http://informahealthcare.com/bmk ISSN: 1354-750X (print), 1366-5804 (electronic) Biomarkers, 2014; 19(3): 198–206 ! 2014 Informa UK Ltd. DOI: 10.3109/1354750X.2014.895852

RESEARCH ARTICLE

Epidermal growth factor receptor (EGFR) mutations as biomarker for head and neck squamous cell carcinomas (HNSCC) K. Nagalakshmi1,2#, Kaiser Jamil1#, Usharani Pingali2, M. Vishnuvardhan Reddy3, and Suresh S. V. Attili4 Genetics Department, Bhagwan Mahavir Medical Research Centre, Hyderabad, Andhra Pradesh, India, 2Clinical Pharmacology and Therapeutics Department, Nizams Institute of Medical Sciences, Hyderabad, Andhra Pradesh, India, 3Department of Otolaryngology, Government ENT Hospital, Koti, Hyderabad, Andhra Pradesh, India, and 4Department of Medical Oncology, BB General Hospital and Cancer Centre, Hyderabad, Andhra Pradesh, India Abstract

Keywords

Context: Mutations in tyrosine kinase domain (TK) of epidermal growth factor receptor (EGFR) lead to signalling interruptions in several cancers. Objective: To understand EGFR mutations in head and neck squamous cell carcinomas (HNSCC), and their role as biomarkers. Methods: Screened 129 HNSCC patients and 150 controls for mutations in the TK domain using polymerase chain reaction (PCR), single strand confirmatory polymorphism (SSCP) and sequencing. Results: 81.39% of HNSCC had four mutations: G2155C, G2176A, C2188G and G2471A among these two mutations were also reported in other cancers where as two novel mutations are being reported for the first time in HNSCC. Mutational frequency was significantly associated with an advanced stage of HNSCC, habits of tobacco/alcohol and ages above 49 years. Conclusion: EGFR single nucleotide polymorphisms could be useful biomarkers of HNSCC.

Biomarkers, EGFR, head and neck squamous cell carcinoma, receptor signalling, risk factors, single nucleotide polymorphism

Introduction Head and neck squamous cell carcinomas (HNSCC) are the group of cancers that include the areas of nasal cavity, sinuses, lip, mouth, salivary glands, throat, larynx and pharynx. HNSCC is the sixth most common cancer of global concern and this is known to be a devastating disease, diagnosed in advanced stages with treatment frequently leaving patients disfigured, with debilitating adverse effects of radiation and chemotherapy, compromised speech, swallowing difficulties and diminished quality of life (Denaro et al., 2011). The high rate of relapse in this tumour indicates the inadequacy of current prognostic predictors in predicting metastatic potential (Chiu et al., 2013; Cortesina & Martone, 2006; Elahi et al., 2012; Yen et al., 2013). One of the vital receptor that controls key signalling pathways for cell proliferation and survival is epidermal growth factor receptor (EGFR), which is a glycoprotein cell surface receptor composed of an extracellular ligand-binding domain, transmembrane domain and cytoplasmic tyrosine #

K. Nagalakshmi and Kaiser Jamil are responsible for statistical design/ analysis. E-mail: [email protected] (K. Nagalakshmi); [email protected] (K. Jamil) Address for correspondence: Dr Kaiser Jamil, Head, Genetics Department, Bhagwan Mahavir Medical Research Centre, Mahavir Marg, AC Guards, 10-1-1, Hyderabad-500004, Andhra Pradesh, India. Tel: +919676872626. Fax: +914066631500. E-mail: [email protected]

History Received 19 December 2013 Revised 14 February 2014 Accepted 14 February 2014 Published online 8 April 2014

kinase (TK) domain. Ligand occupancy of EGFR autophosphorylates the TK domain and activates Mitogen Activated Protein Kinase (MAPK), Signal Transducer and Activator of Transcription (STAT) and phosphatidylinositol-3kinase (PI3K)-AKT signalling pathways, which together modulate cellular proliferation, adhesion, angiogenesis and migration (Harari et al., 2007). High expression of EGFR occurs in most epithelial malignancies including HNSCC. Elevated expression of EGFR in HNSCC correlates with poor prognosis (Ciardiello & Tortora, 2003). Mutations in EGFR are responsible for the over-expression of these receptors (Jorissen et al., 2003) and mutations in TK domain of the EGFR have been identified as a cause of non-small cell lung cancer (NSCLC) (Lynch et al., 2004). The hot spot regions of mutations in the TK domain have been described mostly in lung cancer, these include exon 18 (G719S), exon 19 (in-frame deletions) and exon 21 (L858R) in lung cancer (Lynch et al., 2004; Paez et al., 2004; Pao et al., 2004; Takano et al., 2005); however, such information is not available in HNSCC. This information is vital in view of the fact of selecting targeted therapies for HNSCC. Most of these chemotherapeutics are known as tyrosine kinase inhibitors (TKIs) of EGFR. Gefitinib and erlotinib are active site TKIs developed to control the EGFR signalling in cancers. The mutations of TK domain showed heterogeneity in response to the gefitinib therapy, where some of these point mutations were sensitive (V765M, R776H and G779S) and other few were resistant (D761Y, T790M and K806E) (Wu et al., 2008).

20 14

Biomarkers Downloaded from informahealthcare.com by Emory University on 11/02/14 For personal use only.

1

Biomarkers Downloaded from informahealthcare.com by Emory University on 11/02/14 For personal use only.

DOI: 10.3109/1354750X.2014.895852

Hypothetically, all of the relevant mutations result in conformational changes leading to increased activity as well as TK inhibitors sensitivity (Greulich et al., 2005). Understanding the polymorphic nature of EGFR in HNSCC may pave the way to improve the prognosis, diagnosis and treatment to the HNSCC disease. In view of the above hypothesis, the TK domain of EGFR spanning the exons 18–21 needed to be studied. Our earlier report discussed the polymorphisms in the exon 20 and its association with HNSCC (Nagalakshmi et al., 2013). Hence, in this investigation we propose to identify single nucleotide polymorphisms (SNPs) in the other exons (18, 19 and 21) of TK domain of EGFR. Further, in order to understand the association of SNPs with demographic and clinical parameters of HNSCC we wish to analyse these associations using statistics. Since, in-frame deletion of E746_A750 in exon 19 seems to be a gain-of-function mutation that activates anti-apoptotic pathways (Sordella et al., 2004). Tobacco and alcohol are well established risk factors for HNSCC and they might also be associated with the occurrence of gene polymorphisms (Basu et al., 2008; Sabitha et al., 2008, 2010). However, the association of these risk factors have neither been described in statistical terms nor in terms of their associations to the EGFR genotypes in HNSCC. The hypothesis of this study was to determine the potential association of SNPs with HNSCC disease which may reveal the role of SNPs as biomarkers for prognosis, diagnosis and targeted therapies of HNSCC. Human malignancies are characterised by polymorphic activated proteins, which could be responsible for tumour growth and survival (Dibb et al., 2004).

