Article pubs.acs.org/ac

Enzyme Linked Aptamer Assay: Based on a Competition Format for Sensitive Detection of Antibodies to Mycoplasma bovis in Serum Ping Fu,†,§ Zhenhong Sun,†,§ Ziqiang Yu,† Yuewei Zhang,† Junjun Shen,† Haiyan Zhang,† Wei Xu,† Fei Jiang,† Huiling Chen,‡ and Wenxue Wu*,† †

Key Laboratory of Animal Epidemiology and Zoonosis, Ministry of Agriculture, College of Veterinary Medicine, China Agricultural University, Beijing, P. R. China ‡ Beijing General Station of Animal Husbandry and Veterinary Service, Beijing, P. R. China ABSTRACT: Mycoplasma bovis (M. bovis) is a major, but often overlooked, pathogen that causes respiratory disease, mastitis, and arthritis in cattle. It has been widespread in China since 2008. In this study, single-stranded DNA (ssDNA) aptamers with high affinity and specificity against the P48 protein of M. bovis were selected using microplates as the matrix. Of nine candidates, aptamer WKB-14 showed the best affinity in an indirect enzyme-linked aptamer assay (ELAA) and good specificity by dot blotting. To the best of our knowledge, this is the first time that an aptamer has been used in a competitive ELAA for the serological detection of M. bovis. The percent inhibition (PI) cutoff value of the indirect competitive ELAA (ic-ELAA) was 40%, assessed using 20 negative sera. In a comparative study of different detection methods, ic-ELAA with dc-ELISA and dot blotting had a higher positive detection rate than the other two commercial indirect ELISA kits.

A

situ hybridization and immunohistochemistry,8 and antibody detection methods such as indirect hemeagglutination, film inhibition, and indirect ELISA.9 Aptamers are single-stranded DNA or RNA oligonucleotides isolated during an in vitro selection process called systematic evolution of ligands by exponential enrichment (SELEX), which was first reported in 1990.10 Numerous high-affinity and highly specific aptamers have been generated against a wide variety of target molecules including small organics, peptides, proteins, and even complex targets such as whole cells.11 With the ability to fold into different three-dimensional structures, aptamers can bind to the targets, which is similar to antibody− antigen interactions. Compared with antibodies, aptamers are easier to be produced and modified, and they are more inexpensive, more stable and suitable for working under stringent conditions such as extreme temperatures and pH. With these advantages, aptamers are attractive alternatives to antibodies in many biological applications.12 Several aptamers with efficient binding affinities with bacteria or bacterial proteins have been used for pathogen detection such as Campylobacter jejuni, Shigella dysenteriae, Salmonella typhimurium, Escherichia coli K88, and Mycobacterium tuberculosis.13 Enzyme-linked aptamer assay (ELAA), first reported by Drolet in 1996, was used to detect human vascular endothelial growth factor (VEGF) on microplates.14 In recent years, several similar

s an important bovine pathogen, Mycoplasma bovis causes pneumonia, mastitis, otitis, conjunctivitis, and arthritis. It may also act as a predisposing factor that could weaken the host immune system, facilitating the invasion by other pathogenic bacteria or viruses.1 Clinical disease associated with M. bovis is often chronic, debilitating, and poorly responsive to antimicrobial therapy.2 M. bovis was first isolated from the milk of cow with mastitis in 1961 in the U.S. and is prevalent throughout the world. It is estimated that M. bovis infection causes €144 million in the European cattle industry and $32 million in the United States each year. Noneconomic costs are also highly significant, since chronic pneumonia will reduce the production performance of cattle and prolonged treatment with a variety of antibiotics will contribute to the development of antimicrobial resistance in other pathogens.3 In China, the first case was found in Hubei province in 2008,2,4 and outbreaks were reported in more than 10 provinces now. Calves are easier to be infected especially after long-distance transportation with infection rates 50% to 100% and mortality rates 10% to 50%, which causes huge economic losses. Isolation and culture of M. bovis are a traditional diagnostic method since it produces characteristic “centered” colonies on solid media.5 However, this method has an obvious shortage, since the characteristic colonies will not be seen until several days’ culture, and it is very time-consuming. As alternatives, a number of new diagnostic techniques of M. bovis infection have been developed, including pathogen detection methods of M. bovis such as real-time polymerase chain reaction (PCR),6 sandwich enzyme-linked immunosorbent assay (ELISA),7 in © XXXX American Chemical Society

Received: October 28, 2013 Accepted: January 13, 2014

A

dx.doi.org/10.1021/ac4042203 | Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

Article

assays also have been developed such as a sandwich ELAA for porcine reproductive and respiratory syndrome virus type II,15 a competitive ELAA for Ochratoxin A in wine, or dopamine in serum.16 In this report, we first developed an indirect competitive enzyme-linked aptamer assay (ic-ELAA) using a biotin-labeled aptamer of P48 protein for antibody detections of M. bovis in bovine serum samples. Series of tests proved that ic-ELAA has good sensitivity and specificity which are similar to monoclonal antibody-based competitive ELISA. Furthermore, ic-ELAA showed higher positive detection rates than two other commercial available indirect ELISA kits.

