brain research 1639 (2016) 1–12

Available online at www.sciencedirect.com

www.elsevier.com/locate/brainres

Research Report

Up-regulated ephrinB3/EphB3 expression in intractable temporal lobe epilepsy patients and pilocarpine induced experimental epilepsy rat model Hao Huang, Ruohan Li, Jinxian Yuan, Xin Zhou, Xi Liu, Shu Ou, Tao Xu, Yangmei Chenn Department of Neurology, Second Affiliated Hospital of Chongqing Medical University, 74 Lin Jiang Road, Chongqing 400010, China

art i cle i nfo

ab st rac t

Article history:

EphB family receptor tyrosine kinases, in cooperation with cell surface-bound ephrinB

Accepted 21 February 2016

ligands, play a critical role in maintenance of dendritic spine morphogenesis, axons

Available online 27 February 2016

guidance, synaptogenesis, synaptic reorganization and plasticity in the central nervous system (CNS). However, the expression pattern of ephrinB/EphB in intractable temporal

Keywords:

lobe epilepsy (TLE) and the underlying molecular mechanisms during epileptogenesis

EphrinB3

remain poorly understood. Here we investigated the expression pattern and cellular

EphB3

distribution of ephrinB/EphB in intractable TLE patients and lithium chloride-pilocarpine

Temporal lobe epilepsy

induced TLE rats using real-time quantitative polymerase chain reaction (RT-qPCR),

Pilocarpine

immunohistochemistry, double-labeled immunofluorescence and Western blot analysis.

Synaptogenesis

Compared to control groups, ephrinB3 and EphB3 mRNA expression were significantly up-

Synaptic plasticity

regulated in intractable TLE patients and TLE rats, while the mRNA expression trend of ephrinB1/2 and EphB1/2/4/6 in intractable TLE patients and TLE rats were inconsistent. Western blot analysis and semi-quantitative immunohistochemistry confirmed that ephrinB3 and EphB3 protein level were up-regulated in intractable TLE patients and TLE rats. At the same time, double-labeled immunofluorescence indicate that ephrinB3 was expressed mainly in the cytoplasm and protrusions of glia and neurons, while EphB3 was expressed mainly in the cytoplasm of neurons. Taken together, up-regulated expression of ephrinB3/EphB3 in intractable TLE patients and experimental TLE rats suggested that ephrinB3/EphB3 might be involved in the pathogenesis of TLE. & 2016 Elsevier B.V. All rights reserved.

Abbreviations: AEDs, DNA; CNS,

anti-epileptic drugs; AMPA,

central nervous system; DAB,

GPI,

glycosyl phosphatidylinositol; IE,

LiCl,

lithium chloride; MAP2,

RTKs,

α-amino-3-hydroxy-5-methyl-4-isoxazolpropionic acid; cDNA,

3, 3-diaminobenzidine; DAPI, 4, 6-diamidino-2-phenylindole; EEG,

intractable epilepsy; ILAE,

International League Against Epilepsy; i.p.,

microtubule-associated protein 2; OD,

receptor tyrosine kinases; RT-qPCR,

optical density; PBS,

complementary

electroencephalogram; intraperitoneal;

phosphate buffered saline;

real-time quantitative polymerase chain reaction; SABC, Streptomyces protein avidin-

biotin-peroxidase complex; TBS, Tris buffer saline; TBST, n Corresponding author. Fax: þ86 2363693694. E-mail address: [email protected] (Y. Chen). http://dx.doi.org/10.1016/j.brainres.2016.02.035 0006-8993/& 2016 Elsevier B.V. All rights reserved.

Tris buffer saline with Tween-20; TLE,

temporal lobe epilepsy

2

brain research 1639 (2016) 1–12

1. Introduction Epilepsy is a clinical syndrome characterized by recurrent spontaneous seizures, which are caused by abnormal discharges of neurons in the brain with a high degree of synchronization, resulting in transient disturbances of cerebral functions (Engel, 1995). Approximately 65 million people have epilepsy in the world according to International League Against Epilepsy (ILAE)(Thurman et al., 2011), making it one of the most common neurological conditions globally. Although majority of epilepsies can be well-managed with anti-epileptic drugs (AEDs) and have a good prognosis (1997), up to 30% of them still have recurrent seizures and are drugresistant, which will be progressed to intractable epilepsy (IE) (Kwan and Brodie, 2000). However, temporal lobe epilepsy (TLE) accounts for the majority of all kinds of IE, and the pathogenesis of intractable TLE is still poorly understood and remains to be fully clarified. Eph receptors, named for their expression in an erythropoietin-producing human hepatocellular carcinoma cell line, are the largest family of receptor tyrosine kinases (RTKs) (1997; Pasquale, 1997). In the human genome, according to the structural features and ephrin-binding affinity, Ephs receptors are divided into type-A Eph (EphA1-A8, A10) and type-B Eph (EphB1-B4, B6) subclass members, which interact promiscuously with five glycosyl phosphatidylinositol (GPI)-linked cell membrane-bound ephrinAs (ephrinA1A5) ligands and three transmembrane ephrinBs (ephrinB1–B3) ligands, respectively. Of course, some Ephs receptors can also cooperated with the other class ephrins ligands, for example, EphA4 and EphB2 can bind to both the ephrinAs and ephrinBs ligands (Aoto and Chen, 2007; Boyd et al., 2014; Pasquale, 2008). Interacting with cell membrane-bound ephrin ligands of neighboring cells, Eph receptors are activated and play an important role in maintenance of dynamic equilibrium of actin cytoskeleton, cell shape, cell positioning, intercellular junctions, cell–cell or cell-substrate adhesion, also controlling cell movement, cell survival and proliferation (Egea and Klein, 2007; Himanen et al., 2007; Lackmann and Boyd, 2008; Pasquale, 2005). However, in the developing and mature nervous system, Eph receptors and ephrin ligands, as axon guidance molecules, could modulate neurona and synaptic plasticity (Aoto and Chen, 2007). What is more, in cooperation with cell surface-bound ephrinB ligands, EphB receptors could maintain dendritic spine morphogenesis, regulate spine formation and maturation, spine maintenance and plasticity, actin cytoskeleton reorganization, synaptogenesis, synaptic reorganization, synaptic plasticity, and assembly of post-synaptic specializations in the normal and damaged adult brains (Lai and Ip, 2009; Sloniowski and Ethell, 2012), which are closely related with excitatory synaptic connections and the neuropathological changes of TLE patients and epileptic rat models (Arisi and Garcia-Cairasco, 2007; Gardiner and Marc, 2010). Based on the physiological roles of ephrinB/ EphB in the adult brain, it is important to detect the expression of them in TLE patients and TLE rat models and investigate whether they are involved in the pathogenesis of TLE.

