3220

Tatsuya Shishido et al.

DOI: 10.1002/eji.201444475

Eur. J. Immunol. 2014. 44: 3220–3231

EpsinR, a target for pyrenocine B, role in endogenous MHC-II-restricted antigen presentation Tatsuya Shishido1 , Masami Hachisuka1 , Kai Ryuzaki1 , Yuko Miura1 , Atsushi Tanabe1 , Yasuaki Tamura2 , Tomoe Kusayanagi3 , Toshifumi Takeuchi3 , Shinji Kamisuki3 , Fumio Sugawara3 and Hiroeki Sahara1 1

Laboratory of Biology, Azabu University School of Veterinary Medicine, Sagamihara, Japan Department of Pathology, Sapporo Medical University School of Medicine, Sapporo, Japan 3 Genome and Drug Research Center, Tokyo University of Science, Chiba, Japan 2

While the presentation mechanism of antigenic peptides derived from exogenous proteins by MHC class II molecules is well understood, relatively little is known about the presentation mechanism of endogenous MHC class II-restricted antigens. We therefore screened a chemical library of 200 compounds derived from natural products to identify inhibitors of the presentation of endogenous MHC class II-restricted antigens. We found that pyrenocine B, a compound derived from the fungus Pyrenochaeta terrestris, inhibits presentation of endogenous MHC class II-restricted minor histocompatibility antigen IL-4 inducible gene 1 (IL4I1) by primary dendritic cells (DCs). Phage display screening and surface plasmon resonance (SPR) analysis were used to investigate the mechanism of suppressive action by pyrenocine B. EpsinR, a target molecule for pyrenocine B, mediates endosomal trafficking through binding of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs). Lentiviral-mediated short hairpin (sh) RNA downregulation of EpsinR expression in DCs resulted in a decrease in the responsiveness of CD4+ T cells. Our data thus suggest that EpsinR plays a role in antigen presentation, which provides insight into the mechanism of presentation pathway of endogenous MHC class II-restricted antigen.

Keywords: Antigen presentation · Epsin R · MHC class II · Pyrenocine B · SNARE



Additional supporting information may be found in the online version of this article at the publisher’s web-site

Introduction Expression of major histocompatibility complex (MHC) class II molecules is restricted to professional antigen-presenting cells (APCs), such as B cells, macrophages, and dendritic cells (DCs), and is essential for peptide presentation to CD4+ T cells. Antigenstimulated CD4+ T cells assist the effector functions of both CD8+

Correspondence: Prof. Hiroeki Sahara e-mail: [email protected]  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

T cells and B cells. The mechanism underlying the presentation of antigenic peptides derived from exogenous proteins by MHC class II molecules is relatively well understood [1]. Several biochemical studies have revealed that a large fraction of naturally processed peptides presented by MHC II molecules are derived from endogenous cytoplasmic and nuclear proteins [2–6]. Two different pathways have been implicated in the processing of these antigens, with one pathway involving the cytoplasmic proteasome [7–9] and another involving autophagy [5, 10–12]. As an example of a proteasome-dependent pathway, the presentation by HLA-DR4 of the endogenous protein glutamate decarboxylase, a www.eji-journal.eu

Eur. J. Immunol. 2014. 44: 3220–3231

self-antigen closely related to insulin-dependent diabetes mellitus, requires proteasomal and calpain activity [7]. Likewise, influenza virus-infected primary DCs present antigenic peptides in the context of MHC class II molecules via a proteasome/TAP pathway [9]. Autophagic pathways are also involved in endogenous MHC class II antigen processing. Schmid et al. reported that constitutive autophagosomes formation occurs in APCs, and they fuse with MHC class II compartments via autophagosome-associated protein LC3/autophagy-related protein 8, which contributes to efficient endogenous MHC class II-restricted antigen presentation [12]. In the present study, we analyzed the mechanism of endogenous MHC class II antigen presentation using a model antigen encoded by a minor histocompatibility locus. We have previously reported that the murine H46 locus on chromosome 7 encoded the interleukin 4-induced gene 1 (IL4I1), and this antigen was endogenously expressed in bone marrow-derived DCs (BMDCs) in the context of MHC class II (I-Ab ) molecules using the IL4I1specific recognized lacZ-inducible CD4+ T-cell hybridoma TH3Z [13]. In addition, it was reported that FKBP51 molecules play an important role for MHC class II-restricted IL4I1 antigen presentation using the same model [14]. In order to better understand the antigen presentation machinery, we used a chemical biology approach that explored the chemical compounds derived from a natural product with inhibitory effects of antigen presentation and identified its target molecules by using phage display screening. In this study, we found that pyrenocine B, which is derived from the fungus Pyrenochaeta terrestris inhibits presentation of endogenous MHC class IIrestricted antigens in BMDCs in vitro. Phage display screening and surface plasmon resonance (SPR) analysis data suggested that the target of pyrenocine B is EpsinR (clint1-a), which is known to play a role in endosomal trafficking by binding soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs). In addition, lentiviral-mediated short hairpin (sh) RNA downregulation of EpsinR expression in DCs resulted in a decrease in the responsiveness of CD4+ T cells. Our data thus suggest that EpsinR has a role in presentation of endogenous MHC class II-restricted antigen, which involves a mechanism relating to SNARE-dependent sorting.

Results Inhibition of endogenous MHC class II-restricted antigen presentation by pyrenocine B To explore a molecule related to the pathway of endogenous MHC class II-restricted antigen presentation using a chemical biology approach, we first examined 200 compounds derived from natural products to identify an inhibitor of MHC class IIrestricted antigen presentation by primary BMDCs. These experiments revealed that pyrenocine B (Fig. 1A), derived from the fungus P. terrestris, inhibits the response of the lacZ-inducible CD4+ T-cell hybridoma TH3Z that recognize the IL4I1antigen  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Antigen processing

Figure 1. Immunosuppressive effects of pyrenocine B. (A) Structure of pyrenocine B. (B) C57BL/6 BMDCs were cultured for 24 h in the presence or absence of pyrenocine B at the indicated concentrations, and cocultured overnight with lacZ inducible T-cell hybrid, TH3Z cells. After cocultivation, TH3Z responses were measured by their lacZ activity, as determined by measurement of absorbance at 595 nm. (C) The cytotoxicity of pyrenocine B was assessed by MTT assay. C57BL/6 BMDCs were cultured in the presence or absence of the pyrenocine B at the indicated concentrations for 24 h (open square), 48 h (gray triangle), and 72 h (open circle). After cultivation, these cells were cultured in the presence of MTT for 3 h, and then prepared to measure the absorbance of cells lysate at a wavelength of 570 nm. (D) TH3Z cells were cultured in the presence or absence of the pyrenocine B at the indicated concentrations for 24 h, and then washed and cocultured overnight with C57BL/6 BMDCs. After cocultivation, TH3Z responses were determined by measurement of absorbance at 595 nm. (B–D) Data are shown as mean ± SD (n = 9 samples) and are from one experiment representative of three independent experiments performed.