represents random oligonucleotides based on equal incorporation of A, G, C, and T in each position. The PCR primers were as follows: forward primer (FP17), 5′-GCTGCAATACTCATGGACAG-3′; reverse primer (BP17), 5TTCAGGGTCGTACTCCAGAC-3′. The library and all primers were synthesized and HPLC-purified by Sangon Inc. (Shanghai, China).The ssDNA pools were denatured by heating at 95 °C for 10 min in SHMCK buffer (20 mM Hepes, 120 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, pH 7.4) and then immediately put on ice for 15 min. Selection of DNA Aptamers Targeting P48 Protein. P48 protein was expressed in our laboratory based on the gene encoding P48 (Genbank AY557344) and employed as a target protein in the SELEX procedure of DNA aptamers which is described as follows: P48 protein solution was made by dissolving purified P48 protein in 100 μL of 0.05 M carbonatebicarbonate buffer (pH 9.6) and used to coat 96-well microplates at 4 °C overnight. Then the plates were washed three times with SHMCKT (SHMCK, 0.05% v/v Tween 20) and incubated with 200 μL of 3% bovine serum albumin (BSA) in SHMCKT for 2 h at 37 °C. The plates were washed three times again with SHMCKT, added the initial ssDNA pools (12.7 nmol) to the wells coated by P48 protein solution, and incubated at 37 °C for 60 min. The unbound ssDNA was removed by washing four times with SHCMKT. A volume of 100 μL of elution buffer (20 mM Tris-HCl, 4 M guanidinium isothiocyanate, 1 mM dithiothreitol, pH 8.3) was added to each well and incubated for 10 min at 80 °C. After phenol− chloroform−isoamyl alcohol 25:24:1 extraction, the precipitate was dissolved in 60 μL of ddH2O. P48-bound ssDNA was then amplified by the symmetry PCR method (5 min at 94 °C, followed by 20 cycles of 20 s at 94 °C, 20 s at 61 °C, 30 s at 72 °C, and 5 min at 72 °C). The PCR products were purified by 3% agarose gel electrophoresis, and dsDNA was eluted from the gels using a DNA gel extraction kit purchased from Bioteke Technologies Inc. (China) following the manufacturer’s instructions. The purified symmetric PCR products were then used as the template in an asymmetry PCR run (FP17:BP17 as 1:50; 5 min at 94 °C; followed by 30 cycles of 20 s at 94 °C, 20 s at 57 °C, and 30 s at 72 °C, and then 5 min at 72 °C) to generate ssDNA, which was used as the enriched library for the next round of selection. From the fifth selection round, a blank well without P48 protein was included, which was blocked with BSA as the same as the wells coated with P48 protein. The enriched ssDNA library generated by the fourth selection round was added in the blank well and incubated for 30 min at 37 °C, the supernatant solution was collected and used for the selection of aptamers by which the ssDNA that could bind to BSA or the plate were screened out from the ssDNA library.9a The selection parameters for each round are shown in Table 2. Screening the Affinity of the ssDNA Pool. An indirect ELAA (i-ELAA) was employed to screen the affinity of the ssDNA pool. Bioinitial library was synthesized by Sangon (China) with biotin labeled FP17 (bio-FP17) to generate biotin labeled ssDNA pool. Microplates coated with 100 μg of P48 protein per well were blocked with 3% BSA for 2 h at 37 °C. After washing three times with SHMCKT, 200 nM biopool was added to each well and the microplates were incubated for 1 h at 37 °C. The unbound ssDNA was removed by washing three times with SHMCKT. A volume of 100 μL of streptavidinhorseradish peroxidase (HRP-SA, 1:8000) (Cwbio, Beijing) was added to each well and incubated for 30 min at 37 °C. The plates were washed four times with SHMCKT, and then 100

■

MATERIALS AND METHODS Mycoplasma and Virus Strains. The species of Mycoplasma and virus used in this study are listed in Table 1. Mycoplasma bovis (M. bovis), Mycoplasma bovirhinis (M.

Table 1. Various Mycoplasma and Virus Species Used in This Study strain Mycoplasma Mycoplasma Mycoplasma Mycoplasma

bovis bovis bovis bovis

Mycoplasma bovirhinis Mycoplasma arginini Mycoplasma agalactiae Infectious bovine rhinotracheitis virus Bovine viral diarrhea virus Bovine adenovirus type 3 Bovine parainfluenza virus type 3

source ATCC25523 (PG45)a HB-1b SD-2b field isolates (GY-2, PD-2, HRB-1, HY-1, HG-1)c ATCC27748(PG43)a CVCC346(G230)d CVCC344(PG2)d CVCC AV346d CVCCd ATCC VR-639e ATCC VR-281e

a

American type culture collection (ATCC), USA. bChina animal health and epidemiology center, Qingdao, China. cField isolated from lungs or nasal swabs of bovines having clinical symptoms of M. bovis in China. dChina veterinary culture collection center, Beijing, China. e China center for type culture collection, Wuhan, China.