Materials and methods Study population The present study was a hospital-based case-control study conducted in a south Indian population. The study protocol was approved by an Institutional Ethics Committee. The individuals selected as the study group were personally interviewed to collect the demographic factors such as age, gender, occupation and personal habits (tobacco and alcohol consumption). The details were documented using a structured questionnaire. The clinical parameters and other details of HNSCC including primary cancer site, tumour stage and tumour grade were retrieved from medical records.

EGFR mutations as biomarker for HNSCC

199

lesions or prior history of cancer was also considered as inclusion criteria for the control group. Sample collection Clinically confirmed tissue biopsies of 129 HNSCC samples were collected in saline and stored at 80  C till further use. Three millilitres of blood samples from each individual belonging to the control group (150) was collected by venipuncture. All the samples were collected with an informed consent. Patient characteristics A total of 129 HNSCC cases and 150 healthy volunteers formed our study group. The male–female ratio was similar in both the study groups. The primary sites of the HNSCC disease consisted of: oral cancers (54.26%), oropharyngeal cancers (27.13%), sinonasal cancers (12.40%) and laryngeal cancers (6%). The tumour grade of HNSCC included well differentiated squamous cell carcinomas (WDSCC), medium differentiated squamous cell carcinomas (MDSCC) and poorly differentiated squamous cell carcinomas (PDSCC). The frequency of tumour grade among HNSCC was 66.66% in WDSCC, 24.80% in MDSCC and 8% in PDSCC. The majority of HNSCC cases were at stage III (41.86%), stage IV (32.55%) followed by 20.93% at stage II and 4% at stage I. The overall exposure to tobacco and alcohol was found to be higher in HNSCC cases (87.59%) than controls (46%). The median of the age was found to be 50, thus the study group were divided into two groups based on the age, where 31% of HNSCC were below 50 years of age group and 68.99% were either equal or above 50 years of age. Mutational analysis of tyrosine kinase domain in EGFR Genomic DNA extraction: Genomic DNA was extracted from tissue biopsies of (129) HNSCC patients and blood samples of (150) controls by ethanol precipitation protocol (Miller et al., 1988). The quality and quantity of the DNA was analysed by agarose gel electrophoresis and spectroscopy. The quantified DNA samples (cases and controls) were further processed for mutational analysis using polymerase chain reaction (PCR) and single strand confirmatory polymorphism (SSCP). The methods of this part are already reported in another study of ours (Nagalakshmi et al., 2013), but the current study is concerned with new variables that are not reported in the other report.

Selection of the study group: the inclusion and exclusion criteria

Amplification of EGFR exons using PCR

Head and neck cancer patients were assessed on the basis of clinical and pathological examinations. Patients who were clinically confirmed with HNSCC by pathologists and those patients who gave their consent were 129 individuals and were included in the study. HNSCC patients reluctant to give their consent and patients who were under the radiation plus chemotherapy treatments were excluded. Age and sex-matched 150 healthy individuals were recruited as controls. These were healthy volunteers and they had no medical record of any disease and were not under treatment for any disease. The absence of pre-cancerous

The whole exons of TK domain including exon 18 (213 base pair), exon 19 (258 base pair) and exon 21 (256 base pair) were amplified in all the DNA samples (both 129 HNSCC cases and 150 controls) using the given primers: Exon-18 forward primer (F.P): CCATGTCTGGCACTGCTTT, Exon-18-reverse primer (R.P): CTGTGCCAGGGACCTTAC C (Temam et al., 2007), Exon-19 F.P: TGGTAACATCCACCCAGATCAC; exon-19, R.P: CAGCTGCCAGACATGAGAAAAG (WillmorePayne et al., 2006); EGFR exon 21 primers were designed using primer3 software

200

K. Nagalakshmi et al.

and exon-21 F.P: GAATTCGGATGCAGAGCTTC; exon-21 R.P: GGAAAATGCTGGCTGACCTA. The reaction mixture for amplification was prepared with 1X KCl buffer, 1.8 mM MgCl2, 200 mM of each deoxynucleotide tri phosphates (dNTPs), 1.0 unit of Thermus aquaticus (Taq) polymerase, 10 pM of each primer (F.P and R.P) and 100 ng of DNA template. The conditions for PCR program were initial denaturation at 94  C for 5 min, followed by a 35-cycles reaction of denaturation at 94  C for 30 s, annealing at 60  C/58  C/59  C for 30 s, and extension at 72  C for 30 s and final extension at 72  C for 7 min. The quality and specificity of the amplified exons were confirmed with the 100 base pair molecular marker on 2% agarose gel electrophoresis.

Biomarkers Downloaded from informahealthcare.com by Emory University on 11/02/14 For personal use only.

Single strand confirmatory polymorphism Polyacrylamide gels were used for SNP analysis. The conversion of amplified double stranded DNA of the exons into single stranded DNA was performed in a reaction mixture contains 5 mL of the amplified PCR product and 10 mL of denaturation buffer (95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol, ethylenediaminetetraacetic acid and NaOH). The reaction mixture was denatured at 95  C for 5 min and these denatured samples were snap-cooled on ice for about 5 min. The denatured samples were immediately loaded on 12% (exon 18 and exon 19) and 10% (exon 21) polyacrylamide gels (50% acrylamide stock, 10X buffer, 10% Ammonium per sulphate, Tetramethylethylenediamine, distilled water). The electrophoresis was carried out for 6–8 h at 160 V. The gels were silver stained (1% silver nitrate) to observe the mobility shifts. Sequencing by Sanger’s dideoxy sequencing method The SSCP gels showed two different patterns of mobility shifts where each pattern of mobility corresponds to wild and mutant sequence. For each exon we processed all the mutant samples and 30 samples of wild sequences for both HNSCC and controls. All these samples were processed using Sanger’s dideoxy sequencing method. The sequenced forward and reverse strands were further analysed for polymorphisms. The sequence variations were identified with the help of a wildtype sequence. The samples were repeatedly processed to confirm the mutations and its associated amino acid changes in the codons of the EGFR. Statistical analysis The statistical analysis was carried out with Med Calc version 12.1.1.2 (MedCalc software, Ostend, Belgium). Hardy– Weinberg equilibrium was tested for all the polymorphisms and the genotypes were in agreement with the law. The frequency of mutations was calculated with the number of mutant alleles from the total number of alleles. The McNemar test, odds ratio and multiple regression analysis were used to evaluate the association of mutations in HNSCC disease with the demographic and clinical parameters. Mutation in each exon was considered as dependent variable and other parameters (clinical and demographic factors) were considered as independent variables for all the statistical tests. A two-tailed p value was calculated in all the analyses, and a p value 0.05 was considered statistically significant.