The present study was designed to determine the expression pattern and cellular distribution of ephrinB3/EphB3 in intractable TLE patients and lithium chloride-pilocarpine induced TLE rats using Real-time quantitative polymerase chain reaction (RT-qPCR), Western blot analysis, immunohistochemistry and double-labeled immunofluorescence, and to evaluate the role of ephrinB3/EphB3 in the pathophysiology of TLE.

2. Results 2.1. Demographic and clinical characteristics of the human subjects The mean age of the intractable TLE patients consisted of 11 men and 9 women was 23.10711.10 years, whereas the mean age of control group consisted of 7 men and 13 women was 26.90713.59 years. There was no significant difference in gender distribution (Chi-square¼ 1.616, P¼ 0.204) and age (t ¼  1.478, P¼ 0.148) between intractable TLE and control groups.

2.2. The mRNA expression of ephrinBs and EphBs in intractable TLE patients and TLE rats First, we detected the mRNA expression level of ephrinBs and EphBs in the temporal neocortex of patients using RT-qPCR technology. Compared to the control group, ephrinB3 and EphB3 mRNA expression were up-regulated (Po0.05), ephrinB2 and EphB1 mRNA expression were down-regulated in the intractable TLE patients (Po0.05), while the expression of ephrinB1 and EphB2/4/6 mRNA were no significant difference between intractable TLE patients and controls (P40.05) (Fig. 1A and B). However, in the hippocampus of TLE model rats, we found that the expression of ephrinB1/2/3 and EphB2/3/4/6 mRNA were up-regulated (Po0.05), while the EphB1 mRNA expression was no significant difference between model and control groups (P40.05) (Fig. 1C and D).

2.3. Up-regulated ephrinB3 and EphB3 proteins in the temporal neocortex of intractable TLE patients and the hippocampus and cortex of TLE rats Western blot analysis was performed to further verify the ephrinB3 and EphB3 protein expression differences between TLE and control groups. The ephrinB3 and EphB3 protein bands were detected at the predicted size of 45 kD and 110 kD, respectively. β-actin (42 kD) was used for internal control gene. The ephrinB3 and EphB3 protein level were significantly up-regulated in the temporal neocortex of the intractable TLE patients than in the controls (Po0.05) (Fig. 2A– C). In the hippocampus and temporal neocortex of TLE rats, the ephrinB3 and EphB3 protein level were also significantly up-regulated compared to the controls (Po0.05) (Fig. 2D–I). Followed, immunohistochemistry showed that ephrinB3 immunoreactivity was observed in the cytoplasm and protrusions of positive cells (Fig. 3), while the immunoreactivity of EphB3 was observed in the cytoplasm of positive cells (Fig. 4), and they were widely distributed in the temporal

brain research 1639 (2016) 1–12

3

Fig. 1 – EphBs and ephrinBs mRNA level were measured by RT-qPCR, the changes in mRNA expression of TLE patients and TLE rats were expressed as fold changes relative to that of controls, β-actin was used for internal control gene. In temporal neocortex of intractable TLE patients, EphB3 and ephrinB3 mRNA level were up-regulated, EphB1 and ephrinB2 mRNA level were down-regulated, EphB2/4/6 and ephrinB1 mRNA level were no significant difference compared with controls. In hippocampus of TLE rats, EphB2/3/4/6 and ephrinB1/2/3 mRNA level were up-regulated, EphB1 mRNA level was no significant difference compared with controls. (A, B) the mRNA expression of EphB1/2/3/4/6 and ephrinB1/2/3 in temporal neocortex of intractable TLE patients. (C, D) the mRNA expression of EphB1/2/3/4/6 and ephrinB1/2/3 in hippocampus of TLE rats. *Po0.05 versus control.

Fig. 2 – EphB3 and ephrinB3 protein were detected by western blot analysis. The relative optical density values of EphB3 and ephrinB3 protein bands were normalized to that of β-actin. (A) EphB3 and ephrinB3 protein expression in temporal neocortex of intractable TLE patients and controls. (B, C) The respective bar graph shows the EphB3 and ephrinB3 protein level was upregulated in the TLE patients compared with controls (n ¼20 for each group). (D, G) EphB3 and ephrinB3 protein expression in temporal neocortex and hippocampus of TLE rats and controls. (E, F, H, I) The respective bar graph shows the protein level of EphB3 and ephrinB3 was up-regulated in the TLE rats compared with controls (n¼ 5 for each group). *Po0.05 versus control.

neocortex of human brain and in the hippocampus and cortex of rat brain. However, the negative controls, in which the primary antibody had been omitted, showed no positive expression in neurons or glial cells (data not shown). Statistical analysis revealed that the percent of positive cells of ephrinB3 and EphB3 in the temporal neocortex of intractable TLE patients and in the hippocampus and cortex of TLE rats were significantly increased compared with the control

groups, and there were significant differences between the TLE and the control groups (Po0.05) (Figs. 3 and 4 ).