bovirhinis), Mycoplasma arginini (M. arginini), and Mycoplasma agalactiae (M. agalactiae) were grown in modified PPLO medium containing 20% horse serum.17 Infectious bovine rhinotracheitis virus (IBRV), bovine adenovirus type 3 (BAV3), Bovine viral diarrhea virus (BVDV), and bovine parainf luenza virus type 3 (BPIV3) were cultured in MDBK cells.18 Serum Samples. A total of 20 negative bovine serum samples were collected from cattle without a history of M. bovis infection. In total, 20 positive bovine serum samples were also collected from naturally M. bovis infected cattle from which nasal swabs of M. bovis had been isolated using PPLO medium. Bovine BAV3, IBRV, BVDV, BPIV3 positive control sera were purchased from Real Bio-Technology (China). Rabbit hyperimmune antisera against M. bovirhinis, M. arginini, and M. agalactiae were prepared following standard techniques. A total of 165 clinical bovine serum samples were collected from cattle in 5 provinces (Beijing, Hebei, Tianjin, Shandong, and Heilongjiang) and stored at −20 °C. Oligonucleotide Synthesis. The oligonucleotide library was synthesized as a single-stranded 80-mer with the following sequence: 5′-GCTGCAATACTCATGGACAG-(N) 4 0 GTCTGGAGTACGACCCTGAA-3′, where the central N40 B

dx.doi.org/10.1021/ac4042203 | Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

Article

were placed on top of the membrane and exposed in a dark room. Establishing Indirect Competitive ELAA (ic-ELAA). Microplates (96 wells) were coated with ∼25 μg/well of P48 protein in 0.1 M carbonate-bicarbonate buffer (pH 9.6) at 4 °C overnight. The plates were washed with SHMCKT three times and blocked with 200 μL of 10% horse serum in SHMCKT at 37 °C for 2 h. Next, 50 μL of nondiluted bovine serum (50 μL of SHMCK was added to two wells as buffer control at the same time) and 50 μL of 200 nM bio-WKB-14 were added into the plates. The plates were well mixed on a shaker and incubated at 37 °C for 1 h. Plates were then washed three times with SHMCKT to remove the unbound material, HRP-SA (1:8000) added, and incubated at 37 °C for 30 min. After four washes with SHMCKT, TMB (Sigma, Aldrich) was added for visualization. The reaction was stopped after 10 min at 37 °C by the addition of 50 μL/well 2 M sulfuric acid. The optical densities (OD) were read at 450 nm on a microplate reader. The percent inhibition (PI) values were determined using the formula: PI (%) = (1 − OD450 nm of test serum/OD450 nm of monoclonal control) × 100%. A total of 20 negative bovine sera and 20 positive bovine sera were used to determine the cutoff value between the positive and negative sera. The cutoff value was designed as the mean PI of negative sera + 2 standard deviations (SD), which would ensure that 95% of the PI values for the negative sera fell within this range. Ic-ELAA for Detecting M. bovis Antibodies in Bovine Serum Samples. A total of 165 bovine serum samples from five farms in different provinces of China were detected by icELAA, and the results were compared with that obtained by commercial i-ELISA kits from Bio-X (Belgium) and Biovet (Canada) as well as a direct competitive ELISA (dc-ELISA) and a dot blotting established in our laboratory. The dc-ELISA was developed with the mAb 10E against P48 for the detection of antibodies of M. bovis. There were 22, 32, 21, 33, and 57 serum samples collected, respectively, from Beijing, Hebei, Tianjin, Shandong, and Heilongjiang provinces.

Table 2. Selection Parameters for the P48 Protein SELEX round

P48 protein (μg)

incubating time (min)

ssDNA pool (pmol)