Biomarkers, 2014; 19(3): 198–206

Results Mutations of the exon 18 in EGFR The samples with variant mobility shifts were found with two SNPs in the exon 18 sequence of EGFR. A transversion of guanine to cytosine at nucleotide 2155 created a missense mutation that replaced glycine at 719 aminoacid with arginine (G719R). And the other SNP resulted from a transition of guanine to adenine at 2176 nucleotide created a missense mutation that replaced valine with methionine at 726 aminoacid (V726M). The wild and mutant (heterozygous) nucleotide sequences are presented in Figure 1. Both 2155G4C (G719R) and 2176 G4A (V726M) polymorphisms were coexisted in the study group and showed a significant difference in the mutational frequency of HNSCC (44.96%) and controls (13.33%, p50.0001). The wild allele GG of G719R mutation is significant among the control group, where as the mutant allele GC is significant in HNSCC. Similarly, the wild type allele GG of V726M mutation is significant among the control group, whereas the mutant allele GA is significant in HNSCC (p50.0001). The distribution of mutations among HNSCC and controls, in relation with demographic factors (gender, habits and age) and the significant polymorphic differences in the study group are shown in Table 1. Our results showed a significant difference in HNSCC patients with tobacco and alcohol habits and HNSCC with no habits (OR: 4.1092; 95% CI: 1.1104– 15.2063; p ¼ 0.03). In our study group almost 84.37% of females were habituated to tobacco chewing and alcohol, which determined the possible reason for higher prevalence of polymorphisms among females than males (OR: 0.3784; 95% CI: 0.1769–0.8092; p ¼ 0.01). The distribution of polymorphisms among gender in relation to clinical parameters is presented in Table 2. Multiple regression analysis showed a significant association of polymorphism with age (p ¼ 0.05); therefore, we could record an association of mutations in HNSCC at 50 or older years of age group (OR: 0.4006; 95% CI: 0.1811–0.8861; p ¼ 0.023). The distribution of polymorphisms is 46.87% in advanced stages and 39.39% in early stages, indicating that exon 18 mutations were not affected by the stage of the tumour. But we recorded significant difference among gender at advanced stages, where the mutational frequency of females was greater in advanced stages of the disease and the polymorphic frequency was higher in males at early stages (Table 2). These findings showed that the incidence of polymorphisms was affected by the gender in relation with the stage of the HNSCC disease. Mutations of the exon 19 in EGFR We found a novel polymorphism in the exon 19 sequence, which is a transversion of cytosine to guanine at 2188 nucleotide that replaced leucine with valine at 730 codon (L730V). This polymorphism was not reported in any of the databases which we searched for this exon, hence it is considered as novel. The wild and heterozygous mutant nucleotide sequences are presented in Figure 1. The polymorphic frequency of 2188C4G was 32.55% in HNSCC and 14.66% in controls. The CC genotype

EGFR mutations as biomarker for HNSCC

Biomarkers Downloaded from informahealthcare.com by Emory University on 11/02/14 For personal use only.

DOI: 10.3109/1354750X.2014.895852

201

Figure 1. Single nucleotide polymorphisms in the exons (18, 19 and 21) of EGFR. (1): G2155C polymorphism in exon 18 of EGFR. (1a) Transversion at 2155G4 C replaced Glycine at 719 codon with Arginine. (1b) Normal exon 18 sequence. (2) G2176A polymorphism in exon 18 of EGFR. (2a) Transition at 2176G4A, replaced Valine at 726 codon with Methionine. (2b) Normal exon 18 sequence. (3) 2188C4G polymorphism of exon 19 in EGFR. (3a) Transition at 2188C4G, replaced Leucine at 730 with Valine (L730V). (3b) Normal exon 19 sequence. (4) 2471 G4A polymorphism in exon21 of EGFR. (4a) Transition at 2471G4A, replaced Glycine at 824 with Aspartic acid. (4b) Normal exon 21 sequence.

Table 1. Mutational frequency of the exon 18 in the study group. HNSCC cases (n ¼ 129) Demographics Gender Male Female Habits None Smoke Alcohol Chewers S&A S&C A&C S, A&C Age group 550 50

Mutant (n ¼ 58)

Wild (n ¼ 71)

24 (36.92%) 34 (53.12%)

41 (63.07%) 30 (46.87%)

3 (18.75%) 5 (71.42%) – 17 (48.57%) 7 (31.81%) 1 (50%) 18 (58.06%) 7 (50%)

13 2 2 18 15 1 13 7

12 (30%) 46 (51.68%)

28 (70%) 43 (48.31%)

(81.25%) (28.57%) (100%) (51.43%) (68.18%) (50%) (41.93%) (50%)

Controls (n ¼ 150) Mutant (n ¼ 20) 17 (20%) 3 (4%)

Wild (n ¼ 130)

p Valuea

58 (80%) 62 (96%)

0.06 0.0001b

– – – (100%) (29.41%) (100%) (30%) (57.14%)

84 (100%) 5 (100%) 7 (100%) – 24 (70.58%) – 7 (70%) 3 (42.85%)

0.01b 0.05 0.60 0.29 0.84 0.13 0.58 0.75

11 (16.17%) 9 (10.97%)

57 (83.82%) 73 (89.02%)

0.09 50.0001b

2 10 1 3 4

Smoking: tobacco smoking; Chewers: tobacco chewers; S&A: tobacco smoking and alcohol; S&C: tobacco smoking and tobacco chewers; A&C: alcohol and tobacco chewers; S, A&C: tobacco smoking, alcohol and tobacco chewers. a odds ratio; bp50.05.