2.4. Localization of ephrinB3 and EphB3 in TLE rats To determine the cellular distribution of ephrinB3 and EphB3, double-labeling immunofluorescence experiments were performed on the hippocampus and cortex of TLE rats. In our

4

brain research 1639 (2016) 1–12

Fig. 3 – ephrinB3 expression was measured by immunohistochemistry. (A, B) The ephrinB3 positive cells in the temporal neocortexes of control and TLE patients. (C) The bar graph shows the percent of ephrinB3 positive cells was increased in the TLE patients compared with controls (n ¼20 for each group). (D, E, G, H) The ephrinB3 positive cells in the cortexes and hippocampal CA1 region of control and TLE rats. (F, I) The respective bar graph shows the percent of ephrinB3 positive cells was increased in the cortexes and hippocampal CA1 region of TLE rats compared with controls (n¼ 5 for each group). *Po0.05 versus control. The red and black arrows indicate two different morphology of ephrinB3 positive cells.

results, ephrinB3 was colocalized with the neuron dendritic marker microtubule-associated protein 2 (MAP2) and the astrocyte marker GFAP (Fig. 5). However, EphB3 was only colocalized with NeuN, a marker of mature neurons, not coexpressed with GFAP (Fig. 6).

3. Discussion Eph receptors, the largest subfamily of receptor tyrosine kinases (RTKs), bind with cell surface-bound ephrin ligands of neighboring cells, which could establish close links between the cells expressed receptors or ligands and induce bidirectional signals, including ephrin-induced Eph receptor activation (forward signaling) and Eph-induced ephrin ligands activation (reverse signaling)(Aoto and Chen, 2007). Recent studies demonstrate that ephrins ligands and Eph receptors were widely distributed in the CNS and their important significance in the development, maturation and function maintenance of the CNS during various stages of

embryonic to adult (Aoto and Chen, 2007; Bellot et al., 2014; Klein, 2009; Kullander et al., 2003). EphB forward signaling involved in the excitatory synaptogenesis and synaptic plasticity of dendritic spines by regulating the remodeling of actin cytoskeleton (Klein, 2009; Pasquale, 2008), ephrinB reverse signaling also influence the long-term synaptic plasticity through modulating α-amino-3-hydroxy-5-methyl-4-isoxazolpropionic acid (AMPA)-type glutamate receptors (Gauthier and Robbins, 2003), while the excitatory synaptogenesis, synaptic plasticity, dendritic spines morphology changes and actin cytoskeleton remodeling are closely related to the pathogenesis of epilepsy (Arisi and GarciaCairasco, 2007; Gardiner and Marc, 2010). So, the interaction of EphB receptors and ephrinB ligands may be associated with epileptogenesis. In the present study, we first detected the mRNA expression of EphBs and ephrinBs in the brain samples of intractable TLE patients and TLE rats. Interestingly, we observed that ephrinB3 and EphB3 mRNA expression were consistent and significantly up-regulated in the intractable TLE patients

brain research 1639 (2016) 1–12

5

Fig. 4 – EphB3 expression was measured by immunohistochemistry. (A, B) The EphB3 positive neurons in the temporal neocortexes of control and TLE patients. (C) The bar graph shows the percent of EphB3 positive neurons was increased in the TLE patients compared with controls (n ¼ 20 for each group). (D, E, G, H) The EphB3 positive neurons in the cortexes and hippocampal CA1 region of control and TLE rats. (F, I) The respective bar graph shows the percent of EphB3 positive neurons was increased in the cortexes and hippocampal CA1 region of TLE rats compared with controls (n ¼5 for each group). *Po0.05 versus control. The black arrows indicate EphB3 positive neurons.

and TLE rats, while the mRNA expression trend of ephrinB1/2 and EphB1/2/4/6 in the intractable TLE patients and TLE rats were inconsistent. Considering the important roles of EphBs and ephrinBs in the synaptogenesis and synaptic plasticity (Aoto and Chen, 2007; Gauthier and Robbins, 2003; Klein, 2009), we speculate that the abnormal mRNA expression of ephrinBs and EphBs may participate in the pathogenesis of TLE. Followed, we confirmed that the ephrinB3 and EphB3 protein level were also up-regulated in the TLE patients and TLE rats by Western blot analysis and immunohistochemistry. Previous study shows that ephrinB3 is required and plays an important role on synaptic function, and postsynaptic ephrinB3 transduces reverse signals into developing dendrites of murine hippocampal neurons and shapes dendrites and spines through recruiting Grb4 and Pick1/syntenin, which are necessary for the early development of synaptic structures (Xu et al., 2011). Moreover, a recent research demonstrates that ephrin-B3 recruits and stabilizes PSD-95 at excitatory synapses by direct interaction and changes in neuronal activity (Hruska et al., 2015). Also, activation of the

EphB receptor could induce translocation of the Rho-GEF kalirin to synapses and activate downstream effector molecules, such as Rac1 and PAK-1, which are critical for the modulation of the actin cytoskeleton and shaping spine morphogenesis during development and plasticity (Penzes et al., 2003). Besides, EphB3, as axon guidance molecule, could mediate the early development of neuronal connectivity and modulate specific aspects of axon regrowth and plasticity after CNS injury (Liu et al., 2006). What is more, in the previous studies, EphB3 is implicated in neuronal fate of traumatic brain injury, it could mediate cell death in the injured adult cortex through a novel dependence receptormediated cell death mechanism, cleavaged by caspase or caspase-like molecules in intracellular, but which is attenuated following ephrinB3 stimulation (Theus et al., 2014). Also, it could induce cell death through suppress neural stem progenitor cells proliferation in a p53-dependent manner in the absence of ephrinB3 stimulation (Theus et al., 2010). In addition, ephrin-B3, interacting with EphB receptors, can induce the excitatory synaptogenesis in cocultured neurons