1 2 3 4 5 6 7 8 9 10 11

100 100 100 50 50 25 25 25 10 10 5

60 60 60 45 45 45 30 30 30 20 20

12 700 1 000 1 000 800 800 500 500 250 250 100 100

μL of 3,3′,5,5′-tetramethylbenzidine (TMB) (Sigma) was added to each well. After incubating for 10 min at 37 °C, 2 M sulfuric acid was added to stop the reaction. The optical densities were read at 450 nm on a microplate reader (BioRad). After 11 runs of selection described as above, the purified symmetric PCR products of the 11th run were cloned into T1 vector and transformed in Escherichia coli T1 strains (Transgen, China). Then, in total 83 individual bacterial clones were selected and sequenced by Sinogenomax (China). Determination of Dissociation Constants by i-ELAA. The affinities between aptamers and the P48 protein were determined by i-ELAA with the following procedure: Coated 96-well microplates with P48 protein, blocked with 3% BSA. A volume of 100 μL of denatured bioaptamers of different concentrations (100 nM, 50 nM, 25 nM, 10 nM, 1 nM, 5 nM, 0 nM) was added to each well and incubated for 60 min at 37 °C. The microplates were washed three times with SHMCKT, 1:8000 HRP-SA was added and were incubated at 37 °C for 30 min. The microplates were washed four times with SHMCKT, the substrate TMB (Sigma) was added and incubated for min at 37 °C. Then 2 M sulfuric acid was added to stop the reaction. The optical densities were read at 450 nm. A calibration curve was obtained using bioaptamers with concentrations in the range of 0−100 nM. A saturation curve was obtained based on these data, and the equation Y = BmaxX/(Kd + X) was used to calculate the Kd according to GraphPad Prism 5.0. Y represented the mean value of OD450 nm, Bmax was the maximal value of OD450 nm, and X was the concentration of the bioaptamer. Dot Blotting. A dot blotting assay19 was employed for the comparison of the affinity and specificity between the preferred aptamer WKB-14 and a specific monoclonal antibody (mAb) 10E of P48 protein, which is also produced in our laboratory. A top concentration of 30 000 ng/μL of P48 protein solution was prepared and diluted by a series of 10-fold to 0.3 ng/μL. A total of 20 μg of whole cell lysates of different pathogens were spotted onto a nitrocellulose membrane (Whatman) and was allowed to air-dry. Then, the membrane was blocked with 3% BSA in SHMCKT for 4 h at room temperature and incubated with 100 nM bioaptamer WKB-14 or 1:5000 mAb 10E in SHMCK for 60 min at 37 °C. The membrane was washed three times with SHMCKT, added 1:8000 HRP-SA or 1:5000 goatantimouse lgG (Kpl) and incubated for 30 min at 37 °C. The membrane was washed four times with SHMCKT, the ELC plus substrate (Applygen, China) was added, and X-ray films

■

RESULTS AND DISCUSSION In Vitro Selection of ssDNA Aptamers for the P48 Protein. P48 protein is an immunodominant invariable

Figure 1. Binding rate of different libraries. The bar graph revealed OD450 nm of different biolibraries using the i-ELAA.

lipoprotein that localizes on the membrane of M. bovis, and it is an ideal marker for M. bovis infection as well as a preferred antigenic protein candidate for the developments of specific serological tests for M. bovis.9a So we tried to select ssDNA aptamers specifically targeting the P48 protein of M. bovis. In this study, the microplate was selected as the SELEX matrix as described by Rhodes,20 since it was an easier method for the C

dx.doi.org/10.1021/ac4042203 | Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

Article

Table 3. Random Sequence Analysis of Aptamers Selected against the P48 Protein group

I: A + C = 65%

II: T + C = 65% aptamer III

WKB-14 WKB-51

aptamer

random sequence

A + C (%)

repeat time

WKB-49 WKB-20 WKB-3 WKB-48 aptamer

GCAGACGTCAGAACAATACCAATACTAATCCTTGGACCGC CAACGAACAATACATTATCTACATCACATTGCCCCGCGTG GCCGCGACCATACAACGCAAACAACACGCCTGTACGCTTG GCACGACATAACAACACTTATAGACTACTTCCCCCCTCGC random sequence

65 65 67.5 70 T + C (%)

2 2 8 4 repeat time

WKB-37 WKB-82 WKB-53

GTCCAAACACTATCTCTTCACT-TGCTGTTGTTCCCGTGGC GCACAACACATTAGACTTTGCTCTTCGGTCCCTCCGGCT GCTACCACCAAACATACGCACTCGTCGTCTGCCCTATGTG random sequence GTTGCGAAAGACAACGAATGCTTTGCCTGCCATAATTTGC GTGCGAAGCGCCTCCACTGTACATCCACTCCTTCTGCC

67.5 65 70 T + C (%)

4 3 5 repeat time

27.5 15.38

16 22

Figure 2. Dose-dependent i-ELAA to determine the dissociation constant (Kd) of aptamers. The fit curves were drawn by the GraphPad Prism 5.0 using various concentrations of aptamers as the binding ligands.

Figure 3. Secondary structures of dominant candidate DNA aptamers WKB-3, WKB-14, and WKB-51 specific to the P48 protein of M. bovis.

counter selection rounds were also employed from the fifth round of selection to remove the nonspecific sequences that bound to the microplates. As the ssDNA generation is an important step in the aptamer selection procedure,21 two kinds of PCR were designed. The first one was a symmetry PCR generating dsDNA with ssDNA as the template, and the second one performed subsequently was an asymmetry PCR which might generate enough ssDNA for the subsequent selection of aptamers.

separation of the protein-ssDNA complex from the nonspecific ssDNA. The initial library contained 80 nt ssDNA including 40mer random nucleotide inserts, which means the library was a pool of more than 1012 unique sequences theoretically and provides enough candidates for the selection of aptamers with higher affinity and specificity. Furthermore, the concentration of the P48 protein, ssDNA pool, and incubation time in the subsequent rounds of selection were decreased gradually to increase the probability of obtaining aptamers with higher affinity and specificity (Table 2). To improve specificity, D

dx.doi.org/10.1021/ac4042203 | Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

Article

Table 4. Dot Blotting Analysis of the Comparison Study between the Aptamer WKB-14 and mAb 10E: (a) Detection of P48 Protein in the Concentrations Range from 0.03 to 30 000 ng and (b) Specificity Test Using Seven M. bovis Strains and Seven Relative Pathogensa (a) P48 protein concentrations (ng) 30 000

3 000

300

30

3

0.3

0.03

0

+ +

+ +

+ +

+ +

− +

− −

− −

− −

aptamer mAb 10E

(b) M. bovis strains PG45

HB-1

SD-2

+ +

+ +

+ +

aptamer mAb 10E

PD-2

+ + + + relative pathogen strains

HRB-1

HY-1

HG-1

+ +

+ +

+ +

M. bovis

M. bovirhinis

M. arginini

M. agalactiae

IBRV

BVDV

BAV3

BPIV3

+ +

− −

− −

− −

− −

− −

− −

− −

aptamer mAb 10E a

GY-2

+, Positive; −, negative.