(Fig. 1B). To confirm whether these suppressive effects were responsible for cytotoxicity or not, MTT assay was performed. As shown in Figure 1C, the cytotoxicity of pyrenocine B to C57BL/6 BMDCs was not detected in concentrations from 25 to 100 μM for 24, 48, and 72 h, respectively. These results raised the question as to whether pyrenocine B carried over after washing steps could affect T-cell function. To address this question, TH3Z cells were cultured for 24 h in the presence or absence of pyrenocine B, after which they were thoroughly washed and cocultured overnight with untreated endogenous IL4I1-expressing C57BL/6 BMDCs. We found that pyrenocine B at concentrations up to 100 μM had no effect on the response of the TH3Z (Fig. 1D). To investigate whether pyrenocine B affect IL4I1 antigen processing pathway via autophagy or proteasome, we first investigated whether its antigen presentation is inhibited by autophagy inhibitors, such as lysosomal peptidase inhibitors. The TH3Z response to C57BL/6 BMDCs that are treated with inhibitors of lysosomal proteases; chloroquin for inhibiting lysosomal pH, pepstatin A for blocking the aspartic proteases (cathepsin D and E), and leupeptin for inhibiting cysteine/serine proteases (cathepsin B, S, and L) were not observed to be different as compared with www.eji-journal.eu

3221

3222

Tatsuya Shishido et al.

nontreatments (Supporting Information Fig. 1A–C). Moreover, to investigate whether the IL4I1 antigen processing/presentation pathway is dependent on the proteasome/TAP pathway or not, we investigated T-cell responses to RMA-S BMDCs derived from Tap1tm1Arp knockout mice. TH3Z responded to RMA-S BMDCs, suggesting that the processing/presentation pathway of IL4I1 is independent of proteasome/TAP pathway (Supporting Information Fig. 1D). Therefore, these data suggested that pyrenocine B inhibits the antigen processing pathway independent of the proteasome/TAP- and autophagy-dependent pathway.

Pyrenocine B has no effect on the expression of MHC class II molecules and IL4I1 antigens by BMDCs Next, we investigated whether the decrease in antigen presentation caused by pyrenocine B could be due to a decrease in the expression of MHC class II molecules and other related antigenic stimuli. After primary cultivation for 2 days, BMDCs were cultured in the presence or absence of 50 μM pyrenocine B for 24, 48, and 72 h, respectively, after which the expression of MHC class II molecules and various molecules was examined using flow cytometry. The gating strategy for these analyses are shown in Supporting Information Fig. 2. Pyrenocine B had no effect on the expression of MHC class II molecules on the surface of BMDCs (Fig. 2A). Pyrenocine B also had no effect on the expression of CD80 and CD86. Western blotting was utilized to determine whether the observed decrease in TH3Z responses was due to decreased expression of the IL4I1 antigen in BMDCs. We found that the treatment with pyrenocine B in concentration ranging from 1 to 100 μM for 24 h had no effect on Il4i1 expression (Fig. 2B). These data suggested that pyrenocine B had an effect on MHC class II-restricted endogenous antigen processing or presentation, but not expression of MHC class II molecules and IL4I1 antigens, resulting in CD4+ T-cell unresponsiveness.

Pyrenocine B influences subcellular localization of IL4I1 antigen We next examined the influence of pyrenocine B on subcellular localization of IL4I1 in C57BL/6 BMDC by confocal microscopy. We used markers TGN46, EEA-1, and LAMP-1, which are localized in the trans-Golgi network (TGN), early endosome, and lysosomes, respectively [15]. As shown in Figure 3A–C, IL4I1 antigen in C57BL/6 BMDCs colocalized with TGN46 and EEA-1, but not LAMP-1, suggesting that it would localize in the early endosome via TGN. These data were also supported by the Pearson’s R-value between IL4I1 and TGN46 (bar A), EEA-1 (bar B), or LAMP-1 (bar C) (Fig. 3G). When C57BL/6 BMDCs were treated with 50 μM pyrenocine B, the change in colocalization with IL4I1 and TGN46 or EEA-1 were not observed (Fig. 3D and E), as indicated by the Pearson’s R-value, (Fig. 3G). However, the remarkable change of colocalization of IL4I1 antigen and LAMP-1IL4I1 was observed  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Eur. J. Immunol. 2014. 44: 3220–3231

(Fig. 3F), as indicated by the increase in Pearson’s R-value, (bar F in Fig. 3G). These results suggested that pyrenocine B can influence subcellular localization of IL4I1 antigen, which results in inhibition of antigen processing/presentation.

Inhibition of exogenous antigen presentation by pyrenocine B in the context of MHC class II We further investigated the effect of pyrenocine B on exogenous antigen presentation in the context of MHC class II. We first examined the cytotoxicity of pyrenocine B to B6C3F1 BMDCs. As shown in Figure 4A, cytotoxicity was not observed in concentrations from 25 to 100 μM for 24, 48, and 72 h, respectively. Ovalbumin (OVA) and hen egg lysozyme (HEL) were used as model exogenous antigens for presentation to the OVA- and HEL-specific recognized lacZ-inducible CD4+ T-cell hybrids KZO or KZH, respectively. The responses of KZO or KZH to pyrenocine B-treated B6C3F1 BMDCs that had endocytosed OVA or HEL, respectively, were not affected by pyrenocine B (Fig. 4B and C). Thus, these data suggest that the suppressive effect of pyrenocine B is limited to endogenous MHC class II-restricted antigen presentation.

Phage display screening with immobilized pyrenocine B isolated EpsinR To explore pyrenocine B binding proteins, we applied a chemical biology approach. In general, small molecules that are to be used for isolating binding proteins need to be chemically modified (e.g., biotinylated) in order to be immobilized on a solid surface. Therefore, we utilized a photoaffinity coupling method, which we previously developed [16]. The highly reactive carbene induced by UV irradiation reacted with pyrenocine B, resulting in the production of immobilized pyrenocine B on a solid surface in a nonspecific manner. We performed phage display screening with multiple cycles that consist of binding, washing, recovery, and amplification. Through the screening cycles, the ratios of eluted phage particles associated with pyrenocine B-immobilized resins when compared with input were dramatically increased. We isolated up 16 single-phage clones from the sixth panning elution (sixth cycles). After sequence analysis, nine out of the 16 phages clones were identical. The predicted amino acid sequences of the phage clones were determined through a search of the NCBI protein database. The predicted sequence of nine of the clones was nearly identical to residues 459–571 of EpsinR (Q99KN9.2). The Q99KN9.2 gene is predicted to encode a 631-amino acid that contains epsinNH2 -terminal homology domains, which localized within clathrincoated vesicles (CCVs) and thus may be involved in trafficking between the Golgi body and endosomes [17–19]. To confirm the interaction between pyrenocine B and EpsinR, we prepared a recombinant EpsinR and analyzed the interaction using SPR analysis. Specific binding of pyrenocine B and EpsinR was observed, with a binding dissociation constant (Kd) of 2.2 × 10−9 M (Fig. 5). www.eji-journal.eu

Eur. J. Immunol. 2014. 44: 3220–3231

Antigen processing

Figure 2. Characterization of pyrenocine B-treated BMDCs. (A) C57BL/6 BMDCs were cultured for 24, 48, or 72 h in the presence or absence of 50 μM pyrenocine B, respectively, and then stained with FITC-labeled anti-mouse MHC class II, CD80, and CD86. After staining, cells were analyzed on a flow cytometer. The gray peak represents nonstained and nontreated BMDCs with the FITC-labeled antibody as a negative control. Thick line represents nonpyrenocine B-treated BMDCs and dotted lines represent pyrenocine-treated BMDCs for indicated times, respectively. (B) C57BL/6 BMDCs were cultured for 24 h in the presence or absence of pyrenocine B at the indicated concentration, and then harvested and lysed with lysis buffer. Expression of IL4I1 proteins in these cells was detected by western blotting using rat anti-IL4I1 serum. Detection of β-actin expression was used as a loading control. (A and B) Data are from one experiment representative of three independent experiments performed.