6

brain research 1639 (2016) 1–12

Fig. 5 – Double-labeled immunofluorescence staining shows ephrinB3-positive cells in the temporal neocortexes and hippocampal CA1 region of epileptic rats. ephrinB3 (red) was co-expressed with MAP2-positive neurons (green) and GFAPpositive astrocytes (green), but did not DAPI-positive nuclei (blue) in the temporal neocortexes (A, B) and in the hippocampal CA1 region (C, D). These findings indicate that ephrinB3 was simultaneously expressed in the cytoplasm and protrusions of neurons and glia. White arrows: ephrinB3-positive cells co-expressed with MAP2; arrowheads: ephrinB3-positive cells coexpressed with GFAP. Scale bar¼ 50 μm.

or separate cultured hippocampal neurons (Aoto et al., 2007),

2009; Theus et al., 2014), and they may serve as potential

while the neuron death and excitatory synaptogenesis were major neuropathological changes of TLE (Scharfman and

biomarkers for predicting TLE. Of course, in the complex neural networks composed by

Gray, 2007; Wang et al., 2008). Therefore, up-regulated

neurons and glial cells, Eph forward and ephrin reverse

ephrinB3 and EphB3 expression in intractable TLE patients

signaling also plays critical role in the intercellular commu-

and experimental TLE rats may be related to the synaptogen-

nications, not only between neurons but also between neu-

esis, synaptic plasticity regulation and neuronal death

rons and glial cells (Yamaguchi and Pasquale, 2004). In the

induced by the Eph forward or ephrin reverse signaling

current study, double-labeled immunofluorescence revealed

(Aoto and Chen, 2007; Gauthier and Robbins, 2003; Klein,

that ephrinB3 was expressed mainly in the cytoplasm and

brain research 1639 (2016) 1–12

7

Fig. 6 – Double-labeled immunofluorescence staining shows EphB3-positive cells in the temporal neocortexes and hippocampal CA1 region of epileptic rats. EphB3 (red) was co-expressed with NeuN-positive neurons (green), did not colocalize with GFAP-positive astrocytes (green) or DAPI-positive nuclei (blue) in the temporal neocortexes (A, B) and in the hippocampal CA1 region (C, D). These findings indicate that EphB3 was expressed mainly in the cytoplasm of neurons. White arrows: EphB3 positive cells; arrowheads: NeuN or GFAP positive cells. Scale bar¼ 100 μm.

protrusions of glia and neurons, and EphB3 was expressed mainly in the cytoplasm of neurons, which were consistent with findings that glia were the major sources of ephrinB3 ligand while EphB3 receptor was present on MAP-2 expressing neurons (Duffy et al., 2012; Theus et al., 2010; Theus et al., 2014). These data demonstrated that the interaction of ephrinB3 and EphB3 between neurons or between neurons and glial cells might regulate synaptogenesis, synaptic plasticity, neuronal death and abnormal neural network, which would be proepileptic roles in the development of TLE, and thus participate in the pathogenesis of epilepsy.

In conclusion, for the first time, we observed that the abnormal expression of ephrinB3 and EphB3 expression in the intractable TLE patients and TLE rats. These results indicate that up-regulated ephrinB3 and EphB3 might be involved in the pathogenesis of epilepsy by regulating synaptogenesis, synaptic plasticity, neuronal fate and neural network, and they may serve as potential biomarkers for predicting TLE. However, the exact pathophysiological mechanism through which Eph forward or ephrin reverse signaling participates in the epileptogenesis is still unclear, and warrants further studies in the future.

8

brain research 1639 (2016) 1–12

4. Experimental procedures 4.1. Human subjects In human subjects experiments, the research was performed according to the Code of Ethics (Declaration of Helsinki) of the World Medical Association and the ethical principles and guidelines of the National Institutes of Health, as well as approved by the Ethics Committee of Chongqing Medical University, China. Prior to surgery, all patients or their guardians were informed and the informed consents were obtained for the surgery treatment and the use of brain tissues in the research. Twenty intractable TLE temporal neocortex samples and control twenty histologically normal temporal neocortex samples were selected randomly from Xinqiao Hospital of the Third Military University, China. The diagnostic criteria for intractable TLE was based on the 1981 International Classification of Epilepsy Seizures of ILAE, the patients had typical clinical presentations and characteristic electroencephalograms (EEGs). At the same time, they were refractory to the combination therapy composed by maximal doses of three or more AEDs, including phenytoin, phenobarbital, carbamazepine, gabapentin, lamotrigine, valproic acid, topiramate, oxcarbazepine, and clonazepam. According to previous study (Huang et al., 2015b), patients were underwent a series of pre-surgical evaluation to determine the epileptic lesion before surgery, such as a detailed past medical history and neurological examination, neuroimaging studies, interictal and ictal EEG monitoring, and neuropsychological tests. Furthermore, any other nervous system diseases and progressive lesions in the CNS were excluded. Post-operative examinations revealed the

epileptic lesion was resected completely, no abnormal EEG, and pathological examinations showed neuronal loss, gliosis and neuronal degeneration. Table 1 summarizes the clinical features of the intractable TLE patients. Control temporal neocortex samples were obtained from severe brain trauma patients who must require surgery and no seizures after the trauma, no history of epilepsy, no exposure to AEDs and other neurologic disorders, neuropathology examinations revealed that all resected brain tissues were normal. The clinical features of the control patients are shown in Table 2.