(wild allele) was significant among controls where as CG (mutant allele) genotype showed significant association with HNSCC (p50.0001). The distribution of this novel mutation in relation with the demographic factors (gender, age and habits) in the study group are described in Table 3. The mutant allele CG of 2188C4G was significantly associated in HNSCC patients with habits of tobacco (chewing and smoking) and alcohol (OR ¼ 8.5417; 95% CI: 1.0884– 67.0365; p ¼ 0.04).

The polymorphic frequencies of the 2188C4G in association with the clinical parameters of HNSCC such as primary site, tumour grade and tumour stage were studied. The mutational frequencies among gender in relation to all the clinical parameters are presented in Table 4. Multiple regression analysis showed a significant association of 2188C4G mutation with advanced stages (p ¼ 0.006), tumour grade (p ¼ 0.04) and above 49 years of age group (p ¼ 0.0004). We found higher prevalence of mutant allele

202

K. Nagalakshmi et al.

Biomarkers, 2014; 19(3): 198–206

Table 2. Mutational frequency of the exon 18 in association with the clinical parameters of HNSCC. Males (n ¼ 65)

2

3

Wild (n ¼ 41)

Mutant (n ¼ 34)

Wild (n ¼ 30)

p Valuea

Clinical parameters

Mutant (n ¼ 24)

Primary site Oral cancers Oropharyngeal cancers Sinonasal cancers Larynx cancer

15 (41.66%) 5 (31.25%) 4 (57.14%) –

21 11 3 6

(58.33%) (68.75%) (42.85%) (100%)

21 (61.76%) 10 (52.63%) 3 (33.33%) –

13 9 6 2

(38.23%) (47.36%) (66.66%) (100%)

0.09 0.2 0.34 –

Tumor grade WDSCC MDSCC PDSCC

13 (32.50%) 10 (58.82%) 1 (12.50%)

27 (67.50%) 7 (41.17%) 7 (87.50%)

24 (52.17%) 9 (60%) 1 (33.33%)

22 (47.82%) 6 (40%) 2 (66.66%)

0.06 0.94 0.44

Tumor stage Stage I & II Stage III & IV

7 (43.75%) 17 (34.69%)

9 (56.25%) 32 (65.30%)

6 (35.29%) 28 (59.57%)

11 (64.70%) 19 (40.42%)

0.61 0.01b

S. no. 1

Females (n ¼ 64)

odds ratio; bp50.05.

Biomarkers Downloaded from informahealthcare.com by Emory University on 11/02/14 For personal use only.

a

Table 3. 2188C4G polymorphic frequency of the exon 19 in the study group. HNSCC cases (n ¼ 129) Demographics Gender Male Female Habits None Smoke Alcohol Chewers S&A S&C A&C S, A&C Age group 550 50

Controls (n ¼ 150) p Valuea

Mutant (n ¼ 42)

Wild (n ¼ 87)

Mutant (n ¼ 14)

Wild (n ¼ 136)

16 (24.61%) 26 (40.62%)

49 (75.38%) 38 (59.37%)

10 (13.33%) 4 (5%)

65 (86.66%) 71 (94.66%)

0.06 0.0001b

1 2 1 14 4

(6%) (28.57%) (50%) (40%) (18.18%) – 12 (38.71%) 8 (57.14%)

15 5 1 21 18 2 19 6

1 (1.19%) – – 1 (50%) 8 (23.52%) 1 (100%) 1 (10%) 3 (42.85%)

83 5 7 1 24

(98.81%) (100%) (100%) (50%) (70.58%) – 9 (90%) 4 (57.14%)

0.23 0.33 0.14 0.78 0.55 0.40 0.08 0.53

3 (7.5%) 39 (43.82%)

37 (92.5%) 50 (56.18%)

6 (8.8%) 8 (9%)

62 (91.17%) 74 (90.24%)

0.81 50.0001b

(93.75%) (71.42%) (50%) (60%) (81.81%) (100%) (61.29%) (42.85%)

Smoking: tobacco smoking; Chewers: tobacco chewers; S&A: tobacco smoking and alcohol; S&C: tobacco smoking and tobacco chewers; A&C: alcohol and tobacco chewers; S, A&C: tobacco smoking, alcohol and tobacco chewers. a odds ratio; bp50.05.

(CG) among males with sinonasal cancers and females with oral and oropharyngeal cancers (Table 4). A significant difference was identified between gender and WDSCC where wild allele (CC) was prevalent in males and mutant allele (CG) was prevalent in females (Table 4). These findings indicate that this polymorphism was affected by advanced stages, age and gender in relation with tumour grade. Mutational analysis of the exon 21 in EGFR The sequence of the exon 21 showed a novel mutation which is a transition from guanine to adenine at 2471 loci created a missense mutation that replaced glycine at 824 codon with aspartic acid (G824D). The heterozygous sequence and normal sequences are presented in Figure 1. About 65.11% of HNSCC and 23.33% of controls were identified with 2174 G4A (G824D) polymorphism. We found a significant allelic difference in the study group where GG allele (wild) was prevalent in controls and GA (mutant) was prevalent in HNSCC (p50.0001).

The polymorphic frequencies of exon 21 in the study group in relation to demographic factors are presented in Table 5. Multiple regression analysis showed a significant association of 2174G4A mutation with an advanced stage of HNSCC disease (p ¼ 0.02). The mutational frequencies among gender in relation with clinical parameters are presented in Table 6. Oropharyngeal cancer was identified with higher frequency than other sites of HNSCC. Males with MDSCC showed significant predominance to this novel SNP (Table 6). We found a significant difference in the mutational frequency among females with tobacco (chewing and smoking) and alcohol habits and females without these habits (OR: 4.6667; 95% CI: 1.0772–20.2175; p ¼ 0.03), whereas in males we did not find any significant difference associated with habits of tobacco (chewing and smoking) and alcohol. These findings suggested that the tobacco and alcohol-induced gene susceptibility was significantly higher in females than males in HNSCC. The overall mutational frequency of the 3 exons in EGFR was 81.39% in HNSCC and 28% in controls. We found a significant difference among HNSCC and controls for the

EGFR mutations as biomarker for HNSCC

DOI: 10.3109/1354750X.2014.895852

203

Table 4. 2188C4G polymorphism of the exon 19 in association with clinical parameters of HNSCC. Males (n ¼ 65) Clinical parameters

Mutant (n ¼ 16)