Subcellular localization of EpsinR To investigate subcellular localization of EpsinR, we performed a confocal microscopy study. As shown in Figure 6A, IL4I1 anti-

gens in C57BL/6 BMDCs were colocalized with EpsinR, indicating that EpsinR would play a role in trafficking for presentation/processing of IL4I1 antigen. Since it is known that EpsinR associates with t-SNAREs homologue 1B (Vti1b) as an adaptor

Figure 3. Pyrenocine B influences subcellular localization of IL4I1. C57BL/6 BMDCs were cultured for 24 h in the presence or absence of 50 μM pyrenocine B. (A–F) Images of (A–C) nontreated C57BL/6 BMDCs or (D–F) pyrenocine B-treated C57BL/6 BMDCs costained with anti-IL4I1 serum (green; left panels), and (A and D) anti-TGN46 Ab (red) for trans-Golgi network detection, (B and E) anti-EEA1 Ab (red) for early endosome detection, and (C and F) anti-LAMP1 Ab (red) for lysosome detection (middle panels). The optically merged image (right panels) is representative of most cells examined (n = 100 cells) by laser confocal microscopy. Original magnification: × 1000. Scale bars = 5 μm. (G) Colocalization analysis of images obtained by laser confocal microscopy was evaluated by Pearson’s correlation coefficients. Each bar corresponds to each merge image (A–F). (A–G) Data are from one experiment representative of three independent experiments performed.

 C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

www.eji-journal.eu

3223

3224

Tatsuya Shishido et al.

Eur. J. Immunol. 2014. 44: 3220–3231

Figure 4. No effect of pyrenocine B on MHC class II-restricted presentation of exogenous antigen. (A) B6C3F1 BMDCs were cultured in the presence or absence of pyrenocine B at the indicated concentrations for 24 h (open square), 48 h (gray triangle), and 72 h (open circle). After cultivation, these cells were cultured in the presence of MTT for 3 h, and then prepared to measure the absorbance of cells lysate at a wavelength of 570 nm. (B and C) B6C3F1 BMDCs were cultured in the presence (closed symbols) or absence (open symbols) of 50 μM pyrenocine B for 24 h, and then used as an antigen presenting cells (APCs). (B) OVA and (C) HEL protein at the indicated concentrations were added to these APCs and cocultured overnight with lacZ-inducible T-cell hybrid, (B) KZO or (C) KZH. After cocultivation, lacZ-inducible T-cell hybrid responses were measured as their lacZ activity, as determined by measurement of absorbance at 595 nm. (A–C) Data are shown as mean ± SD (n = nine samples) and are from one experiment representative of three independent experiments performed.

E in Fig. 6G). EpsinR did not colocalized with Vti1b in the presence of pyrenocine B, as indicated by the decrease of Pearson’s R-value, (bar F in Fig. 6G). These data suggested that pyrenocine B could inhibit the association of EpsinR and Vti1b, which might result in change of the destination of lysosomes containing Vti1b-cargo including IL4I1 antigen as shown in Figure 3F. We further investigated whether MHC class II molecules were colocalized with EpsinR or Vti1b. Colocalization with MHC class II and these molecules was not observed (Fig. 7A and B), as indicated by the low Pearson’s R-value (Fig. 7C). These data suggested that MHC class II molecules might be transported to MHC class II compartments (MIIC) by a cargo unlike Vti1b- or EpsinR-cargo. Figure 5. Measurement of association of pyrenocine B with EpsinR by surface plasmon resonance (SPR) analysis. SPR analysis was performed with a Biacore 3000 system. (A) EpsinR cDNA from C57BL/6 BMDCs was  R cloned and inserted into pCold TF DNA vector. This plasmid was introduced with E.coli strain BL21 (DE3), and recombinant EpsinR with (His)6 -TF tag was purified. The association between pyrenocine B-biotin (ligand immobilized on the sensor surface), and recombinant (His)6 -TFEpsinR as an analyte was analyzed. A specific binding responses with pyrenocine B and EpsinR ((His)6 -TF-epsinR) were observed and the binding dissociation constant (Kd) was 2.2 × 10−9 M. (B) Recombinant (His)6 TF that is tag-derived from empty pCold vector was also generated as an analyte control. The association of pyrenocine B and TF tag was investigated as a negative control. (A and B) Data are from one experiment representative of three independent experiments performed.

forming a CCV [15, 20, 21], we investigated whether IL4I1 also colocalized with Vti1b. Consequently, IL4I1 colocalized with Vti1b (Fig. 6B), and the colocalization between EpsinR and Vti1b in BMDCs was observed (Fig. 6C). These data were also supported by the high Pearson’s R-value (bar A–C in Fig. 6G). We next examined the influence of pyrenocine B on subcellular localization of these molecules. When C57BL/6 BMDCs were treated with 50 μM pyrenocine B, a marked delocalization of IL4I1 and EpsinR was observed (Fig. 6D), as indicated by the decrease of Pearson’s R-value, (bar D in Fig. 6G). On the other hand, the colocalization with IL4I1 and Vti1b was not changed (Fig. 6E), and no change of Pearson’s R-value corresponding to it was observed (bar  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

EpsinR plays a role in MHC class II-restricted antigen presentation Lentivirus each packed with four short hairpin RNAs (shRNA) specific for the EpsinR gene (Esh1, 2, 3, and 4) were individually introduced into BMDCs to determine the RNA sequence that effectively downregulates the gene. When Esh4 shRNA was introduced into cells, the endogenous EpsinR expression reduced approximately 50% compared to sh-control treated with a shRNA for a nontarget gene. Among the shRNAs tested, Esh4 was the most effective at inducing downregulation of EpsinR expression (Fig. 8A). As shown in Figure 8B, TH3Z response to Esh4-shRNAtreated BMDCs (EpsinR-KD BMDCs) significantly decreased compared to the control. The ability to present pulsed-antigenic peptide on EpsinR-KD C57BL/6 BMDCs was investigated using HAV14 peptide with an IL4I1-derived TH3Z epitope. No difference in presentation capability as compared with control was observed, suggesting that the ability of exogenous antigen presentation of MHC class II molecules could not be influenced by EpsinR (Fig. 8C). Next, B6C3F1 BMDCs were introduced with Esh4 shRNA, and used as APCs to confirm this finding in an I-Ak restricted antigen model unlike I-Ab . Exogenous OVA-antigen presentation was not be influenced by EpsinR (Fig. 8D). These www.eji-journal.eu