4.2. An experimental rat model of TLE Adult male Sprague–Dawley rats (8 weeks old and weighing 180-220 g) were obtained from the Experimental Animal Center of Chongqing Medical University and were randomly divided into control group and model group (n ¼11 per group). All rats were raised in a controlled standard room (27 1C, 50– 60% humidity, and 12 h light/12 h dark cycle) and free access to food and water. The animal experimental procedures were performed according to the guidelines of the Ethical Commission and the Animal Care Committee of Chongqing Medical University, China. TLE model rats were given an intraperitoneal (i.p.) injection of lithium chloride (LiCl, 127 mg/kg, Sigma-Aldrich, St. Louis, MO, USA), followed with an i.p. injection of pilocarpine (50 mg/kg, Sigma-Aldrich) 20 hours later. The rats received an i.p. injection of 1 mg/kg atropine methyl nitrate 30 min before the administration of pilocarpine to reduce its peripheral cholinomimetic effects. The rats received an i.p. injection of 10 mg/kg diazepam to terminate convulsions 1 hour after LiCl/pilocarpine-induced seizures. If the rats did not develop seizures, they were injected with

Table 1 – Clinical features of the TLE patients. No.

Sex

Age (years)

Onset(years)

Duration (years)

Seizure type

AEDs

Resected tissue

Pathology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

M F M M M F F M M F M F F M M F F M F M

22 14 39 48 29 5 9 27 29 25 13 35 22 17 21 4 18 31 27 23

14 3 32 24 25 3 5 23 13 17 6 18 11 8 9 2 12 23 22 17

8 11 7 20 4 2 4 4 16 8 7 17 11 9 12 2 6 8 5 6

SPS, SGS GTCS SPS, SGS CPS CPS, SGS CPS CPS, SGS CPS SPS,SGS GTCS SGS SPS,SGS CGS, SGS CPS SPS CPS CPS, SGS CPS SGS SPS, SGS

CBZ, VPA, PB OXC,VPA, PHT CBZ, PHT, VPA CBZ, PHT, VPA, CBL CBZ, VPA, CBL OXC, CBL, VPA, TMP OXC, VPA, GBP CBZ, VPA, PHT CBZ, VPA, TPM VPA, CBZ, PHT OXC, PHT, VPA CBZ, VPA, CBL, TPM OXC, VPA, TPM OXC, VPA, PHT CBZ, PHT, VPA, TMP OXC, PHT, TMP OXC, VPA, LTG CBZ, PHT, LTG CBZ, PHT, LTG, CBL CBZ, PHT, TMP

TNL TNR TNR TNR TNL TNL TNR TNL TNR TNL TNR TNL TNR TNL TNR TNL TNL TNR TNL TNR

g, g, g, g, g, g g, g, g, g, g, g, g, g, g, g g, g, g, g,

nl, nl, nl, nl, nl nl nl nl, nl nl, nl, nl, nl, nl

nd nd nd nd

nd nd nd nd nd

nl nl, nd nl nl

Sex: F, female; M, male. Seizure type: CPS, complex partial seizure; GTCS, generalized tonic-clonic seizure; SGS, secondarily generalized seizure; SPS, simplex partial seizure. AEDs, anti-epileptic drugs: CBZ, carbamazepine; CLB, clonazepam; GBP,gabapentin; LTG,lamotrigine; OXC, oxcarbazepine; PB, phenobarbital; PHT, phenytoin; TPM, topiramate; VPA, valproic acid. Resected tissue: TNL, left temporal neocortex; TNR, right temporal neocortex. Pathology: nl, neuronal loss; nd, neuronal degeneration; g, gliosis.

brain research 1639 (2016) 1–12

Table 2 – Clinical features of the 20 patients in the control group. Sex Age (years)

Etiology diagnosis

Resected tissue

Seizure Adjacent tissue pathology

M F F M M F F F F M F F M F M F F F M F

Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma

TNR TNL TNR TNR TNL TNR TNL TNL TNL TN TNR TN TNL TN TNL TNL TNL TN TNR TN

None None None None None None None None None None None None None None None None None None None None

49 22 31 17 23 21 18 49 15 51 31 24 28 11 15 14 46 52 33 28

Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal Normal

Sex: F, female; M, male. Resected tissue: TNL, left temporal neocortex; TNR, right temporal neocortex.

pilocarpine (10 mg/kg, i.p.) every 30 min until the appearance of seizures. According to Racine’s standard criteria (Racine, 1972), the rats in stages 4 and 5 were considered successfully kindled in the acute period and were included in the study. Followed, spontaneous recurrent seizures of the model rats in chronic period were monitored by a video recording system (12 h/day, for 5 days), and the rats with spontaneous seizures were also included in the study. The control rats were subjected to an i.p. injection of an equal volume of saline, instead of pilocarpine. The rats were sacrificed at 60 days after modeling, and the brain tissues were removed immediately.

4.3. Tissue processing All human brain tissues were divided into two portions, one portion was immediately stored in liquid nitrogen for subsequent Western blot analysis and RT-qPCR, the other portion was fixed in 4% paraformaldehyde for 24 h and then was embedded in paraffin. All rats were sacrificed by decapitation after the i.p. administration of Hydrated Chloral (3.5 mg/kg, Zhongshan Golden Bridge, Inc. Beijing, China) at 60 days after modeling. The bilateral hippocampus and temporal neocortex of half the rats (n¼ 5 for each group) were dissected from the brain and stored in liquid nitrogen for subsequent Western blot analysis and RT-qPCR. Another ten rats (n ¼5 for each group) were anesthetized and perfused with 100 ml saline and 4% paraformaldehyde consecutively. Followed, the brains were removed and fixed in 4% paraformaldehyde for 24 h and then were embedded in paraffin. All paraffinembedded human and rat tissues were sectioned as 5-μm thick paraffin slices, which were laid out on polylysine-coated

9

slides and stored at 41C for subsequent use in immunohistochemistry. The remaining two rats (n ¼1 for each group) were anesthetized and perfused with 4% paraformaldehyde after saline irrigation, and the brains were dissected and fixed in 4% paraformaldehyde for 24 h, then were respectively put in 20% and 30% graded sucrose solution for 48 h. Followed, the brains were sliced into 10-μm thick sections on a freezing microtome, mounted on polylysine-coated slides, and stored at  20 1C for double-labeled immunofluorescence.