Figure 4. Schematic mechanism of ELAA. (A) I-ELAA. The P48 protein is immobilized on the microplate. After blocking for 2 h, the plate is incubated with bioaptamer for 1 h. After washing 3 times, SA-HRP is added and incubated for 30 min, followed by washing. The plate is then added to substrate TMB for colorimetric detection. (B) Ic-ELAA: serum and bioaptamer are added to the blocked plate at the same time. Immunoglobulins in positive serum compete to inhibit the bioaptamer from binding to the P48 protein, resultong in a lighter colorimetric detection.

After 11 rounds of selection, the fifth, eighth, ninth, and eleventh ssDNA pools were labeled with biotin by PCR methods with a bio-FP17 primer. There was a positive correlation between the OD450 nm values and the binding rates. According to the i-ELAA results as shown in Figure 1, the OD450 nm of the biolibrary kept rising before the eleventh selection round and then became steady, suggesting that eleven rounds were enough for the P48-specfic aptamers SELEX. Sequence Analysis of ssDNA Aptamers. After 11 rounds of selection, the eleventh symmetry PCR products were cloned and 83 individual bacterial clones were sequenced. As listed in Table 3, nine different sequences were obtained. In the 83 bacterial clones, some sequences were detected multiple times such as wkb-3, wkb-14, and wkb-51 which were repeated for 8, 16, and 22 times, respectively. These results suggested that the aptamers against P48 protein had been well enriched. On the

basis of base content, these nine sequences were divided into three groups as shown in Table 3. In group I, there were four adenine-cytosine-rich sequences (A + C ≥ 65%), which contained conserved “GAACAATAC”, “TACT”, and “CGC” motifs. In group II, there were three thymine-cytosine-rich sequences (T + C ≥ 65%), and all of them had conserved “CCAAACA”, “ACT”, “TGCTGTT”, and “CCC” motifs. In group III, there were two sequences, which retained conserved motifs such as “TGCGAA”, “GCCTGCCA”, and “TTCTGC”, although they had different base content. Three sequences (WKB-3, WKB-14, and WKB-51), with relatively higher rates of detection were selected and analyzed. The secondary structures of these three aptamers were confirmed using the m-fold program, and their affinity with P48 protein was confirmed by i-ELAA assays. E

dx.doi.org/10.1021/ac4042203 | Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

Article

Figure 5. Ic-ELAA for detection of antibodies to M. bovis. (A) Determination of the cutoff value of percent inhibition by using 20 negative bovine sera. (B) Binding inhibition of aptamer WKB-14 by bovine or rabbit antisera against various pathogen species 1−10, respectively, was BAV3, BVDV, BPIV3, BRSV positive control serum, Rabbit hyperimune antisera against M. bovirhinis, M. arginini and M. agalactiae, rabbit negative serum, bovine negative M. bovis serum, bovine M. bovis positive serum.

bioaptamer-SA-HRP were detected instead of the fluorescence intensity of FAM-aptamers. It was a convenient, specific method and did not require expensive equipment. As determined by i-ELAA, all three aptamers had strong binding affinities with P48 protein (Figure 2). The curve drawn using the GraphPad Prism 5.0 resulted in a small error with respect to the experimental data. The Kd values of aptamer WKB-3, WKB14, and WKB-51 with P48 protein were 32.81 ± 7.75 nM, 15.61 ± 2.36 nM, and 20.81 ± 4.48 nM, respectively, by further calculations, and WKB-14 had a slightly stronger binding affinity with P48 than WKB-3 or WKB-51 by comparison of the three Kd values. Two dimensional stem-loop structures of WKB-3, WKB-14, and WKB-51 were predicted by online software: http://mfold. rit.albany.edu/.23 As shown in Figure 3, the three aptamers all had several loop structures that represented clearly the accessible single-stranded regions, which were probably more energetically favorable for target binding versus an “induced fit” in double-stranded stem regions wherein hydrogen bonds between the nitrogen bases of the aptamers would be broken. Nevertheless, common loop structures did not necessarily indicate a target binding site within a family of aptamers.24 In the following application studies, Aptamer WKB-14 was selected since it had the highest binding affinity with P48 protein. Comparison of the Specificity and Affinity between Aptamer WKB-14 and mAb 10E. A dot blotting assay was carried out to evaluate the affinity and specificity of the aptamer

Table 5. Comparison of the Five Methods for Detecting the Antibody to M. bovis in Bovine Serum Samplesa province Beijing Hebei Tianjin Shandong Heilongjiang total a

+ − + − + − + − + −

ic-ELAA

dc-ELISA

Biovet

Bio-X

dot blotting

13 9 17 15 13 8 26 7 26 31 165

13 9 17 15 13 8 25 8 26 31 165

11 11 13 19 9 12 23 10 23 34 165

7 15 11 21 9 12 20 13 18 39 165

13 9 17 15 13 8 24 9 26 31 165

+, Positive; −, negative.