Eur. J. Immunol. 2014. 44: 3220–3231

Antigen processing

Figure 6. Subcellular localization of EpsinR. C57BL/6 BMDCs were cultured for 24 h in the presence or absence of 50 μM pyrenocine B. (A–C) Nontreated or (D–F) pyrenocine B-treated C57BL/6 BMDCs costained with anti-IL4I1 serum or anti-EpsinR Ab (green; left panels), and anti-EpsinR Ab or anti-Vti1b Ab (red; middle panels). The optically merged image (right panels) is representative of most cells examined by laser confocal microscopy. Original magnification: × 1000. Scale bars = 5 μm. (G) Colocalization analysis of image obtained by laser confocal microscopy was evaluated by Pearson’s correlation coefficients. Each bar corresponds to each merge image (A–F). (A–G) Data are from one experiment representative of three independent experiments performed.

data suggest that EpsinR plays an important role in endogenous MHC class II-restricted antigen presentation. To investigate subcellular localization of IL4I1 antigen in EpsinR-KD BMDCs, we performed a confocal microscopy study. As shown in Figure 9A and B, a decrease in expression of EpsinR molecules in EpsinR-KD C57BL/6 BMDCs was observed as compared with nontarget, as indicated by the decrease of Pearson’s R-value, (bar A and D in Fig. 9I). However, no change in colocalizations with IL4I1 antigen and TGN-46 or EEA-1 was observed in EpsinR-KD BMDCs (Fig. 8F and G) as compared with nontarget (Fig. 9B and C), as indicated by Pearson’s R-value, (Fig. 9I). However, a marked change in colocalization of IL4I1 antigen and LAMP-1 was observed (Fig. 9D and H), as indicated by the increase of Pearson’s R-value, (bar D and H in Fig. 9I). Thus, these results suggested that EpsinR could play an important role in subcellular localization of IL4I1 antigen, suggesting that trafficking of IL4I1 from TGN/endosome to lysosome is inhibited by association with EpsinR and Vti1b.

Discussion Pyrenocines are phytotoxins produced by the fungus P. terrestris, which exert general antibiotic activity against plants, fungi, and bacteria. Although three pyrenocine derivatives have been identified (pyrenocine A, B, and C), only pyrenocine A demon-

 C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

strates strong cytotoxic activity, while pyrenocine B and C display minimal bioactivity [22]. In fact, we found that concentrations of pyrenocine B over 100 μM had no effect on BMDCs viability. Thus, it was suggested that the downregulation of TH3Z responses observed in the present study were due to pyrenocine B-mediated suppression of the function of EpsinR rather than cytotoxicity. EpsinR is a CCV associated protein that interacts with adaptor protein 1 (AP-1) and possesses an epsin-NH2 -terminal homology domain that binds to phosphatidylinositol phosphate (PtdInsP) [17–19]. EpsinR is also found in CCVs budding from TGN [23], which is considered to play a role in transport by binding to PI(4,5)P2 [22]. PostGolgi vesicular transport including the complex of MHC class II with invariant chain (Ii) is mediated primarily by CCVs, and is thought to involve other integral membrane proteins such as SNAREs, which mediate bilayer fusion [24, 25]. For example, during homotypic fusions of late endosome or heterotypic fusion with lysosomes, a combination trans (t)-SNAREs, consisting of Q-SNAREs syntaxin 7, syntaxin 8, and vesicle transport through interaction with t-SNAREs homologue 1B (Vti1b), interacts with vesicle (v)-SNAREs consisting of the R-SNARE vesicle-associated membrane protein (VAMP) 8 or VAMP7, respectively [26]. Also, trimeric SNAREs consisting of VAMP7, VAMP8, and Vti1b mediate the fusion of autophagosomes and lysosomes [27]. The function of the precursor homotypic fusion protein autophagy-related proteins 16 L1 is dependent upon interaction with SNARE protein VANP7

www.eji-journal.eu

3225

3226

Tatsuya Shishido et al.

Figure 7. Subcellular localization of MHC class II and EpsinR or Vti1b. (A and B) C57BL/6 BMDCs costained with anti-MHC class II Ab (green, left panels), and (A) anti-EpsinR Ab or (B) anti-Vti1b Ab (red) (middle panels). The optically merged images (right panels) are representative of most cells examined by laser confocal microscopy. Original magnification: × 1000. Scale bars = 5 μm. (C) Colocalization analysis of image obtained by laser confocal microscopy was evaluated by Pearson’s correlation coefficients. Each bar (MHC-EpsinR and –Vti1b) corresponds to each merge image (A and B). (A–C) Data are from one experiment representative of three independent experiments performed.

and partner SNAREs, and is critical in the early phases of autophagy [20]. Thus, CCV-dependent protein transport post-TGN plays a critical role in SNAREs, such as targeting vesicle. Recently, it was reported that EpsinR associates with SNARE protein Vti1b, suggesting that EpsinR may be a Vti1b-selective adaptor [15, 28, 29]. Since pyrenocine B inhibits IL4I1 antigen presentation on MHC class II, it may interfere with EpsinR function. These data raise the possibility of nascent IL4I1 antigen transport to CCVs budding from the TGN and subsequent transport or fusion to target vesicles bearing the SNARE protein Vti1b. Although nascent MHC class II molecules are also considered to be transported and presented on the cell surface by these pathways, in the present study, we found no evidence that expression of MHC class II molecules was affected by pyrenocine B, suggesting that the vesicles that transport the IL4I1 antigen and MHC class II/Ii complexes are different. As shown in Figure 3 and 7, IL4I1 antigen cargo would transport to the early endosome from the TGN, and then would be fused with MHC II-loading compartments through an unknown processing mechanism. EpsinR could play an important role for this trafficking, because blockade of EpsinR by pyrenocine B treatment or EpsinR RNA silencing significantly changed the fate of IL4I1-antigen presentation by traffick C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Eur. J. Immunol. 2014. 44: 3220–3231

ing error in Vti1b recognition. However, in this study, it remains unclear why IL4I1 cargo was transported to lysosome from TGN by pyrenocine B treatment or EpsinR RNA silencing. Miller et al., reported that disrupting the EpsinR-Vti1b interaction increased the accumulation of Vti1b in LAMP-1-positive late endosomes and lysosomes, which indicates that EpsinR normally facilitates retrograde transport of Vti1b from a relatively late endosomal compartment back to an earlier compartment and/or the TGN [15]. This report has provided evidence to support our results. The question as to what type of SNARE is found on vesicles that transport IL4I1 remains to be answered, as does the question of what determines the selection of IL4I1 for incorporation into a different type of vesicle than transporting MHC class II/Ii complexes. Despite these unanswered questions, our results provide insight into the importance of selective antigen transport by selective SNARE-mediated fusion of vesicles in the processing pathway of endogenous MHC class II-restricted antigens. In conclusion, using a chemical biology approach, we found that EpsinR is involved in sorting of endogenous antigens for presentation on MHC class II. These findings not only shed light on the mechanism of antigen presentation, they also illustrate the value of a chemical biology approach in efforts to elucidate the biological mechanisms of small-molecule and protein interactions.