Primary site Oral cancers Oropharyngeal cancers Sinonasal cancers Larynx cancer

10 (27.77%) 1 (6.25%) 5 (71.42%) –

S. no. 1

2

3

Tumor grade WDSCC MDSCC PDSCC Tumor stage Stage I & II Stage III & IV

Females (n ¼ 64)

Wild (n ¼ 49) 26 15 2 6

Mutant (n ¼ 26)

Wild (n ¼ 38) (50%) (63.15%) (77.77%) (100%)

p Valuea

(72.22%) (93.75%) (28.57%) (100%)

17 (50%) 7 (36.84%) 2 (22.22%) –

17 12 7 2

0.05 0.05 0.06 –

6 (15.00%) 6 (35.20%) 4 (50.00%)

34 (85%) 11 (64.70%) 4 (50%)

19 (41.30%) 7 (47%) –

27 (58.69%) 8 (53.33%) 3 (100%)

0.009b 0.51 1

1 (6.25%) 15 (30.61%)

15 (93.75%) 34 (69.38%)

3 (17.64%) 23 (48.93%)

14 (82.35%) 24 (51.06%)

0.33 0.06

odds ratio; bp50.05.

Biomarkers Downloaded from informahealthcare.com by Emory University on 11/02/14 For personal use only.

a

Table 5. 2174G4A polymorphism of the exon 21 in association with the study group. HNSCC cases (n ¼ 129) Demographics Gender Male Female Habits None Smoke Alcohol Chewers S&A S&C A&C S, A&C Age group 550 50

Mutant (n ¼ 83)

Controls (n ¼ 150)

Wild (n ¼ 46)

Mutant (n ¼ 29)

Wild (n ¼ 121)

p Valuea

44 (67%) 39 (60%)

21 (32.30%) 25 (39.06%)

24 (32%) 5 (6%)

51 (68%) 70 (93.33%)

0.0001b 0.0001b

7 5 1 21 16 1 22 9

9 2 1 14 6 1 9 5

3 (3%) 2 (40%) 2 (28%) – 15 (44%) – 3 (30%) 4 (57%)

81 3 5 2 19 1 7 3

(96.42%) (60%) (71.42%) (100%) (55.88%) (100%) (70%) (42.85%)

0.0001b 0.28 0.57 0.20 0.03b 0.22 0.02b 0.75

16 (23.52%) 13 (15.85%)

52 (76.47%) 69 (84.14%)

0.13 50.0001b

(43%) (71%) (50%) (60%) (72%) (50%) (70%) (64%)

22 (55%) 61 (68.53%)

(56.25%) (28.57%) (50%) (40%) (27.27%) (50%) (29.03%) (35.71%)

18 (45%) 28 (31.46%)

Smoking: tobacco smoking; Chewers: tobacco chewers; S&A: tobacco smoking and alcohol; S&C: tobacco smoking and tobacco chewers; A&C: alcohol and tobacco chewers; S, A&C: tobacco smoking, alcohol and tobacco chewers. a odds ratio; bp50.05.

Table 6. 2174G4A polymorphism in association with clinical parameters of HNSCC. Males (n ¼ 65) S. no. 1

2

3

Clinical parameters Primary site Oral cancers Oropharyngeal cancers Sinonasal cancers Larynx cancer Tumor grade WDSCC MDSCC PDSCC Tumor stage Stage I & II Stage III & IV

Mutant (n ¼ 44) 23 13 5 3

(63.88%) (81.25%) (71.42%) (50.00%)

Females (n ¼ 64)

Wild (n ¼ 21) 13 3 2 3

Mutant (n ¼ 39)

Wild (n ¼ 25) (32.35%) (42.10%) (44.44%) (100%)

p Valuea

(36.11%) (18.75%) (28.57%) (50%)

23 (67.64%) 11 (57.89%) 5 (55.55%) –

11 8 4 2

0.74 0.14 0.51 1

27 (67.50%) 14 (82.35%) 3 (37.50%)

13 (32.50%) 3 (17.64%) 5 (62.50%)

31 (67.39%) 6 (40.00%) 2 (66.66%)

15 (32.60%) 9 (60%) 1 (33.33%)

0.99 0.01b 0.39

9 (56.25%) 35 (71.42%)

7 (43.75%) 14 (28.57%)

7 (41.17%) 10 (68.08%)

10 (58.82%) 15 (31.91%)

0.38 0.72

a

odds ratio; bp50.05.

presence of mutations (p50.0001). The four SNPs of tyrosine kinase domain of EGFR found in our study group are presented in Table 7. We found a significant difference in the mutational frequency among HNSCC and controls in

association with demographic factors where males (p50.0001), females (p50.0001), people younger than 50 years age group (p ¼ 0.0002) and people at 50 or older age group (p ¼ 0.0001), and tobacco (chewing and smoking) plus

204

K. Nagalakshmi et al.

Biomarkers, 2014; 19(3): 198–206

Table 7. Mutations in tyrosine kinase domain of EGFR gene. Domain Tyrosine kinase domain

Exon

Nucleotide

Amino acid

Mutation

HNSCC (n %)

Controls (n %)

p Valuea

18 19 21

G2155C & G2176A C2188G G2471A

G719R & V726M L730V G824D

Missense Missense Missense

58/129 (44.96%) 42/129 (32.55%) 83/129 (65.11%)

20/150 (13.33%) 22/150 (14.66%) 35/150 (23.33%)

0.0001 0.0001 0.0001b

a

McNemar test. p50.05.

Biomarkers Downloaded from informahealthcare.com by Emory University on 11/02/14 For personal use only.

b

alcohol habits (p50.0001). These findings suggested that the TK domain mutations of EGFR were more specific to HNSCC disease. Apart from demographic factors, clinical parameters such as primary site (p ¼ 0.003) and advanced stage HNSCC (p ¼ 0.01) showed a significant association to EGFR polymorphisms. We did not found any significant association of mutations with tumour grade (p ¼ 0.13), whereas we record a significant association for HNSCC with tobacco (chewing and smoking) plus alcohol habits (p ¼ 0.0002), especially females with these habits showed predominance (p ¼ 0.0003). Advanced stage of disease, tobacco (chewing and smoking) plus alcohol habits and age (at 50 or older years) parameters are affecting the gene susceptibility to mutations in TK domain of EGFR in HNSCC. Apart from these, we are assuming that the ethnic differences might also affect the incidence of TK domain polymorphisms.