4.4. Real-time quantitative polymerase chain reaction (RTqPCR) The total RNA of human brain and rat hippocampus tissues was extracted by Trizol reagent (Beyotime, Haimen, China) according to the manufacturer’s protocol. The concentration and purity of RNA were measured with the biophotometer and the RNA samples were considered to be qualified for reverse transcription when the A260/A280 ratio was between 1.8 and 2.0. The RNA (1 μg) eliminated genomic DNA was reverse transcripted into complementary DNA (cDNA) using the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). The reaction conditions of reverse transcription including 37 1C for 15 min and 85 1C for 5 s. Primers were designed and synthesized by Sangon Biotech (Shanghai, China), β-actin was used for internal control gene, the sequences and product size for each target gene were listed in Table 3. cDNA was amplified on Bio-Rad CFX96 Real Time System (Bio-Rad, Hercules, CA, USA) with SYBRs Premix Ex Taq™ II (Takara) according to the manufacturer's instructions. The thermal cycling conditions of RT-qPCR were as follows: initial denaturation for 30 s at 95 1C, followed by 40 cycles of 95 1C for 5 s, and 60 1C for 30 s, and a final melting curve analysis from 65.0 to 95.0 1C (increment 0.5 1C for 5 s). After the reaction was completed, checking the amplification and melting curves and the relative gene expression level was calculated using the comparative CT method (Schmittgen and Livak, 2008).

4.5. Western blot analysis Total protein was isolated from brain tissues using a whole protein extraction kit (Beyotime). The protein concentration was measured by the Enhanced Bicinchoninic Acid Protein Assay Kit (Beyotime). Equal amounts (50 μg per lane) of protein were loaded and separated by 10% SDSpolyacrylamide gel electrophoresis (90 V, 30 min followed 120 V, 60 min), and then electrotransferred to polyvinylidene fluoride membranes (210 mA, 60–120 min, Millipore Corp, Massachusetts, USA). The membranes were blocked with a buffer containing 5% bovine serum albumin in Tris buffer saline (TBS) with Tween-20 (TBST) at room temperature for 1 h and incubated with primary polyclonal rabbit anti-EphB3 antibody (1:500, Abcam), or primary polyclonal rabbit anti-βactin antibody (1:1000, Santa Cruz) at 4 1C overnight. After being washed with TBST four times (5 min each time), the membranes were incubated with a horseradish peroxidaseconjugated secondary antibody (goat anti rabbit IgG-HRP, 1:3000, Zhongshan Golden Bridge, Inc.) for 60 min at room temperature. The same process was performed with the

10

brain research 1639 (2016) 1–12

Table 3 – Target gene-specific primers used for the RTqPCR. Target gene (species)

Primer sequence (50 –30 )

Product size (bp)

EphB1 (Homo sapiens) EphB2 (Homo sapiens) EphB3 (Homo sapiens) EphB4 (Homo sapiens) EphB6 (Homo sapiens) ephrinB1 (Homo sapiens) ephrinB2 (Homo sapiens) ephrinB3 (Homo sapiens) β-Actin (Homo sapiens) EphB1 (Rattus norvegicus) EphB2 (Rattus norvegicus) EphB3 (Rattus norvegicus) EphB4 (Rattus norvegicus) EphB6 (Rattus norvegicus) ephrinB1 (Rattus norvegicus) ephrinB2 (Rattus norvegicus) ephrinB3 (Rattus norvegicus) β-Actin (Rattus norvegicus)

F: CCTCCCTAATGTCCCAGGAT R: CCTCAGACCAGAAGGCTGAC F: AGCATTACCCTGTCGTGGTC R: TTTATGGCTGTGGCGTTGTA F: CGGTCCCAGATTACACAACC R: CCAATACGGAGCAGGTCTTC F: AGGAACATCACAGCCAGACC R: ACCACAATGACCACCAGGAC F: GGACCTGCTCTTCAATGTCG R: CCCACTAACACTCGGCTCTC F: GGCTGGACACTGATGGACA R: TGATGATAGCGGACAAGCAG

101 110 148 115 147 102

F: ACTTTGGTTTATGCGGTGCT R: AGGTCTGCCGTATGTGCTTC

108

F: GGTGTTGCCTCAGTTTCCTC R: GACCTCTGGTGGACAAAGCA

113

F: CCTGGCACCCAGCACAAT R: GGGCCGGACTCGTCATAC F: AGATCGTCAACACCCTGGAC R: AGTCTGGGATAGAGCGGTCA F: GAAGCCGAGTACCAGACCAG R: CATACGATGGCAATGACGAC F: GCTGAGTTTGAGACCACGAG R: GCAGACAAGAGCAATGACCA F: GTCAGTTCGAGCATCCCAAC R: GTCTAGGGCTCCATTCTCCA F: TCACAAGGAGCCCAGCAGT R: AGCCCACCAACTAACACTCG F: ACTACTCAAGCTCCGCAAGC R: AGTGCCCGCTGTACCACTAC

144

F: CCTTATTCGCAGGGATTGC R: CGTGTGCTGTGGAGAGTGTT

116

F: AGTGCCTTCGTCCAGAACAG R: CCACAGGGTAAGAACCATCC

135

F: ACGGTCAGGTCATCACTATCG R: GGCATTAGAGGTCTTTACGGATG

156

111 107 132 101 108 109

F, forward; R: reverse.

primary polyclonal rabbit anti-ephrinB3 antibody (1:500, Abcam). A chemiluminescent substrate (Beyotime) was used to visualize immunoreactive protein bands. Then the immunoreactive bands were visualized using a LICOR Odyssey Infrared Imaging System (LICOR Bioscience, Nebraska, USA), according to the manufacturer’s protocol. The relative optical density (OD) values of each protein band were quantified using LICOR Odyssey software V3.0. Then the OD values of ephrinB3 and EphB3 were normalized to that of β-actin.