Materials and methods Mice and cells Inbred mice, C57BL/6J and B6C3F1 mice (C57BL/6N Crj × C3H/HeN Crj) were obtained from Japan Charles River Co. All procedures were performed in compliance with the guidelines of the Animal Research Committee of Azabu University. Bone marrow cells obtained from the thigh bones of mice and were cultured with RPMI 1640 (Sigma-Aldrich, MO, USA) supplemented with 10% fetal bovine serum, 10 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF) (Life Technologies Co., CA, USA), 2 mM glutamine, 50 μM 2-mercaptoethanol, 200 U/mL penicillin, and 200 μg/mL streptomycin. After 5 days, the characteristic immature DCs in CD11c+ , CD86− , and I-Ab /Ak low cultures accounted for more than 65% of the cells in flow cytometric analysis and were designated bone marrow-derived DCs (BMDCs) and used as antigen presenting cells (APCs). The IL4I1-specific lacZ inducible CD4+ T-cell hybrid TH3Z (B6 mousederived-IL4I1567–580/I-Ab -specific) was generated as described [22]. The lacZ inducible CD4+ T-cell hybrid KZO (ovalbumin (OVA) 247–265/Ak specific) and KZH (HEL 34–45/ Ak specific) were used to investigate effect of pyrenocine B on exogenous antigen presentation as described elsewhere [14, 30].

Treatment of DCs with pyrenocine B and T-cell activation assays After 2 or 3 days of primary culture, BMDCs of C57BL/6 or B6C3F1 were subsequently cultured for 24 h in the presence or absence of www.eji-journal.eu

Eur. J. Immunol. 2014. 44: 3220–3231

Antigen processing

Figure 8. The role of EpsinR in MHC class II-restricted antigen presentation. Lentivirus packed with four shRNA specific for the EpsinR gene (Esh1, 2, 3, and 4) and nontargeting sh-RNA were individually introduced into C57BL/6 BMDCs, and cultured for 72 h. (A) EpsinR mRNAs derived from C57BL/6 BMDCs measured by quantitative real-time RT-PCR. Results (% nontargeting shRNA) represent as a mean ± SD of triplicate wells. (B) Lentivirus packed sh-RNA introduced C57BL/6 BMDCs were cocultured overnight with TH3Z. TH3Z responses represent measurement of absorbance at 595 nm. Results are compared with the Student’s t-test, *p < 0.05, **p < 0.01. (C) EpsinR-KD (closed symbols) or nontarget (open symbols) C57BL/6 BMDCs were used as APCs. C57BL/6 mice-derived TH3Z epitope peptide HAFVEAIPELQGHV (HAV14) at the indicated concentration were added to APCs and cocultured overnight with TH3Z. (D) EpsinRKD (closed symbols) or nontarget (open symbols) B6C3F1 BMDCs were used as APCs. OVA at the indicated concentrations were added to APCs and cocultured overnight with KZO cells. T-cell responses (mean ± SD) represent measurement of absorbance at 595 nm. (A–D) Data are shown as mean ± SD (n = nine samples) and are from one experiment representative of three independent experiments performed.

pyrenocine B suspended in PBS. In some experiments, TH3Z cells were cultured for 24 h in the presence or absence of pyrenocine B. After 24 h, BMDCs and T-cell hybrids were thoroughly washed with cultured medium three times, and cocultured overnight with lacZ inducible T-cell hybrids and APCs, respectively. In an assessment of exogenous antigen presentation, B6C3F1 BMDCs were cultured overnight with OVA and HEL protein at indicated concentrations in the presence or absence 50 μM pyrenocine B. CD4+ T-cell hybridoma were cocultured overnight with these BMDCs and their responses were examined. The results showed that the lacZ activity measured as the absorbance at 595 nm (with 635 nm as the reference wavelength) of the chromogenic product released after the cleavage of the substrate chlorophenol red β-pyranoside [13]. Results are represented as mean ± SD of triplicate wells for one of three independent experiments.

added to each well and mixed using a pipette to disrupt the cells. The absorbance of the contents in each well was measured using  R a multiwell scanning photometer (iMark , Bio-Rad Laboratories, CA, USA) at a wavelength of 570 nm. Results are represented as mean ± SD of triplicate wells for one of three independent experiments.

MTT assay

Western blotting

To investigate cell growth or cytotoxicity, the MTT (3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was performed according to the methods described previously [31]. Briefly, cells (5 × 103 cells per well) were cultured in 96-well plates for 24 h, the various amounts of pyrenocine B suspended in PBS were added to the wells, and then cultured. After cultivation for 24, 48, or 72 h, 50 μg of MTT was added to the cells and incubation was continued for 3 h. Next 4% HCl in 2-propanol was

Anti-IL4I1 polyclonal antibody serum was generated in rats immunized with Fc chimera proteins that were prepared by fusing C-terminal IL4I1 fragment (amino acid residues 215–630) with the Fc region of human IgG as described [32]. In brief, truncated IL4I1 (IL4I1644–1890 ) cDNA from C57BL/6 mice were cloned and inserted into the XhoI cloning site of a modified pME18S expression vector that contained a mouse CD150 leader segment and the Fc segment of human IgG1 , which was kindly provided by

 C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Flow cytometric analysis FITC-labeled anti-mouse MHC class II (I-Ab ), CD80, and CD86 mAbs were purchased from BD Pharmingen (CA, USA). Cells were stained with these primary mAbs for 30 min on ice and washed with PBS and resuspended in PBS containing 1% paraformaldehyde. After staining, cells were analyzed on a flow cytometer (EC800, Sony iCyt, Tokyo, Japan).

www.eji-journal.eu

3227

3228

Tatsuya Shishido et al.

Eur. J. Immunol. 2014. 44: 3220–3231

Figure 9. EpsinR influences subcellular localization of IL4I1. (A–H) Images of (A–D) nontarget shRNA or (E–H) Esh4 introduced into C57BL/6 BMDCs costained with anti-IL4I1 serum (green), and (A and E) anti-EpsinR Ab (red), (B and F) anti-TGN46 Ab (red) for trans-Golgi network detection, (C and G) anti-EEA1 Ab (red) for early endosome detection, and (D and H) anti-LAMP1 Ab (red) for lysosome detection. The optically merged image is representative of most cells examined by laser confocal microscopy. Original magnification: × 1000. Scale bars = 5 μm. (I) Colocalization analysis of image obtained by laser confocal microscopy was evaluated by Pearson’s correlation coefficients. Each bar corresponds to each merge image (A–H). All results in this figure are from one experiment representative of three independent experiments performed.

Dr. Hisashi Arase of Osaka University, Japan. COS cells were transfected with truncated IL4I1-Fc chimera cDNA vector and then conditioned medium including IL4I1-IgG chimera protein was harvested 4 days after transfection. IL4I1-Fc protein in this supernatant was purified by Protein A (Life Technology Co.). Wistar rats (Japan SLC, Hamamatsu, Japan) were immunized with mouse IL4I1-Fc protein using TiterMax Gold adjuvant (Bio Scientific Pty., Ltd. Sydney Australia). After immunization, serum was harvested and used for some studies. Mouse β-actin antibody was purchased from Sigma-Aldrich (MO, USA). Cells were lysed in lysis-buffer (50 mM Tris-HCl [pH = 8], 150 mM NaCl, 0.1% NP40, and protease inhibitor cocktail [Roche Applied Science, Mnnheim, Germany]). Then samples were loaded on 10 or 12% SDS-PAGE and transferred to a Hybond-ECL nitrocellulose membrane (Amersham Bioscience Crop. NJ, USA). The transferred antigens on the membrane were detected with anti-IL4I1 serum by western blotting.