Discussion EGFR is a trans-membrane receptor playing an important role in normal cellular mechanisms of cell proliferation, differentiation and survival. The aberrant activation of EGFR due to over-expression and mutations was found in many cancers and seen in tumour cell proliferation that leads to progressive disease (Nomura et al., 2007). Many human cancers exhibit EGFR over expression, which is correlated with an advanced tumour stage or a poor clinical outcome, such as non-small cell lung cancer (NSCLC) (Arau´jo et al., 2007), colorectal cancer (Hsieh et al., 2012), breast cancer (Lo et al., 2006) head and neck cancer (Farnebo et al., 2009), bladder cancer (Mellon et al., 1995) and gastric cancer (Tanner et al., 2005). Thus, EGFR became an attractive target for cancer therapies. Small molecule inhibitors such as gefitinib and erlotinib were targeted against TK domain of EGFR and used in the treatment of lung cancer. Several EGFR mutations related to increased carcinogenesis (tumour growth, invasion, metastasis and progression) and also these SNPs serve as key determinants of a response to targeted chemotherapies (Nomura et al., 2007). HNSCC is the sixth most frequent cancer worldwide (Denaro et al., 2011) despite current therapeutic modalities, many patients suffer from relapse of the disease or develop metastases, highlighting the need for new therapeutic targets (Chiu et al., 2013; Cortesina & Martone, 2006; Elahi et al., 2012; Yen et al., 2013). The present study comprehensively evaluated the polymorphisms in TK domain of EGFR gene and their association with HNSCC. The polymorphic frequency of EGFR was found to be 7.3% in Asian HNSCC (Lee et al., 2005), 15.7% in Korean HNSCC (Na et al., 2007) and no mutations were reported in Spanish

(Lemos-Gonzalez et al., 2007), American (Chung et al., 2006), French (Temam et al., 2007) and Caucasian HNSCC (Loeffler-Ragg et al., 2006). In this study, we found four SNPs in EGFR TK domain (exon 18, 19 and 21) that resulted in four missense mutations (G719R, V726M, L730V and G824D). The polymorphic frequency of TK domain was 81.39% in HNSCC of our population (at least one or two in the three exons of TK domain). Indeed, differences in incidence have been well characterised with respect to EGFR mutations in NSCLC, where the incidence was twice that in Asians compared to Whites (Linardou et al., 2009). The findings reported a higher polymorphic frequency (51.8%) of EGFR mutations in lung cancer patients (Sahoo et al., 2011) and therefore this is our first report of the novel SNP findings in HNSCC. Our study also confirms that ethnic variations could affect the incidence of polymorphisms in HNSCC, since polymorphic nature of EGFR was found to be the most common phenomena in HNSCC of our population. Our findings were also supported by the literature that the prevalence of EGFR mutations in HNSCC shows ethnic variations (Loeffler-Ragg et al., 2006). Gene susceptibility to mutations may vary among populations which are generally determined by the possible risk factors, which includes tobacco (chewing and smoking), alcohol, age, socio-economic conditions and clinical parameters of the disease. Previously we reported two silent mutations (G779G, and Q787Q) and two missense mutations (R776H and L798H) in exon 20 of EGFR which relate to the risk factors influencing the mutational frequency in EGFR (Nagalakshmi et al., 2013). Alcohol and tobacco were the two major etiological factors which increased the chances of HNSCC in males more than in females (3:1) (Hama et al., 2009). Equal male to female ratio (1:1) of HNSCC subjects in our population confirmed that the tobacco (chewing and smoking) and alcohol habits could affect the incidence of HNSCC as we found 84.37% of females and 90.76% of males were habituated to tobacco and alcohol. Earlier studies (Shigematsu et al., 2005) reported that the etiology of EGFR mutations in HNSCC might be different from that of lung cancer. However, somatic mutations in the tyrosine kinase domain of EGFR were more common in adenocarcinomas and never smokers in NSCLC (Shigematsu et al., 2005). Lee et al. (2005) found that in the head and neck cancers the EGFR mutations occurred in squamous cell carcinomas and smokers. Our results were also similar as we found that tobacco (chewing and smoking) and alcohol habits could increase the mutational frequency in HNSCC. G719R and V726M were reported in lung adenocarcinomas (2–5%) (Tokumo et al., 2005) and in our study these two polymorphisms coexisted in 44% of HNSCC and associated with age, gender (female) and HNSCC independent of tobacco and

EGFR mutations as biomarker for HNSCC

Biomarkers Downloaded from informahealthcare.com by Emory University on 11/02/14 For personal use only.

DOI: 10.3109/1354750X.2014.895852

alcohol habits. E746_A750del mutation in exon 19 of EGFR mutations was most common in HNSCC and NSCLC (Chung et al., 2006; Sharma et al., 2007). L730V was present in 32% of HNSCC and it was affected by the stage, gender and age. Some of the EGFR SNPs, including R497K (Krohn et al., 2011), G719S (Yoshikawa et al., 2013) and Q787Q (Kaneko et al., 2010), were more likely to affect the tumour growth and development. The frequency of EGFR mutation was found to be associated with tumour grade in lung cancer (Hang et al., 2013). The novel mutation (L730V) in the exon 19 of EGFR in our study was found to be significant, as it was found to be associated with WDSCC in males. The occurrence of novel SNPs (L730V and G824D) of EGFR in our study also indicates the polymorphic nature of the gene which leads to mutations under various external or intrinsic pressures; here, we were able to attribute these novel mutations to various risk factors associated with the population. Moreover, the occurrence of mutation were different for each SNP and indicated that gene susceptibility to mutations in EGFR which were influenced by parameters that included site of cancer, intensity of associated risk factors (tobacco and alcohol), age and stage of the disease. SNPs in more than one key signalling molecule contribute to an individuals’ susceptibility to cancer. The high EGFR copy number with concurrent KRAS or BRAF mutations is quite common in colon cancer (Rong et al., 2012). Large number of multiple mutations in TP53, HRAS and NOTCH family gene mutations (NOTCH1, NOTCH2 and NOTCH3) confirmed the heterogeneity of the HNSCC tumours, which is reflected in the diverse biology, response to treatment and prognosis of HNSCC patients (Agrawal et al., 2011; Stransky et al., 2011). The co-existence of mutations in exon 18 (G719R and V726M) and its association with HNSCC of our study indicated that the presence of multiple SNPs in one exon or more than one exon may influence the disease state and prognosis. Studies on multiple gene mutations of key signalling pathways and its association with HNSCC may contribute to the better understanding of the HNSCC disease prognosis and treatment. Somatic mutations of EGFR are known to affect the response to tyrosine kinase inhibitors (gefitinib and erlotinib). Some of the TK domain mutations (S768I, R776H, G779S, T783A, L798H, K806E and L814P) reported in NSCLC responded to gefitinib treatment (Takano et al., 2005; Wu et al., 2008). Literature suggests that the response rate to TKI in NSCLC was, as similar as the response rate in HNSCC (Cohen et al., 2003). Our previous study on G719S and L858R polymorphisms affinity towards qunazoline inhibitors (CI1033, gefitinib and erlotinib) found that G719S was sensitive to CI1033, gefitinib and not to erlotinib (Sabitha & Kaiser, 2006). Further studies on the sensitivity of these EGFR polymorphisms to gefitinib therapy may help in understanding the suitable therapy for HNSCC disease. To the best of our knowledge the present study was conducted on EGFR TK domain mutations with large number of samples of HNSCC (129) for the first time in the south Indian population. The association of mutations with all the possible demographic and clinical parameters of HNSCC were discussed. The limitation of the present study was that the sample size was not power determined but from the