Dissociation Constants of the Aptamers of P48 Protein. Currently, there are many methods adopted to measure aptamer-protein equilibria, including fluorescence intensity, fluorescence anisotropy/polarization, UV−vis absorption, circular dichroism, surface plasmon resonance, isothermal titration calorimetry, and affinity capillary.22 However, these methods require sophisticated and expensive machinery and are significantly time consuming. In this study, the Kd values of the P48 protein-specific aptamers were determined by i-ELAA based on the method reported by Li et al.13b with some modifications as follows. Bioaptamers were used instead of FAM-aptamer, and the reaction between substrate TMB and

Figure 6. Correlation between ic-ELAA and Biovet, Bio-X on 165 sera samples. X-axis, percent inhibition of serum sample by ic-ELAA; Y-axis, OD450 nm of serum sample by commercial kit (Biovet and Bio-X). One point represents one serum sample. F

dx.doi.org/10.1021/ac4042203 | Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

Article

Figure 7. PCR results of 33 bovine nasal swabs from the individual cattle in Shandong farm. Rinsed nasal swabs with 1 mL of PBS and extracted whole genome DNA with DNA extraction kit (Tiangen, China). A pair of primers (MB-F, GCTTCATGTGGTGATAAATACTTTA; MB-R, CTATTTTTGTGTTTCTTTAGCCAAT) based on the P48 gene (Genbank AY557344) were used and a 1341 bp amplified product was expected. M, DM 2000 marker; N, negative control; +, positive control; 1−33, 33 bovine nasal swabs. Six nasal swabs (6, 8, 9, 23, 25, 29) were negative, and 27 other samples were positive.

determine the status of serum samples in response to M. bovis antibodies (Figure 5A). As shown in Figure 5A, all positive sera have PI values higher than 40%. Overall, the cutoff value of PI set at 40% could clearly distinguish between the negative and positive M. bovis serum samples. The specificity of the ic-ELAA for the detection of M. bovis antibodies was also evaluated by cross-reactivity with antisera of other related pathogens. The percent inhibition values of these sera were calculated using the same method as described above. As shown in Figure 5B, all the antisera of the other related pathogens showed PI values lower than 40%, which were considered as negative. That suggested that our ic-ELAA had no cross-activity with other antisera of related pathogens. Detection of Antibodies to M. bovis in Clinical Bovine Serum Samples Using ic-ELAA. The effectiveness of the icELAA for the detections of M. bovis antibody was validated using 165 clinical bovine serum samples from five different provinces in China. Samples were also detected using two commercial ELISA kits, dc-ELISA and dot blotting, which were already available in our laboratory. The total results are listed in Table 5. Of the 165 samples, 95 samples were tested as positive by ic-ELAA. There were 79, 65, and 93, 94 serum samples that were detected as positive using the Biovet kit, Bio-X kit, dcELISA, and dot blotting, respectively. The ic-ELAA, dc-ELISA, and dot blotting all had higher positive detection rates than the two commercial ELISA kits. The correlation between ic-ELAA and Biovet, Bio-X was shown in two scatter diagrams (Figure 6). Pearson productmoment correlation coefficient (r) was used for the statistical analysis of the data by the SAS v9.2. In total, for 165 samples, the r values of ic-ELAA-Biovet, ic-ELAA-Bio-X, Biovet-Bio-X

WKB-14 against the target P48 protein, and the affinity and specificity were also compared between aptamer WKB-14 and mAb 10E against the P48 protein. For the evaluation of affinity, a series of 10-fold dilutions of P48 protein in the range from 0.3 to 30 000 ng were prepared and used in the dot blotting assay, and the results shown in Table 4a suggested that the detection limits of aptamer WKB-14 and mAb 10E were 30 ng and 3 ng, respectively, which meant that the mAb 10E has a 10-fold higher affinity than aptamer WKB-14. Eight different M. bovis strains and seven other related pathogens were also employed in the dot blotting assay in order to compare the specificity of aptamer WKB-14 and mAb 10E. The results presented in Table 4b indicated that all eight M. bovis strains (PG45, HB-1, SD-2, GY-2, PD-2, HRB-1, HY-1, HG-1) formed visible dots and the other related pathogens did not produce visible dots when both aptamer WKB-14 and mAb 10E were used as the recognition ligands, suggesting that aptamer WKB-14 and the mAb 10E had comparable specificity. Determination of the Cutoff Value and Specificity of ic-ELAA. The key factors of the indirect competitive assay were titers of M. bovis antibody and concentrations of the competing aptamer. In the indirect competitive assay, immunoglobulins in positive sera competed to inhibit the bioaptamer from binding to its specific antigens, as depicted schematically in Figure 4. Therefore, positive sera would prevent color development whereas nonreactive sera will allow a strong color reaction. After optimization, 20 negative bovine sera were used to determine the cutoff value of the percent inhibition (PI). These negative sera had a mean percent inhibition value of 24.9% with a standard deviation (SD) of 7.7%. Hence, the cutoff value of percent inhibition was set at 40% (mean + 2 SD)25 to G

dx.doi.org/10.1021/ac4042203 | Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