Indirect immunofluorescence analysis  R

Anti-EpsinR (abcom Cambridge, UK), anti-mouse EEA-1 (Sant  R Cruz Biotechnology Inc. CA, USA), TGN-46 (abcom ), Vti1b  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

 R

(Sigma-Aldrich), and LAMP-1 (abcom ) were purchased. Cells were fixed with ice-cold acetone for 3 min and then stained with anti-IL4I1 serum and anticellular organelle markers Abs followed by Alexa Fluor 488-conjugated goat anti-rat IgG and 594conjugated goat anti-rabbit IgG (Life Technologies Co.), respectively, and visualized using Leica TCS SP5 II laser confocal scanning microscopy system (Leica Microsystems, Wetzlar, Germany). Statistical analysis of confocal images was evaluated by Pearson correlation coefficient, which was performed by using FIJI software (ImageJA 1.45j; Max Planck Society).

Phage display screening Unless stated otherwise, all manipulations were performed at room temperature according to our protocol described previously [33]. Briefly, a 10 μM of biotinylated pyrenocine B solution was added to a streptavidin-coated 96-well microplate (Thermo fisher scientific, Waltham, MA) and allowed 1 h for immobilization. Unbound compound was then removed by washing three times with TBS (25 mM Tris-HCl, 137 mM NaCl, 2.7 mM KCl, pH 7.4). An aliquot of the T7 phage library (1.5 × 1010 pfu) constructed www.eji-journal.eu

Eur. J. Immunol. 2014. 44: 3220–3231

from cDNA of C57BL/6 BMDCs was added to each well and incubated for 1 h. After incubation, unbound phage particles were removed by washing 10 times with TBST (TBS, 1% Tween 20). An elution buffer (TBS, 1% SDS) was then added and incubated for 15 min to recover the bound phage particles. In order to amplify the recovered phage particles, each elute was mixed with a culture of Escherichia coli BLT5615 (Merck, Darmstadt, Germany). The cells were cultured at 37°C until cell lysis was observed. The resulting solution was used for the next round of biopanning. After six rounds of selection, the elute was mixed with 1 mL of E. coli BLT5615 culture and 10 mL of warmed top agarose. The mixture was then poured evenly across the surface of an LB agar plate supplemented with 50 μg/mL carbenicillin. Once the overlay had solidified, the plate was incubated at 37°C for 3 h in order to allow the formation of phage plaque. A total of 16 plaques were randomly picked and each plaque was suspended in phage extraction buffer (20 mM Tris-HCl, 100 mM NaCl, 6 mM MgSO4 , pH 8.0). The DNA sequence of each phage clone was then analyzed as described in a previous report [33].

EpsinR-knockdown BMDCs by shRNA and assessment of antigen presentation activity We applied four sh-RNA technology platforms (Sigma  R MissionRNAi , Sigma-Aldrich) to knockdown EpsinR gene expression in BMDCs according to our protocol described previously [31]. Briefly, these sequences were as follows: Esh1; 5 -CCGGGGCAAGGATCAAGGTATAAACCTCGAGGTTTATACCTT GATCCTTGCCTTTTTG-3 , Esh2; 5 -CCGGACGGTGACGACGAAGC ATATCCTCGAGGATATGCTTCGTCGTCACCGTTTTTTG-3 , Esh3; 5 -CCGGCCAATAGAAGTTCGATATATACTCGAGTATATATCGAA CTTCTATTGGTTTTTG-3 , Esh4; 5 -CCGGCCCAGCAGCCATC GCTTAATACTCGAGTATTAAGCGATGGCTGCTGGGTTTTTG-3 , which were cloned into pLKO.1-puro shRNA vector. A nontargeting shRNA (Sigma-Aldrich) was used as control (sh-control). Plasmid DNAs including nontargeting shRNA were transfected into BMDCs along with Lentiviral Packaging Mix consisting of an envelope and packaging vector (Sigma-Aldrich) to produce lentivirus packed with shRNA cassettes using the standard procedure. DC infection was performed as described before [21]. Briefly, C57BL/6 or B6C3F1 BMDCs were plated on a 96-well plate (round bottom) at a concentration of 5 × 104 cells per well with 100 μL BMDC-medium. After 48 h, these BMDCs were added to virus supernatant including 20 MOI and 4 μg/mL of polybrene, and then the plate was centrifuged at 2 000 rpm for 2 h. The medium was replaced by 200 μL/well of fresh BMDCs-medium at 6 h after centrifugation. The plates were incubated for 24 h and the cells were selected with 1 μg/mL of puromycin. Cells were collected for analysis 48 h after selection and were used for some studies. In some experiments, Esh4-introduced or nontargeting shRNA-introduced C57BL/6 BMDCs (EpsinR-KD or nontarget C57BL/6 BMDCs) were cocultured with TH3Z in the present C57BL/6 mice-derived TH3Z epitope peptide HAFVEAIPELQGHV  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Antigen processing

(HAV14) at the indicated concentration, respectively [13]. Also Esh4-introduced or nontargeting shRNA-introduced B6C3F1 (EpsinR-KD or nontarget B6C3F1 BMDCs) was cocultured with KZO in the presence of OVA protein at the indicated concentration. After overnight culture, the lacZ activity measured as the absorbance at 595 nm (with 635 nm as the reference wavelength) of the chromogenic product released after cleavage of the substrate chlorophenol red β-pyranoside [13]. Results are represented as a mean ± SD of triplicate wells for one of three independent experiments.

Quantitative real time PCR analysis The quantitative measurement of gene expression was performed  R using the LightCycler system (Roche Applied Science) according to our protocol described previously [31]. Quantitative real-time RT-PCR analyses of mouse glucose-6-phosphate dehydrogenase (G6PDH) and EpsinR gene expression were performed using the  R LightCycler FastStart DNA MasterPLUS SYBR Green I system (Roche Applied Science) with the following primer sets: forward primer, 5 -GCACAAGATTGATCGAGA-3 and reverse primer, 5 GAGGCAGAGTATAGATGGTGTA-3 for the detection of mouse G6PDH; forward primer, 5 -ACAGAATATGCAACAGCCTC-3 and reverse primer, 5 - ACATCCCCATGTTCATGTTC-3 for the detection of mouse EpsinR. PCR amplification of the housekeeping gene, G6PDH, was performed for each sample as a control for sample loading and to allow for normalization among the samples. To determine the absolute copy number of the target transcripts, the fragments of G6PDH or the target genes amplified by PCR using the above described primer sets were  R  R subcloned into the pCR4 -TOPO - cloning vector (Life Technologies Co.). The concentrations of these purified plasmids were measured by absorbance at 260 nm and copy numbers were calculated from the concentration of the samples. A standard curve was created by plotting the threshold cycle (Ct) versus the known copy number for each plasmid template in the dilutions. The copy numbers for all unknown samples were determined according to the standard curve using LightCycler version 3.5.3 (Roche Applied Science). To correct for differences in both RNA quality and quantity between samples, each target gene was first normalized by dividing the copy number of the target by the copy number of G6PDH; therefore, the mRNA copy number of the target was the copy number per the copy number of G6PDH. The initial value was also corrected for the amount of G6PDH indicated as 100% to evaluate the sequential alteration of the mRNA expression level.