205

literature we understood that our study was conducted in a large sample size of HNSCC.

Conclusion Thus, our study is a step towards the understanding of the role of EGFR polymorphisms with HNSCC. The higher polymorphic frequency of EGFR gene in our study group highlighted the association of mutations with various clinical (advanced stages, tumour grade) and demographic factors [tobacco (chewing and smoking) plus alcohol habits and at 50 or older years] of HNSCC. Late age and tobacco plus alcohol improve the gene susceptibility to mutations that implies the possible association with carcinogenesis. We found that EGFR-TK domain mutations are more specific to HNSCC disease at an advanced stage, which might confer the poor clinical outcome in HNSCC disease. It is concluded that the mutations of TK domain EGFR might serve as molecular biomarker to understand the aggressive tumours and also for risk assessment of HNSCC disease in individuals with severe dysplasia. Further, novel mutations of our study L730V and G824D emphasised on the gene diversity and ethnic differences associated in the occurrence of EGFR polymorphisms among HNSCC. The present study suggests that EGFR gene polymorphism in TK domain may be implicated, at least in part, in the regulation of EGFR expression in head and neck tumours, where TK domain polymorphisms may serve as therapeutic biomarkers to categorise the patients who will be sensitive to the treatment of gefitinib and help in reducing the adverse effects in patients and thereby may improve the survival rates.

Acknowledgements The authors are grateful to all the patients and volunteers who formed the study group and to the oncologists and pathologists who encouraged them in this study. The authors are grateful to SSLS Life Sciences Pvt. Ltd., and Bhagwan Mahavir Medical Research Centre, Hyderabad, A.P., India, for the facilities.

Declaration of interest The authors declare no conflict of interest.

References Agrawal N, Frederick MJ, Pickering CR, et al. (2011). Exome sequencing of head and neck squamous cell carcinoma reveals inactivating mutations in NOTCH1. Science 6046:1154–7. Arau´jo A, Ribeiro R, Azevedo I, et al. (2007). Genetic polymorphisms of the epidermal growth factor and related receptor in non-small cell lung cancer. Oncologist 2:201–10. Basu R, Mandal S, Ghosh A, Poddar TK. (2008). Role of tobacco in the development of head and neck squamous cell carcinoma in an eastern Indian population. Asian Pac J Cancer Prev 9:381–6. Chiu TJ, Chen YJ, Rau KM, et al. (2013). Midkine neurite growthpromoting factor 2 expression as a potential prognostic marker of adjuvant therapy in head and neck squamous cell carcinoma. Biomarkers 18:687–98. Chung CH, Ely K, McGavran L, et al. (2006). Increased epidermal growth factor receptor gene copy number is associated with poor prognosis in head and neck squamous cell carcinomas. J Clin Oncol 24:4170–6. Ciardiello F, Tortora G. (2003). Epidermal growth factor receptor (EGFR) as a target in cancer therapy: understanding the role of

Biomarkers Downloaded from informahealthcare.com by Emory University on 11/02/14 For personal use only.

206

K. Nagalakshmi et al.

receptor expression and other molecular determinants that could influence the response to anti-EGFR drugs. Eur J Cancer 39:1348–54. Cohen EE, Rosen F, Stadler WM, et al. (2003). Phase II trial of ZD1839 in recurrent or metastatic squamous cell carcinoma of the head and neck. J Clin Oncol 21:1980–7. Cortesina G, Martone T. (2006). Molecular metastases markers in head and neck squamous cell carcinoma: review of the literature. Acta Otorhinolaryngol Ital 26:317–25. Denaro N, Lo Nigro C, Natoli G, et al. (2011). The role of p53 and MDM2 in head and neck cancer. ISRN Otolaryngology 2011:article ID 931813, 8 pages. Dibb NJ, Dilworth SM, Mol CD. (2004). Switching on kinases: oncogenic activation of BRAF and the PDGFR family. Nat Rev 4: 718–27. Elahi M, Rakhshan V, Ghasemian NT, Moshref M. (2012). Prognostic value of transforming growth factor beta 1 [TGF-b1] and matrix metalloproteinase 9 [MMP-9] in oral squamous cell carcinoma. Biomarkers 17:21–7. Farnebo L, Jedlinski A, Ansell A, et al. (2009). Proteins and single nucleotide polymorphisms involved in apoptosis, growth control, and DNA repair predict cisplatin sensitivity in head and neck cancer cell lines. Int J Mol Med 4:549–56. Greulich H, Chen TH, Feng W, et al. (2005). Oncogenic transformation by inhibitor-sensitive and -resistant EGFR mutants. PLoS Med 2:313. Hama T, Yuza Y, Saito Y, et al. (2009). Prognostic significance of epidermal growth factor receptor phosphorylation and mutation in head and neck squamous cell carcinoma. Oncologist 14:900–8. Hang L, Yunjian P, Yuan L, et al. (2013). Frequency of well-identified oncogenic driver mutations in lung adenocarcinoma of smokers varies with histological subtypes and graduated smoking dose. Lung Cancer 79:8–13. Harari PM, Allen GW, Bonner JA. (2007). Biology of interactions: anti epidermal growth factor receptor agents. J Clin Oncol 25:4057–65. Hsieh YY, Tzeng CH, Chen MH, et al. (2012). Epidermal growth factor receptor R521K polymorphism shows favorable outcome to cetuximab-based treatment in KRAS wild-type colorectal cancer patients. Cancer Sci 4:791–6. Jorissen RN, Walker F, Pouliot N, et al. (2003). Epidermal growth factor receptor: mechanisms of activation and signalling. Exp Cell Res 284: 31–53. Kaneko K, Kumekawa Y, Makino R, et al. (2010). EGFR gene alterations as a prognostic biomarker in advanced esophageal squamous cell carcinoma. Front Biosci 15:65–72. Krohn V, Wiegand S, Werner JA, Mandic R. (2011). EGFR codon 497 polymorphism – implications for receptor sensitivity to inhibitors in HNSCC cell lines. Anticancer Res 1:59–65. Lee JW, Soung YH, Kim SY, et al. (2005). Somatic mutations of EGFR gene in squamous cell carcinoma of the head and neck. Clin Cancer Res 11:2879–82. Lemos-Gonzalez Y, Paez de la Cadena M, Rodriguez-Berrocal FJ, et al. (2007). Absence of activating mutations in the EGFR kinase domain in Spanish head and neck cancer patients. Tumour Biol 28:273–9. Linardou H, Dahabreh IJ, Bafaloukos D, et al. (2009). Somatic EGFR mutations and efficacy of tyrosine kinase inhibitors in NSCLC. Nature Rev Clin Oncol 6:352–66. Lo HW, Hsu SC, Hung MC. (2006). EGFR signaling pathway in breast cancers: from traditional signal transduction to direct nuclear translocalization. Breast Cancer Res Treat 3:211–18. Loeffler-Ragg J, Witsch-Baumgartner M, Tzankov A, et al. (2006). Low incidence of mutations in EGFR kinase domain in Caucasian patients with head and neck squamous cell carinoma. Eur J Cancer 42: 109–11. Lynch TJ, Bell DW, Sordella R, et al. (2004). Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350:2129–39. Mellon K, Wright C, Kelly P, et al. (1995). Long-term outcome related to epidermal growth factor receptor status in bladder cancer. J Urol 2: 919–25. Miller SA, Dykes DD, Polesky HF. (1988). A simple salting-out procedure for extracting DNA from human nucleated cells. Nucl Acid Res 16:1215.

