additional material is published online only. To view please visit the journal online (http://dx.doi.org/10.1136/ gutjnl-2013-306347). 1
Tytgat Institute for Liver and Intestinal Research and Department of Gastroenterology & Hepatology, Academic Medical Center, Amsterdam, The Netherlands 2 Department of Biochemistry and Molecular Biology, USC/ Norris Comprehensive Cancer Center, University of Southern California Keck School of Medicine, Los Angeles, California, USA Correspondence to Professor Gijs R van den Brink, Tytgat Institute for Liver and Intestinal Research, Academic Medical Center, Amsterdam 1105 AZ, The Netherlands; [email protected] Received 25 October 2013 Revised 31 March 2014 Accepted 2 April 2014
ABSTRACT Objective Stress in the endoplasmic reticulum (ER) leads to activation of the unfolded protein response (UPR). Xbp1, a key component of the UPR has recently been linked to the risk of developing oesophageal squamous cell carcinoma, suggesting an important role for the UPR in the oesophageal epithelium. Here we examined the role of ER stress and the UPR in oesophageal epithelial homoeostasis. Design We examined the expression of components of the UPR in the oesophageal epithelium. We used a pharmacological approach and a genetic approach to examine the effects of ER stress in vivo in the mouse oesophagus. The oesophagus of these mice was examined using immunohistochemistry and real-time reverse transcription (RT)-PCR. Results Components of the UPR were heterogeneously expressed in the basal layer of the epithelium. Induction of ER stress by 24-h treatment with thapsigargin resulted in depletion of proliferating cells in the basal layer of the oesophagus and induced differentiation. We next activated the UPR by inducible deletion of the major ER chaperone Grp78 in Ah1Cre-Rosa26-LacZ-Grp78−/− mice in which mutant cells could be traced by expression of LacZ. In these mice LacZ-positive mutant cells in the basal layer lost their proliferative capacity, migrated towards the oesophageal lumen and were replaced by LacZ-negative non-mutant cells. We observed no apoptosis in mutant cells. Conclusions These results show that ER stress induces epithelial differentiation in precursor cells in the oesophageal epithelium. This UPR induced differentiation may serve as a quality control mechanism that protects against oesophageal cancer development.
INTRODUCTION
To cite: Rosekrans SL, Heijmans J, Büller NVJA, et al. Gut Published Online First: [ please include Day Month Year] doi:10.1136/ gutjnl-2013-306347
The squamous epithelium of the oesophagus is a rapidly renewing tissue. The epithelium is hierarchically organised with proliferating cells in the basal layer, which maintain cellular renewal. As these cells differentiate, they move upwards, lose their nucleus and are eventually shed off into the lumen. Although there has been a lot of focus on the stem cell compartment, programmed cell divisions, differentiation and cell death in other parts of the GI tract, comparatively little is known about these processes in the oesophagus. More insight into oesophageal epithelial homoeostasis may shed important new light on mechanisms that drive oesophageal squamous cell carcinoma, a cancer with a devastating prognosis.
Significance of this study What is already known about this subject?
▸ Xbp1 lies in a susceptibility locus associated with the risk of developing oesophageal squamous cell carcinoma. ▸ In the intestine induction of endoplasmic reticulum (ER) stress, and thereby initiation of the unfolded protein response, leads to loss of intestinal epithelial stem cells due to differentiation. ▸ Xbp1 deletion in the small and large intestine promotes tumourigenesis via ER stress.
What are the new findings?
▸ Components of the unfolded protein response are expressed in a heterogeneous manner in the basal layer. ▸ Induction of ER stress causes rapid depletion of oesophageal precursor cells, which are replaced by non-stressed cells. ▸ Oesophageal epithelial cells with high levels of ER stress do not undergo apoptosis but are forced to differentiate.
How might it impact on clinical practice in the foreseeable future?
▸ Understanding oesophageal epithelial homoeostasis can unravel mechanisms that drive oesophageal squamous cell carcinoma, a cancer with a very poor prognosis.
Recently, using a genome-wide association study, the locus of transcription factor X-box-binding protein 1 (XBP1) was identified as susceptibility locus associated with oesophageal squamous cell carcinoma.1 Xbp1 is part of the unfolded protein response (UPR), a signalling pathway associated with the endoplasmic reticulum (ER). The ER is the major site for folding and modification of transmembrane and secreted proteins. Under homoeostatic conditions, the ER-associated chaperone 78 kDa glucose-regulated protein (Grp78) is in a dynamic equilibrium between folding proteins and three ER transmembrane receptors, Ire1α, Perk and Atf6. When folding proteins accumulate Grp78 is shifted away from the receptors resulting in the activation of the UPR.2 Ire1α will splice the mRNA of Xbp1, resulting in a frame shift which generates a longer transcriptionally active form of Xbp1 (Xbp1s). Perk will phosphorylate eIF2α and Atf6 is
Rosekrans SL,Article et al. Gut author 2014;0:1–8. doi:10.1136/gutjnl-2013-306347 1 Copyright (or their employer) 2014. Produced by BMJ Publishing Group Ltd (& BSG) under licence.