■

ACKNOWLEDGMENTS This work was supported by the Agricultural Finance Program, Ministry of Agriculture of China, and Program for New Century Excellent Talents in University of Ministry of Education of China.

were 0.74, 0.80, and 0.74, respectively. In 95 samples detected as positive by ic-ELAA (percent inhibition ⩾ 40%), the r value of ic-ELAA-Biovet, ic-ELAA-Bio-X, Biovet-Bio-X was 0.65, 0.66, and 0.57, respectively. In 79 samples detected as positive by Biovet (OD450 nm⩾ 0.32), r value of ic-ELAA-Biovet, ic-ELAABio-X, Biovet-Bio-X was 0.62, 0.65, and 0.54, respectively. In 65 samples detected as positive by Bio-X (OD450 nm ⩾ 0.49), r value of ic-ELAA-Biovet, ic-ELAA-Bio-X, Biovet-Bio-X was 0.61, 0.62, and 0.47, respectively. The agreement rates between ic-ELISA and the other four methods were also analyzed by kappa statistics SPSS v19.0. There were good agreements between ic-ELAA and dc-ELISA (kappa = 0.988), Biovet (kappa = 0.807), Bio-X (kappa = 0.648), dot blotting (kappa = 0.975). It was interesting that Bio-X had a lower kappa value with ic-ELAA than Biovet, while it had a higher r value than Biovet. A better explanation we can come up with is that Bio-X had a relative higher cutoff value (0.49) than Biovet (0.32), which led to a lower positive detection rate. The results of clinical samples detected by ic-ELAA and dcELISA were consistent except for one datum, although the mAb 10E had a 10-fold higher affinity than aptamer WKB-14. In competitive format, aptamer with a lower affinity might be inhibited easily by immunoglobulins in positive sera, similarly described by Eva Baldrich et al in 2005. In addition, aptamers are chemically, animal-free produced, can be easily modified without affecting their affinity, used and restored in a variety of conditions. On the contrary, mAbs are normally animal-needed, only stable under a physiological environment, and their chemical modification often relates to a decrease in affinity with their targets.14 To determine whether the positive sera detected by ic-ELAA, dc-ELISA, and dot blotting that were missed by the commercial kits were indeed positive, 33 nasal swab samples were harvested from the same cattle in Shandong province, and 27 samples were confirmed as positive by PCR based on the P48 gene, including 26 ic-ELAA positive samples (Figure 7). So, it could be concluded that the ic-ELAA we developed with aptamer WKB-14 could be used as an alternative method for M. bovis serological detection.