Preparation of recombinant protein  R

BMDCs-derived total RNAs were prepared using an RNeasy Mini Kit (QIAGEN Inc., Hilden, Germany) according to the manufacturer’s instructions and then reverse-transcribed to cDNA with a Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science). EpsinR cDNA from BMDCs was cloned by www.eji-journal.eu

3229

3230

Tatsuya Shishido et al.

Eur. J. Immunol. 2014. 44: 3220–3231

 R

polymerase chain reaction (PCR) system. To insert into pCold TF DNA vector (Life Technologies Co.), PCR amplifications were performed according to GoTaq Flexi DNA Polymerase system (Promega, Co. WI, USA) using primer set; forward primer, 5 - AATAAGGATCCATGCTGAACATGTGGAAGGT-3 , which was added to AATAAGGATCC including BamHI-recognition oligonucleotide at upstream of start site of open reading frame, and reverse primer, 5 - CTTGGCTGCAGTTTGCTAAAGTTGGCAAAG3 , which was added to CTGCAGCCAAG including PstI-recognition oligonucleotide at 3 end. After amplification, PCR product was digested with BamHI/PstI, and then ligased into pCold vector at BamHI/PstI site. This plasmid was introduced with E. coli strain BL21 (DE3) (Life Technologies Co.), and these transformants were incubated at 37°C when an OD600 reached 0.5. These transformants were further cultured for induction with 1 mM isopropyl β-D-thiogalactopyranoside for overnight at 15°C. Recombinant EpsinR was purified by nickel column chromatography with ProBondTM Resin (Life Technologies Co.) according to the manufacturer’s procedure and designated (His)6 -TF-EpsinR. Recombinant (His)6 -TF that is tag derived from empty pCold vector was also generated and purified as a negative control of (SPR study).

Acknowledgments: This research was supported by a research project grant awarded by the Azabu University. We thank Dr. Nilabh Shastri for the generous gift of T-cell hybridoma and are grateful to Dr. Hisashi Arase for providing us invaluable tools for our study.

Conflict of interest: The authors declare no financial or commercial conflict of interest.

References 1 Trombetta, E. S. and Mellman, I., Cell biology of antigen processing in vitro and in vivo. Annu. Rev. Immunol. 2005. 23: 975–1028. 2 Weiss, S. and Bogen, B., MHC class II-restricted presentation of intracellular antigen. Cell 1991. 64: 767–776. 3 Rudensky, A. Y., Preston-Hurlburt, P., Hong, S. C., Barlow, A., and Janeway, C. A., Sequence analysis of peptides bound to MHC class II molecules. Nature 1991. 353: 622–627. 4 Dongre, A. R., Kovats, S., deRoos, P., McCormack, A. L., Nakagawa, T., Paharkova-Vatchkova, V., Eng, J. et al., In vivo MHC class II presentation

SPR analysis using the Biacore system

of cytosolic proteins revealed by rapid automated tandem mass spectrometry and functional analyses. 2001. Eur. J. Immunol. 31: 1485–1494. 5 Dengjel, J., Schoor, O., Fischer, R., Reich, M., Kraus, M., Muller, ¨ M., Kreym-

SPR experiments were performed with a Biacore 3000 system (GE Healthcare UK Ltd., Buckinghamshire, England) according to our protocol described previously [33]. With this system, the molecule of interest (ligand) is immobilized on a sensor surface and the binding partner (analyte) can then be passed over it in a mobile aqueous phase. Their interaction on the sensor surface can subsequently be monitored in real time without the use of labels. To investigate pyrenocine B-EpsinR interaction, we employed pyrenocine B-biotin as a ligand that was immobilized on the sensor surface, and the (His)6 -TFEpsinR as an analyte. Pyrenocine B-biotin was immobilized through avidin–biotin interaction, according to the instruction manual for the Biacore 3000. Briefly, the carboxymethylated dextran matrix preimmobilized with streptavidin on the gold surface (sensor chip SA, GE Healthcare UK Ltd.) was conditioned with three consecutive 1 min injections of 1M NaCl in 50 mM NaOH. Subsequently, 10 μL of 5 μM pyrenocine B-biotin in PBS (67 mM Na2 HPO4 , 12.5 mM KH2 PO4 , 70 mM NaCl, 1 mM DTT, pH 7.4) was injected for 1 min. Finally, the chip surface was washed with PBS to remove any loosely bound ligands. The amount of immobilized pyrenocine B-biotin as a ligand was 200–300 RU on the sensor surface area. For a control, we immobilized biotin 800–850 RU. To estimate affinity interaction between pyrenocine B-biotin and (His)6 -TF-EpsinR, the dissociation constant (KD ) was determined from sensorgram curves of different analyte concentration by BIA evalution version 4.1 software (GE Healthcare UK Ltd.). Furthermore, we used TF for a control of analyte.  C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

borg, K. et al., Autophagy promotes MHC class II presentation of peptides from intracellular source proteins. Proc. Natl. Acad. Sci. USA 2005. 102: 7922–7927. 6 Costantino, C. M., Spooner, E., Ploegh, H.L., and Hafler, D.A., Class II MHC self-antigen presentation in human B and T lymphocytes. PLoS One 2012. 7: e29805. 7 Lich, J., Elliott, J. F. and Blum, J. S., Cytoplasmic processing is a prerequisite for presentation of an endogenous antigen by major histocompatibility complex class II proteins. J. Exp. Med. 2000. 191: 1513–1524. 8 Malnati, M. S., Marti, M., LaVaute, T., Jaraquemada, D., Biddison, W., DeMars, R. and Long, E. O., Processing pathways for presentation of cytosolic antigen to MHC class II-restricted T cells. Nature 1992. 357: 702– 704. 9 Tewari, M. K., Sinnathamby, G., Rajagopal, D. and Eisenlohr, L. C., A cytosolic pathway for MHC class II-restricted antigen processing that is proteasome and TAP dependent. Nat. Immunol. 2005. 6: 287–294. 10 Dorfel, ¨ D., Appel, S., Grunebach, ¨ F., Weck, M. M., Muller, ¨ M. R., Heine, A. and Brossart, P., Processing and presentation of HLA class I and II epitopes by dendritic cells after transfection with in vitro-transcribed MUC1 RNA. Blood 2005. 105: 3199–3205. 11 Zhou, D., Li, P., Lin, Y., Lott, J. M., Hislop, A. D., Canaday, D. H., Brutkiewicz, R. R. et al., Lamp-2a facilitates MHC class II presentation of cytoplasmic antigens. Immunity 2005. 22: 571–581. 12 Schmid, D., Pypaert, M. and Munz, ¨ C, Antigen-loading compartments for major histocompatibility complex class II molecules continuously receive input from autophagosomes. Immunity 2007. 26: 79– 92. 13 Sahara, H. and Shastri, N., Second class minor: Molecular identification of the autosomal H46 histocompatibility locus as a peptide presented by