Downloaded from gut.bmj.com on July 17, 2014 - Published by group.bmj.com
Oesophagus cleaved to generate a fragment that can translocate to the nucleus.3 Activation of the UPR results the induction of canonical targets such as Chop and Atf4 and in upregulation of Grp78 transcription thus contributing to the re-establishment of homoeostasis in the ER.4 5 We have recently found that components of the UPR are differentially expressed between stem cells and transit amplifying (TA) cells in the crypts of the small intestinal epithelium. Activation of ER stress and the UPR in intestinal epithelial stem cells resulted in rapid loss of stem cells due to an induction of stem cell to TA cell differentiation.6 Here we set out to investigate the distribution of components of the UPR in the oesophageal epithelium and the role of ER stress in oesophageal homoeostasis using a pharmacological approach and a genetic approach.
METHODS Mice Animals were housed in the Leiden University Medical Center experimental animal centre or in the Academic Medical Center animal research institute and were handled in accordance with guidelines and with permission of the local experimental animal committees. Wild type C57BL/6 mice, ordered from the Jackson Laboratory, were treated with a single intraperitoneal injection with vehicle (dimethylsulfoxide, DMSO) or 1 mg/kg thapsigargin in 50 μL corn oil containing 10% DMSO and sacrificed 24 h later. The Grp78fl/fl allele,7 8 the Rosa26-LacZ allele,9 and the Ah1Cre allele10 have been described previously. In Ah1CreRosa26-LacZ-Grp78+/+ and Ah1Cre-Rosa26-LacZ-Grp78−/− compound mice, Cre was induced by intraperitoneal injections with β-naphthoflavone in corn oil (80 mg/kg) three times in 12 h.
Immunohistochemistry Slides were deparaffinised, dehydrated and immersed in 1.5% H2O2 in methanol for 20 min. Slides were cooked at 100°C for 20 min in 0.1 M sodium citrate (pH 6) and blocked with phosphate buffered saline (PBS) with 1% bovine serum albumin and 0.1% Triton X-100 (PBT) for 30 min, followed by incubation overnight at 4°C with the primary antibody in PBT. The following antibodies were used: anti-Xbp1 (HPA044305, Sigma), anti-Grp78 (3177, Cell Signaling), anti-BrdU (BMC 9318, Roche), anti-Ki67 (MONX10284, Monosan), antiactive caspase3 (9661L, Cell Signaling), anti-Krt13 (ab90096, Abcam), anti-loricrin (anti-Lor) (ab24722, Abcam) and anti-involucrin (anti-Ivl) (80192, Imgenex). Slides were subsequently incubated for 30 min with Brightvision-horseradish peroxidase from Immunologic. Peroxidase activity was detected with 3,3-diaminobenzidine (Sigma, D5637). Sections were counterstained with haematoxylin, dehydrated and mounted with Pertex (Histolab 00801).
X-Gal staining X-Gal staining was performed by fixing freshly isolated tissues for 90 min at 4°C in PBS containing 1% formaldehyde, 0.2% glutaraldehyde and 0.02% NP-40. Subsequently tissue was washed in ice-cold PBS and stained overnight in the dark at 37° C using PBS containing 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2, 1 mg/mL X-Gal and 0.02% NP-40. The next day tissue was fixed overnight in 4% formaldehyde.
RNA isolation, complementary DNA synthesis and quantitative reverse transcription (RT)-PCR For isolation of RNA an RNeasy kit from Qiagen (74104) was used. The tissue was homogenised in Qiagen RNeasy Lysis buffer using a rotor-stator homogeniser and extraction was performed 2
according to manufacturer’s instructions. Complementary DNA was synthesised from 1 μg RNA, using Revertaid (Fermentas).
Quantitative RT-PCR Quantitative RT-PCR was performed using SybrGreen (QIAGEN) according to manufacturers’ protocol. Concentrations were corrected for the amount of Cyclophilin in each sample. Primers for Krt13 were preoptimised from Qiagen (QT00101402). The other primers were designed using mouse qPrimerDepot http://mouseprimerdepot.nci.nih.gov/. Primers used are listed in the table below. A Bio-Rad iCycler IQ5 was used for the quantitative reverse-transcription PCR assay.