■

REFERENCES

(1) Soehnlen, M.; Aydin, A.; Lengerich, E.; Houser, B.; Fenton, G.; Lysczek, H.; Burns, C.; Byler, L.; Hattel, A.; Wolfgang, D. Vaccine 2011, 29 (33), 5347−5354. (2) Nicholas, R.; Ayling, R. Res. Vet. Sci. 2003, 74 (2), 105. (3) (a) Caswell, J. L.; Archambault, M. Animal Health Res. Rev. 2007, 8 (2), 161. (b) Changmin, H.; Lei, S.; Rui, G.; Zhidi, B.; Aizhen, G. Prog. Vet. Med. 2009, 30 (8), 73−77. (4) Xin, J.; Li, Y.; Guo, D.; Song, N.; Hu, S.; Chen, C.; Pei, J.; Cao, P. Chin. J. Prev. Vet. Med. 2008, 30 (9), 661−664. (5) Nicholas, R., Baker, S., Eds. Recovery of mycoplasmas from animals. In Mycoplasma Protocols; Humana Press: Totowa, NJ, 1998; pp 37−43. (6) Rossetti, B.; Frey, J.; Pilo, P. Mol. Cell. Probes 2010, 24 (5), 321. (7) Ball, H.; Finlay, D.; Reilly, G. Vet. Rec. 1994, 135 (22), 531−532. (8) (a) Björn, J.; Hermeyer, K.; Jechlinger, W.; Zimmermann, M.; Spergser, J.; Rosengarten, R.; Marion, H.-T. J. Vet. Diagn. Invest. 2010, 22 (1), 90−93. (b) Hermeyer, K.; Peters, M.; Brügmann, M.; Jacobsen, B.; Hewicker-Trautwein, M. J. Vet. Diagn. Invest. 2012, 24 (2), 364−369. (9) (a) Robino, P.; Alberti, A.; Pittau, M.; Chessa, B.; Miciletta, M.; Nebbia, P.; Le Grand, D.; Rosati, S. Vet. Microbiol. 2005, 109 (3−4), 201. (b) Perez Casal, J.; Prysliak, T. Microb. Pathog. 2007, 43 (5−6), 189. (c) Ball, H. J.; Nicholas, R. Vet. J. 2010, 186 (3), 280. (10) (a) Tuerk, C.; Gold, L. Science 1990, 249 (4968), 505−510. (b) Bock, L. C.; Griffin, L. C.; Latham, J. A.; Vermaas, E. H.; Toole, J. J. Nature 1992, 355, 564−566. (11) Hong, P.; Li, W.; Li, J. Sensors 2012, 12 (2), 1181−1193. (12) (a) Iliuk, A. B.; Hu, L.; Tao, W. A. Anal. Chem. 2011, 83 (12), 4440−4452. (b) Song, K.-M.; Lee, S.; Ban, C. Sensors 2012, 12 (1), 612−631. (13) (a) Qin, L.; Zheng, R.; Ma, Z.; Feng, Y.; Liu, Z.; Yang, H.; Wang, J.; Jin, R.; Lu, J.; Ding, Y. Clin. Chem. Lab. Med. 2009, 47 (4), 405−411. (b) Li, H.; Ding, X.; Peng, Z.; Deng, L.; Wang, D.; Chen, H.; He, Q. Can. J. Microbiol. 2011, 57 (6), 453−459. (c) Rotherham, L.; Maserumule, C.; Dheda, K.; Theron, J.; Khati, M. PLoS One 2012, DOI: 10.1371/journal.pone.0046862. (14) Baldrich, E.; Acero, J. L.; Reekmans, G.; Laureyn, W.; O’Sullivan, C. K. Anal. Chem. 2005, 77 (15), 4774−4784. (15) Lee, S. J.; Kwon, Y. S.; Lee, J.-e.; Choi, E.-J.; Lee, C.-H.; Song, J.Y.; Gu, M. B. Anal. Chem. 2012, 85 (1), 66−74. (16) (a) Park, H.; Paeng, I. R. Anal. Chim. Acta 2011, 685 (1), 65− 73. (b) Barthelmebs, L.; Jonca, J.; Hayat, A.; Prieto-Simon, B.; Marty, J.-L. Food Control 2011, 22 (5), 737−743. (17) (a) Alberti, A.; Addis, M. F.; Chessa, B.; Cubeddu, T.; Profiti, M.; Rosati, S.; Ruiu, A.; Pittau, M. J. Vet. Diagn. Invest. 2006, 18 (1), 41−51. (b) Silló, P.; Pintér, D.; Ostorházi, E.; Mazán, M.; Wikonkál, N.; Pónyai, K.; Volokhov, D. V.; Chizhikov, V. E.; Szathmary, S.; Stipkovits, L. J. Clin. Microbiol. 2012, 50 (3), 1113−1117. (18) (a) Schutz, J.; Carroll, J.; Gasbarre, L.; Shelton, T.; Nordstrom, S.; Hutcheson, J.; Van Campen, H.; Engle, T. J. Anim. Sci. 2012, 90 (6), 1948−1954. (b) Elazhary, M.; Derbyshire, J. Vet. Microbiol. 1977, 2 (4), 283−288. (19) Wang, R.; Li, Y. Biosens. Bioelectron. 2013, 42, 148−155. (20) Rhodes, A.; Deakin, A.; Spaull, J.; Coomber, B.; Aitken, A.; Life, P.; Rees, S. J. Biol. Chem. 2000, 275 (37), 28555−28561. (21) Marimuthu, C.; Tang, T.-H.; Tominaga, J.; Tan, S.-C.; Gopinath, S. C. Analyst 2012, 137 (6), 1307−1315. (22) (a) Berezovski, M.; Nutiu, R.; Li, Y.; Krylov, S. N. Anal. Chem. 2003, 75 (6), 1382−1386. (b) Jing, M.; Bowser, M. T. Anal. Chim. Acta 2011, 686 (1), 9−18. (23) Zuker, M. Nucleic Acids Res. 2003, 31 (13), 3406−3415.

■

CONCLUSION To the best of our knowledge, this is the first report of indirect competitive ELAA for antibody detection. Our ic-ELAA employed ssDNA aptamer WKB-14 that can specifically bind to the P48 protein of M. bovis with a Kd of 15.61 nM. With a PI cutoff value of 40%, the ic-ELAA had higher positive detection rates than two commercial indirect ELISA kits when they were used to detect clinical bovine serum samples, which suggested the ic-ELAA we developed here was a useful method for the surveillance of M. bovis and helpful for a better understanding of the ecology and epidemiology of M. bovis.

■

Article

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Fax: +8610-62733048. Author Contributions §

P.F. and Z.S. contributed equally to this work.

Notes

The authors declare no competing financial interest. H

dx.doi.org/10.1021/ac4042203 | Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

Article

(24) Bruno, J. G.; Carrillo, M. P.; Richarte, A. M.; Phillips, T.; Andrews, C.; Lee, J. S. BMC Res. Notes 2012, 5 (1), 1−12. (25) Webster, K.; Giles, M.; Dawson, C. Vet. Parasitol. 1997, 68 (1), 155−164.

I

dx.doi.org/10.1021/ac4042203 | Anal. Chem. XXXX, XXX, XXX−XXX