4.6. Immunohistochemistry Streptomyces protein avidin-biotin-peroxidase complex (SABC) assay was used for immunohistochemistry analysis

as previously described (Huang et al., 2015a). The paraffin sections were deparaffinized in xylene, dehydrated in a graded series of ethanol, and incubated in 0.3% H2O2 for 15 min to block the activity of endogenous peroxide. Then the sections were heated in a microwave oven at 98 1C for 15 min in citrate buffer sodium (0.01 M, pH 6.0) for antigen retrieval, and were blocked in 10% normal goat serum (Zhongshan Golden Bridge, Inc.) for 60 min at 37 1C. After blocking, the sections were incubated overnight at 4 1C with primary polyclonal rabbit anti-ephrinB3 antibody (1:100, Abcam, USA). Next, after sufficiently washing with phosphate buffered saline (PBS), the sections were incubated at 37 1C for 25 min with goat anti-rabbit secondary antibody (Zhongshan Golden Bridge, Inc.), followed by treatment with avidinbiotin-peroxidase complex (Zhongshan Golden Bridge Inc.) at 37 1C for 30 min, and further extensive washing with PBS. Immunoreactivity was observed with 3,3-diaminobenzidine (DAB, Zhongshan Golden Bridge, Inc.). Counterstaining was applied with Harris hematoxylin. The same process was performed with the primary polyclonal rabbit anti-EphB3 antibody (1:150, Abcam). Negative controls were obtained by application of PBS, instead of the primary antibody. Digital images were obtained from random points on every section using a LEICA DM6000B automatic microscope (Leica, Germany). Cells with buffy staining in the cytoplasm were defined as positive for ephrinB3 and EphB3. Ten visual fields of every section were chosen randomly under the microscope, and the percentage of ephrinB3 and EphB3 positive cells were analyzed by two investigators who were blinded to the studies.

4.7. Double-labeled immunofluorescence Frozen sections were dried at room temperature for 10 min and immersed in acetone for 20 min. After washed with PBS three times (5 min per time), antigen retrieval was performed using microwave heating with 10 mmol/l sodium citrate buffer (pH 6.0). Then, the sections were permeabilized with 0.3% Triton X-100 for 15 min at 37 1C and blocked in 10% normal goat serum for 60 min at 37 1C. Followed, the sections were incubated in a mixture of polyclonal rabbit antiephrinB3 antibody (1:25, Abcam), mouse anti-MAP2 antibody (1:25, Abcam), or mouse anti-GFAP antibody (1:200; Cell Signaling Technology, Beverly, MA, USA), and a mixture of polyclonal rabbit anti-EphB3 antibody (1:50, Abcam), mouse anti-Neun antibody (1:50, Merck Millipore, Germany), or mouse anti-GFAP antibody (1:200; Cell Signaling Technology) overnight at 4 1C. On the following day, after sufficiently washing with PBS, the sections were incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (1:200; Zhongshan Golden Bridge, Inc.) and DyLight 549Affinipure goat anti-rabbit IgG (1:200, EarthOx, Millbrae, CA, USA) for 90 min at 37 1C in the dark, then incubated in 4,6diamidino-2-phenylindole (DAPI Beyotime) at 37 1C for 8 min. Finally, the sections were extensive washed with PBS (4  5 min) and mounted with 50% glycerol. Fluorescence was detected with a laser scanning confocal microscope (Leica Microsystems, Wetzlar, Germany).

brain research 1639 (2016) 1–12

4.8. Statistical analyses All statistical analyses were performed with the SPSS 13.0 software package. All data are expressed as mean7standard deviation (SD). Chi-square test and Student's t-test were used for comparisons between intractable TLE patients and controls. Student's t-test was used for comparisons between model rats and controls. A P value of less than 0.05 was considered significant.

Conflict of interest The authors declare that they have no conflict of interests regarding the publication of this study.

Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (Nos. 81171225 and 81571259). The authors sincerely thank the Xinqiao Hospital of The Third Military Medical University for supplying the brain tissues used in this study, the patients and their families for their participation in this study, and the National Board of the Medical Affairs and the local ethics committee.

r e f e r e n c e s

Aoto, J., Chen, L., 2007. Bidirectional ephrin/Eph signaling in synaptic functions. Brain Res. 1184, 72–80. Aoto, J., Ting, P., Maghsoodi, B., Xu, N., Henkemeyer, M., Chen, L., 2007. Postsynaptic ephrinB3 promotes shaft glutamatergic synapse formation. J. Neurosci. 27, 7508–7519. Arisi, G.M., Garcia-Cairasco, N., 2007. Doublecortin-positive newly born granule cells of hippocampus have abnormal apical dendritic morphology in the pilocarpine model of temporal lobe epilepsy. Brain Res. 1165, 126–134. Bellot, A., Guivernau, B., Tajes, M., Bosch-Morato, M., VallsComamala, V., Munoz, F.J., 2014. The structure and function of actin cytoskeleton in mature glutamatergic dendritic spines. Brain Res. 1573, 1–16. Boyd, A.W., Bartlett, P.F., Lackmann, M., 2014. Therapeutic targeting of EPH receptors and their ligands. Nat. Rev. Drug Discov. 13, 39–62. Duffy, P., Wang, X., Siegel, C.S., Tu, N., Henkemeyer, M., Cafferty, W.B., Strittmatter, S.M., 2012. Myelin-derived ephrinB3 restricts axonal regeneration and recovery after adult CNS injury. Proc. Natl. Acad. Sci. USA 109, 5063–5068. Egea, J., Klein, R., 2007. Bidirectional Eph-ephrin signaling during axon guidance. Trends Cell Biol. 17, 230–238. Engel Jr., J., 1995. Concepts of epilepsy. Epilepsia 36 (Suppl. 1), S23–S29. Eph Nomenclature Committee, 1997. Unified nomenclature for Eph family receptors and their ligands, the ephrins. Cell 90, 403–404. Gardiner, J., Marc, J., 2010. Disruption of normal cytoskeletal dynamics may play a key role in the pathogenesis of epilepsy. Neuroscientist 16, 28–39. Gauthier, L.R., Robbins, S.M., 2003. Ephrin signaling: one raft to rule them all? One raft to sort them? One raft to spread their call and in signaling bind them? Life Sci. 74, 207–216.