Primer name
Forward
Reverse
Mm_Cyclophilin mm_Ddit3 mm_Xbp1s mm_Ivl mm_Lor mm_Notch1 mm_Notch2 mm_Notch3 mm_Jag1 mm_Jag2 mm_Dll1 mm_Dll3 mm_Hes5 mm_p21
ATGGTCAACCCCACCGTGT CTGGAAGCCTGGTATGAGGAT AGGCTTGGTGTATACATGG CAGGAGTCACATGAGCCAGA TCCCTCACTCATCTTCCCTG GAATGGAGGTAGGTGCGAAG TGCTGTGGCTCTGGCTGT AAGCGTCTCCTGGATGCTG GCTTCGGCTCAGGGTCTAC CGTCGTCATTCCCTTTCAGT GGAGAAGATGTGCGACCCT TCCCTGTCTCCACCAGTAGC AACTCCAAGCTGGAGAAGGC CGGTGTCAGAGTCTAGGGGA
TTCTGCTGTCTTTGGAACTTTGTC CAGGGTCAAGAGTAGTGAAGGT GGTCTGCTGAGTCCGCAGCAGG TATCTGTTGCTGCTGCTGCT GGTCTTTCCACAACCCACAG CTGAGGCAAGGATTGGAGTC TGTGCCGTTGTGGTAGGTAA GAATCTGGAAGACACCCTGG GGCGAAACTGAAAGGCAGTA ATCAGCAGCTCCTCATCTGG CTCCCCTGGTTTGTCACAGT GTTCCCATCACAAGGTCCAG GTAGTCCTGGTGCAGGCTCT ATCACCAGGATTGGACATGG
Statistics Statistical analysis was performed with Prism V.5.0 (GraphPad Software). All values were represented as the mean±SEM. Samples were analysed using a student t test. Differences were considered statistically significant at p
Gut Online First, published on April 30, 2014 as 10.1136/gutjnl-2013-306347 Oesophagus
ORIGINAL ARTICLE
ER stress induces epithelial differentiation in the mouse oesophagus Sanne L Rosekrans,1 Jarom Heijmans,1 Nikè V J A Büller,1 Jessica Westerlund,1 Amy S Lee,2 Vanesa Muncan,1 Gijs R van den Brink1 ▸ Additional material is published online only. To view please visit the journal online (http://dx.doi.org/10.1136/ gutjnl-2013-306347). 1
Tytgat Institute for Liver and Intestinal Research and Department of Gastroenterology & Hepatology, Academic Medical Center, Amsterdam, The Netherlands 2 Department of Biochemistry and Molecular Biology, USC/ Norris Comprehensive Cancer Center, University of Southern California Keck School of Medicine, Los Angeles, California, USA Correspondence to Professor Gijs R van den Brink, Tytgat Institute for Liver and Intestinal Research, Academic Medical Center, Amsterdam 1105 AZ, The Netherlands; [email protected] Received 25 October 2013 Revised 31 March 2014 Accepted 2 April 2014
ABSTRACT Objective Stress in the endoplasmic reticulum (ER) leads to activation of the unfolded protein response (UPR). Xbp1, a key component of the UPR has recently been linked to the risk of developing oesophageal squamous cell carcinoma, suggesting an important role for the UPR in the oesophageal epithelium. Here we examined the role of ER stress and the UPR in oesophageal epithelial homoeostasis. Design We examined the expression of components of the UPR in the oesophageal epithelium. We used a pharmacological approach and a genetic approach to examine the effects of ER stress in vivo in the mouse oesophagus. The oesophagus of these mice was examined using immunohistochemistry and real-time reverse transcription (RT)-PCR. Results Components of the UPR were heterogeneously expressed in the basal layer of the epithelium. Induction of ER stress by 24-h treatment with thapsigargin resulted in depletion of proliferating cells in the basal layer of the oesophagus and induced differentiation. We next activated the UPR by inducible deletion of the major ER chaperone Grp78 in Ah1Cre-Rosa26-LacZ-Grp78−/− mice in which mutant cells could be traced by expression of LacZ. In these mice LacZ-positive mutant cells in the basal layer lost their proliferative capacity, migrated towards the oesophageal lumen and were replaced by LacZ-negative non-mutant cells. We observed no apoptosis in mutant cells. Conclusions These results show that ER stress induces epithelial differentiation in precursor cells in the oesophageal epithelium. This UPR induced differentiation may serve as a quality control mechanism that protects against oesophageal cancer development.