Biomarkers, 2014; 19(3): 198–206

Na II, Kan HJ, Cho SY, et al. (2007). EGFR mutations and human papillomavirus is squamous cell carcinoma of tongue and tonsil. Eur J Cancer 43:520–6. Nagalakshmi K, Jamil K, Usharani P. (2013). Association of EGFR gene polymorphisms in head and neck cancer patients with tobacco and alcohol consuming habits. Biol Med 5:69–77. Nomura M, Shigematsu H, Li L, et al. (2007). Polymorphisms, mutations, and amplification of the EGFR gene in non-small cell lung cancers. PLoS Med 4:125. Paez JG, Ja¨nne PA, Lee JC, et al. (2004). EGFR mutations in lung cancer: correlation with clinicalresponse to gefitinib therapy. Science 304:1497–500. Pao W, Miller V, Zakowski M, et al. (2004). EGF receptor gene mutations are common in lung cancers from ‘‘never smokers’’ and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 101:13306–11. Rong R, Tull J, Zhang S. (2012). Molecular biomarker profile of EGFR copy number, KRAS and BRAF mutations in colorectal carcinoma. J Solid Tumors 2:27–31. Sabitha K, Kaiser J. (2006). Analysis of EGFR gene mutations which have a response to quinazolin inhibitors. Comparative Evol Genom Proteom 5:229–32. Sabitha K, Reddy MVV, Kaiser J. (2008). GST genotypes in head and neck cancer patients and its clinical implications. Afr J Biotechnol 7: 3853–9. Sabitha K, Reddy MVV, Kaiser J. (2010). Smoking related risk involved in individuals carrying genetic variants of CYP1A1 gene in head and neck cancer. Cancer Epidemiol 34:5587–92. Sahoo R, Harini VV, Babu VC, et al. (2011). Screening for EGFR mutations in lung cancer, a report from India. Lung Cancer 73: 316–19. Sharma SV, Bell DW, Settleman J, Haber DA. (2007). Epidermal growth factor receptor mutations in lung cancer. Nat Rev Cancer 7:169–81. Shigematsu H, Lin L, Takahashi T, et al. (2005). Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst 97:339–46. Sordella R, Bell DW, Haber DA, Settleman J. (2004). Gefitinibsensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways. Science 305:1163–7. Stransky N, Egloff AM, Tward AD, et al. (2011). The mutational landscape of head and neck squamous cell carcinoma. Science 333: 1157–60. Takano T, Ohe Y, Sakamoto H, et al. (2005). Epidermal growth factor receptor gene mutations and increased copy numbers predict gefitinib sensitivity in patients with recurrent non-small-cell lung cancer. J Clin Oncol 23:6829–37. Tanner M, Hollme´n M, Junttila TT, et al. (2005). Amplification of HER2 in gastric carcinoma: association with Topoisomerase II alpha gene amplification, intestinal type, poor prognosis and sensitivity to trastuzumab. Ann Oncol 2:273–8. Temam S, Kawaguchi H, El-Naggar AK, et al. (2007). Epidermal growth factor receptor copy number alterations correlate with poor clinical outcome in patients with head and neck squamous cancer. J Clin Oncol 25:2164–70. Tokumo M, Toyooka S, Kiura K, et al. (2005). The relationship between epidermal growth factor receptor mutations and clinicopathologic features in non-small cell lung cancers. Clin Cancer Res 11:1167–73. Willmore-Payne C, Holden JA, Layfield LJ. (2006). Detection of EGFRand HER2-activating mutations in squamous cell carcinoma involving the head and neck. Modern Pathol 19:634–40. Wu JY, Wu SG, Yang CH, et al. (2008). Lung cancer with EGFR exon 20 mutations is associated with poor gefitinib treatment response. Clin Cancer Res 14:4877–82. Yen C-Y, Huang C-Y, Hou M-F, et al. (2013). Evaluating the performance of fibronectin 1 (FN1), integrin a4b1 (ITGA4), syndecan-2 (SDC2), and glycoprotein CD44 as the potential biomarkers of oral squamous cell carcinoma (OSCC). Biomarkers 18: 63–72. Yoshikawa S, Kukimoto-Niino M, Parker L, et al. (2013). Structural basis for the altered drug sensitivities of non-small cell lung cancerassociated mutants of human epidermal growth factor receptor. Oncogene 32:27–38.