www.eji-journal.eu

Eur. J. Immunol. 2014. 44: 3220–3231

major histocompatibility complex class II molecules. J. Exp. Med. 2003. 197: 375–385. 14 Imai, A., Sahara, H., Tamura, Y., Jimbow, K., Saito, T., Ezoe, K., Yotsuyanagi, T. et al., Inhibition of endogenous MHC class II-restricted antigen presentation by tacrolimus (FK506) via FKBP51. Eur. J. Immunol. 2007. 37: 1730–1738. 15 Miller, S. E., Collins, B. M., McCoy, A. J., Robinson, M. S. and Owen, D. J., A Snare-adaptor interaction is a new mode of cargo recognition in clathrin-coated vesicles. Nature 2007. 450: 570–574. 16 Kuramochi, K., Haruyama, T., Takeuchi, R., Sunoki, T., Watanabe, M., Oshige, M., Kobayashi, S. et al., Affinity capture of a mammalian DNA polymerase beta by inhibitors immobilized to resins used in solid-phase organic synthesis. Bioconjug. Chem. 2005. 16: 97–104. 17 Hirst, J., Motley, A., Harasaki, K., Chew, S. Y. P. and Robinson, M. S., EpsinR: an ENTH domain-containing protein that interacts with AP-1. Mol. Biol. Cell 2003. 14:625–641. 18 Mills, I. G., Praefcke, G. J. K., Vallis, Y, Peter, B. J., Olesen, L. E., Gallop, J. L., Bulter, P. J. G. et al., EpsinR: an AP-1/clathrin interacting protein involved in vesicle trafficking. J. Cell Biol. 2003. 160: 213–222. 19 Hom, R. A., Vora, M., Regner, M., Subach, O. M., Cho, W., Verkhusha, V. V., Stahelin, R. V. et al., pH-dependent binding of the epsin ENTH domain and the AP180 ANTH domain to PI(4,5)P2-containing bilayers. J. Mol. Biol. 2007. 373: 412–423. 20 Moreau, K., Ravikumar, B., Renna, M., Puri, C. and Rubinsztein, D. C. Autophagosome precursor maturation requires homotypic fusion. Cell 2011. 146: 303–317.

Antigen processing

27 Furuta, N., Fujita, N., Noda, T., Yoshimori, T. and Amano, A., Combinational soluble N-ethylmaleimide-sensitive factor attachment protein receptor proteins VAMP8 and Vti1b mediate fusion of antimicrobial and canonical autophagosomes with lysosomes. Mol. Biol. Cell 2010. 21: 1001– 1010. 28 Hirst, J., Miller, S. E., Taylor, M. J., Mollard, G. F. and Robinson, M. S., EpsinR is an adaptor for SNARE protein Vti1b. Mol. Biol. Cell 2004. 15: 5593–5602. 29 Chidambaram, S., Mullers, ¨ N., Wiederhold, K., Haucke, V. and Mollard, G. F., Specific interaction between SNAREs and Epsin N-terminal homology (ENTH) domains of Epsin-related proteins in trans-Golgi network to endosome transport. J. Biol. Chem. 2004. 279: 4175–4179. 30 Sanderson, S., Frauwirth, K. and Shastri, N., Expression of endogenous peptide-major histocompatibility complex class II complexes derived from invariant chain-antigen fusion proteins. Proc. Natl. Acad. Sci. USA 1995. 92: 7217–7221. 31 Matsuki, K., Tanabe, A., Hongo, A., Sugawara, F., Sakaguchi, K., Takahashi, N., Sato, N. et al., Anti-angiogenesis effect of 3’-sulfoquinovosyl1’-monoacylglycerol (SQMG) via upregulation of thrombospondin 1. Cancer Sci. 2012. 103: 1546–1552. 32 Shiratori, J., Ogasawara, K., Saito, T., Lanier, L.L. and Arase, H., Activation of natural killer cells and dendritic cells upon recognition of a novel CD99-like ligand by paired immunoglobulin-like type 2 receptor. J. Exp. Med. 2004. 199: 525–533. 33 Morohashi, K., Sahara, H., Miyashita, H., Sato, N., Tanabe, A., Shimotohno, K., Kobayashi, K. et al., Cyclosporine A associated helicase-like protein facilitates the association of hepatitis C virus RNA polymerase with its cellular cyclophilin B. PLoS One 2011. 6: e18285.

21 Cebrian, I., Visentin, G., Blanchard, N., Jouve, M., Bobard, A., Moita, C., Enninga, J. et al., Sec 22b regulates phagosomal maturation and antigen crosspresentation by dendritic cells. Cell 2011. 147: 1355– 1368. 22 Sparace, S. A., Reeleder, R. D. and Khanizadeh, S., Antibiotic activity of the pyrenocines. Can. J. Microbiol. 1987. 33: 327–330. 23 Kalthoff, C., Groos, S., Kohl, R., Mahrhold, S. and Ungewickell, E., Clint: a

Abbreviations: Atg: autophagy-related proteins · BMDC: bone marrowderived DC · CCV: clathrin-coated vesicle · HEL: hen egg lysozyme · IL4I1: interleukin 4-induced gene 1 · shRNA: short hairpin RNA · SNARE: soluble N-ethylmaleimide-sensitive factor attachment protein receptor · SPR: surface plasmon resonance · TGN: trans-Golgi network · Vti1b:

novel clathrin-binding ENTH-domain protein at the Golgi. Mol. Biol. Cell

vesicle transport through interaction with t-SNAREs homologue 1B ·

2002. 13: 4060–4073.

VAMP: vesicle-associated membrane protein

24 Dugast, M., Toussaint, H., Dousset, C. and Benaroch, P., AP2 clathrin adaptor complex, but not AP1, controls the access of the major histocompatibility complex (MHC) class II to endosome. J. Biol. Chem. 2005. 280: 19656–19664. 25 Santambrogio, L., Potolicchio, I., Fessler, S. P., Wong, S. H., Raposo, G. and Strominger, J. L., Involvement of caspase-cleaved and intact adaptor

Full correspondence: Prof. Hiroeki Sahara, Laboratory of Biology, Azabu University School of Veterinary Medicine, Fuchinobe 1-17-71, Chuo-ku, Sagamihara 252–5201, Japan Fax: +81-42-769-1842 e-mail: [email protected]

protein 1 complex in endosomal remodeling in maturing dendritic cells. Nat. Immunol. 2005. 10: 1020–1028. 26 Pryor, P. R., Mullock, B. M., Bright, N. A., Lindsay, M. R., Gray, S. R., Richardson, S. C. W., Stewart, A. et al., Combinational SNARE complexes with VAMP7 or VAMP8 define different late endocytic fusion events. EMBO Rep. 2004. 5: 590–595.

 C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Received: 15/1/2014 Revised: 31/7/2014 Accepted: 3/9/2014 Accepted article online: 4/9/2014

www.eji-journal.eu

3231