INTRODUCTION
To cite: Rosekrans SL, Heijmans J, Büller NVJA, et al. Gut Published Online First: [ please include Day Month Year] doi:10.1136/ gutjnl-2013-306347
The squamous epithelium of the oesophagus is a rapidly renewing tissue. The epithelium is hierarchically organised with proliferating cells in the basal layer, which maintain cellular renewal. As these cells differentiate, they move upwards, lose their nucleus and are eventually shed off into the lumen. Although there has been a lot of focus on the stem cell compartment, programmed cell divisions, differentiation and cell death in other parts of the GI tract, comparatively little is known about these processes in the oesophagus. More insight into oesophageal epithelial homoeostasis may shed important new light on mechanisms that drive oesophageal squamous cell carcinoma, a cancer with a devastating prognosis.
Significance of this study What is already known about this subject?
▸ Xbp1 lies in a susceptibility locus associated with the risk of developing oesophageal squamous cell carcinoma. ▸ In the intestine induction of endoplasmic reticulum (ER) stress, and thereby initiation of the unfolded protein response, leads to loss of intestinal epithelial stem cells due to differentiation. ▸ Xbp1 deletion in the small and large intestine promotes tumourigenesis via ER stress.
What are the new findings?
▸ Components of the unfolded protein response are expressed in a heterogeneous manner in the basal layer. ▸ Induction of ER stress causes rapid depletion of oesophageal precursor cells, which are replaced by non-stressed cells. ▸ Oesophageal epithelial cells with high levels of ER stress do not undergo apoptosis but are forced to differentiate.
How might it impact on clinical practice in the foreseeable future?
▸ Understanding oesophageal epithelial homoeostasis can unravel mechanisms that drive oesophageal squamous cell carcinoma, a cancer with a very poor prognosis.
Recently, using a genome-wide association study, the locus of transcription factor X-box-binding protein 1 (XBP1) was identified as susceptibility locus associated with oesophageal squamous cell carcinoma.1 Xbp1 is part of the unfolded protein response (UPR), a signalling pathway associated with the endoplasmic reticulum (ER). The ER is the major site for folding and modification of transmembrane and secreted proteins. Under homoeostatic conditions, the ER-associated chaperone 78 kDa glucose-regulated protein (Grp78) is in a dynamic equilibrium between folding proteins and three ER transmembrane receptors, Ire1α, Perk and Atf6. When folding proteins accumulate Grp78 is shifted away from the receptors resulting in the activation of the UPR.2 Ire1α will splice the mRNA of Xbp1, resulting in a frame shift which generates a longer transcriptionally active form of Xbp1 (Xbp1s). Perk will phosphorylate eIF2α and Atf6 is
Rosekrans SL,Article et al. Gut author 2014;0:1–8. doi:10.1136/gutjnl-2013-306347 1 Copyright (or their employer) 2014. Produced by BMJ Publishing Group Ltd (& BSG) under licence.
Downloaded from gut.bmj.com on July 17, 2014 - Published by group.bmj.com
Oesophagus cleaved to generate a fragment that can translocate to the nucleus.3 Activation of the UPR results the induction of canonical targets such as Chop and Atf4 and in upregulation of Grp78 transcription thus contributing to the re-establishment of homoeostasis in the ER.4 5 We have recently found that components of the UPR are differentially expressed between stem cells and transit amplifying (TA) cells in the crypts of the small intestinal epithelium. Activation of ER stress and the UPR in intestinal epithelial stem cells resulted in rapid loss of stem cells due to an induction of stem cell to TA cell differentiation.6 Here we set out to investigate the distribution of components of the UPR in the oesophageal epithelium and the role of ER stress in oesophageal homoeostasis using a pharmacological approach and a genetic approach.
METHODS Mice Animals were housed in the Leiden University Medical Center experimental animal centre or in the Academic Medical Center animal research institute and were handled in accordance with guidelines and with permission of the local experimental animal committees. Wild type C57BL/6 mice, ordered from the Jackson Laboratory, were treated with a single intraperitoneal injection with vehicle (dimethylsulfoxide, DMSO) or 1 mg/kg thapsigargin in 50 μL corn oil containing 10% DMSO and sacrificed 24 h later. The Grp78fl/fl allele,7 8 the Rosa26-LacZ allele,9 and the Ah1Cre allele10 have been described previously. In Ah1CreRosa26-LacZ-Grp78+/+ and Ah1Cre-Rosa26-LacZ-Grp78−/− compound mice, Cre was induced by intraperitoneal injections with β-naphthoflavone in corn oil (80 mg/kg) three times in 12 h.