11

Himanen, J.P., Saha, N., Nikolov, D.B., 2007. Cell-cell signaling via Eph receptors and ephrins. Curr. Opin. Cell Biol. 19, 534–542. Hruska, M., Henderson, N.T., Xia, N.L., Le Marchand, S.J., Dalva, M. B., 2015. Anchoring and synaptic stability of PSD-95 is driven by ephrin-B3. Nat. Neurosci. 18, 1594–1605. Huang, H., Chen, Y.M., Zhu, F., Tang, S.T., Xiao, J.D., Li, L.L., Lin, X. J., 2015a. Down-regulated Na(þ)/K(þ)-ATPase activity in ischemic penumbra after focal cerebral ischemia/reperfusion in rats. Int. J Clin. Exp. Pathol. 8, 12708–12717. Huang, H., Wang, H., Yuan, J., Wu, X., Huang, Y., Zhou, X., Chen, Y., 2015b. Protein expression of phospho-lim kinase-1 in patients and an experimental rat model with intractable temporal lobe epilepsy. Int. J. Clin. Exp. Med. 8, 625–633. International League Against Epilepsy, 1997a. ILAE Commission Report. The epidemiology of the epilepsies: future directions. Epilepsia 38, 614–618. Klein, R., 2009. Bidirectional modulation of synaptic functions by Eph/ephrin signaling. Nat. Neurosci. 12, 15–20. Kullander, K., Butt, S.J., Lebret, J.M., Lundfald, L., Restrepo, C.E., Rydstrom, A., Klein, R., Kiehn, O., 2003. Role of EphA4 and EphrinB3 in local neuronal circuits that control walking. Science 299, 1889–1892. Kwan, P., Brodie, M.J., 2000. Early identification of refractory epilepsy. N. Engl. J. Med. 342, 314–319. Lackmann, M., Boyd, A.W., 2008. Eph, a protein family coming of age: more confusion, insight, or complexity? Sci. Signal., 1 re2. Lai, K.O., Ip, N.Y., 2009. Synapse development and plasticity: roles of ephrin/Eph receptor signaling. Curr. Opin. Neurobiol. 19, 275–283. Liu, X., Hawkes, E., Ishimaru, T., Tran, T., Sretavan, D.W., 2006. EphB3: an endogenous mediator of adult axonal plasticity and regrowth after CNS injury. J Neurosci. 26, 3087–3101. Pasquale, E.B., 1997. The Eph family of receptors. Curr. Opin. Cell Biol. 9, 608–615. Pasquale, E.B., 2005. Eph receptor signalling casts a wide net on cell behaviour. Nat. Rev. Mol. Cell Biol. 6, 462–475. Pasquale, E.B., 2008. Eph-ephrin bidirectional signaling in physiology and disease. Cell 133, 38–52. Penzes, P., Beeser, A., Chernoff, J., Schiller, M.R., Eipper, B.A., Mains, R.E., Huganir, R.L., 2003. Rapid induction of dendritic spine morphogenesis by trans-synaptic ephrinB-EphB receptor activation of the Rho-GEF kalirin. Neuron 37, 263–274. Racine, R.J., 1972. Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalogr. Clin. Neurophysiol. 32, 281–294. Scharfman, H.E., Gray, W.P., 2007. Relevance of seizure-induced neurogenesis in animal models of epilepsy to the etiology of temporal lobe epilepsy. Epilepsia 48 (Suppl. 2), S33–S41. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108. Sloniowski, S., Ethell, I.M., 2012. Looking forward to EphB signaling in synapses. Semin. Cell Dev. Biol. 23, 75–82. Theus, M.H., Ricard, J., Bethea, J.R., Liebl, D.J., 2010. EphB3 limits the expansion of neural progenitor cells in the subventricular zone by regulating p53 during homeostasis and following traumatic brain injury. Stem Cells 28, 1231–1242. Theus, M.H., Ricard, J., Glass, S.J., Travieso, L.G., Liebl, D.J., 2014. EphrinB3 blocks EphB3 dependence receptor functions to prevent cell death following traumatic brain injury. Cell Death Dis. 5, e1207. Thurman, D.J., Beghi, E., Begley, C.E., Berg, A.T., Buchhalter, J.R., Ding, D., Hesdorffer, D.C., Hauser, W.A., Kazis, L., Kobau, R., Kroner, B., Labiner, D., Liow, K., Logroscino, G., Medina, M.T., Newton, C.R., Parko, K., Paschal, A., Preux, P.M., Sander, J.W.,

12

brain research 1639 (2016) 1–12

Selassie, E.B., Theodore, W., Tomson, T., Wiebe, S., 2011. Standards for epidemiologic studies and surveillance of epilepsy. Epilepsia 52 (Suppl. 7), S2–S26. Wang, L., Liu, Y.H., Huang, Y.G., Chen, L.W., 2008. Time-course of neuronal death in the mouse pilocarpine model of chronic epilepsy using Fluoro-Jade C staining. Brain Res. 1241, 157–167.

Xu, N.J., Sun, S., Gibson, J.R., Henkemeyer, M., 2011. A dual shaping mechanism for postsynaptic ephrin-B3 as a receptor that sculpts dendrites and synapses. Nat. Neurosci. 14, 1421–1429. Yamaguchi, Y., Pasquale, E.B., 2004. Eph receptors in the adult brain. Curr. Opin. Neurobiol. 14, 288–296.