Immunohistochemistry Slides were deparaffinised, dehydrated and immersed in 1.5% H2O2 in methanol for 20 min. Slides were cooked at 100°C for 20 min in 0.1 M sodium citrate (pH 6) and blocked with phosphate buffered saline (PBS) with 1% bovine serum albumin and 0.1% Triton X-100 (PBT) for 30 min, followed by incubation overnight at 4°C with the primary antibody in PBT. The following antibodies were used: anti-Xbp1 (HPA044305, Sigma), anti-Grp78 (3177, Cell Signaling), anti-BrdU (BMC 9318, Roche), anti-Ki67 (MONX10284, Monosan), antiactive caspase3 (9661L, Cell Signaling), anti-Krt13 (ab90096, Abcam), anti-loricrin (anti-Lor) (ab24722, Abcam) and anti-involucrin (anti-Ivl) (80192, Imgenex). Slides were subsequently incubated for 30 min with Brightvision-horseradish peroxidase from Immunologic. Peroxidase activity was detected with 3,3-diaminobenzidine (Sigma, D5637). Sections were counterstained with haematoxylin, dehydrated and mounted with Pertex (Histolab 00801).
X-Gal staining X-Gal staining was performed by fixing freshly isolated tissues for 90 min at 4°C in PBS containing 1% formaldehyde, 0.2% glutaraldehyde and 0.02% NP-40. Subsequently tissue was washed in ice-cold PBS and stained overnight in the dark at 37° C using PBS containing 5 mM K3Fe(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2, 1 mg/mL X-Gal and 0.02% NP-40. The next day tissue was fixed overnight in 4% formaldehyde.
RNA isolation, complementary DNA synthesis and quantitative reverse transcription (RT)-PCR For isolation of RNA an RNeasy kit from Qiagen (74104) was used. The tissue was homogenised in Qiagen RNeasy Lysis buffer using a rotor-stator homogeniser and extraction was performed 2
according to manufacturer’s instructions. Complementary DNA was synthesised from 1 μg RNA, using Revertaid (Fermentas).
Quantitative RT-PCR Quantitative RT-PCR was performed using SybrGreen (QIAGEN) according to manufacturers’ protocol. Concentrations were corrected for the amount of Cyclophilin in each sample. Primers for Krt13 were preoptimised from Qiagen (QT00101402). The other primers were designed using mouse qPrimerDepot http://mouseprimerdepot.nci.nih.gov/. Primers used are listed in the table below. A Bio-Rad iCycler IQ5 was used for the quantitative reverse-transcription PCR assay.
Primer name
Forward
Reverse
Mm_Cyclophilin mm_Ddit3 mm_Xbp1s mm_Ivl mm_Lor mm_Notch1 mm_Notch2 mm_Notch3 mm_Jag1 mm_Jag2 mm_Dll1 mm_Dll3 mm_Hes5 mm_p21
ATGGTCAACCCCACCGTGT CTGGAAGCCTGGTATGAGGAT AGGCTTGGTGTATACATGG CAGGAGTCACATGAGCCAGA TCCCTCACTCATCTTCCCTG GAATGGAGGTAGGTGCGAAG TGCTGTGGCTCTGGCTGT AAGCGTCTCCTGGATGCTG GCTTCGGCTCAGGGTCTAC CGTCGTCATTCCCTTTCAGT GGAGAAGATGTGCGACCCT TCCCTGTCTCCACCAGTAGC AACTCCAAGCTGGAGAAGGC CGGTGTCAGAGTCTAGGGGA
TTCTGCTGTCTTTGGAACTTTGTC CAGGGTCAAGAGTAGTGAAGGT GGTCTGCTGAGTCCGCAGCAGG TATCTGTTGCTGCTGCTGCT GGTCTTTCCACAACCCACAG CTGAGGCAAGGATTGGAGTC TGTGCCGTTGTGGTAGGTAA GAATCTGGAAGACACCCTGG GGCGAAACTGAAAGGCAGTA ATCAGCAGCTCCTCATCTGG CTCCCCTGGTTTGTCACAGT GTTCCCATCACAAGGTCCAG GTAGTCCTGGTGCAGGCTCT ATCACCAGGATTGGACATGG
Statistics Statistical analysis was performed with Prism V.5.0 (GraphPad Software). All values were represented as the mean±SEM. Samples were analysed using a student t test. Differences were considered statistically significant at p
