Enteroviral meningitis. Diagnostic methods and aspects on the distinction from bacterial meningitis.

Scandinavian Journal of Infectious Diseases

ISSN: 0036-5548 (Print) 1651-1980 (Online) Journal homepage: http://www.tandfonline.com/loi/infd19

Enteroviral Meningitis: Diagnostic Methods and Aspects on the Distinction from Bacterial Meningitis Martin Glimåker To cite this article: Martin Glimåker (1992) Enteroviral Meningitis: Diagnostic Methods and Aspects on the Distinction from Bacterial Meningitis, Scandinavian Journal of Infectious Diseases, 24:sup85, 1-64, DOI: 10.3109/inf.1992.24.suppl-85.01 To link to this article: http://dx.doi.org/10.3109/inf.1992.24.suppl-85.01

Published online: 02 Jan 2015.

Submit your article to this journal

Article views: 3

View related articles

Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=infd19 Download by: [RMIT University Library]

Date: 25 April 2016, At: 01:08

Scandinavian Journal of Infectious Diseases Supplementum 85 1992

Downloaded by [RMIT University Library] at 01:08 25 April 2016

From the Departments of Infectious Diseases, Orebro Medical Center Hospital and University Hospital Uppsala and the Department of Virology, the Central Microbiological Laboratory of the Stockholm County Council, Sweden.

ENTEROVIRAL MENINGITIS Diagnostic Methods and Aspects on the Distinction from Bacterial Meningitis

by Martin Glimaker

ISSN 0300-8878 Scandinavian University Press, Oslo - Stockholm

Printed in Sweden by Repro Print AB, Stockholm 1992


© Martin Glimaker And Scandinavian University Press, P.O. Pox 2959 Teyen. N-0608 Oslo, Norway.

3

Original papers


This thesis is based on the following papers, which will be refered to by their Roman numerals. I

Glimaker M, Olcen P, Strannegard 6. Intrathecal production of neopterin and B-2 microglobulin in patients with aseptic meningitis. Immunol Infect Dis 2:191-199, 1992.

II

Glimaker M, Kragsbjerg P, Forsgren M, Olcen P. Tumor necrosis factor-a in cerebrospinal fluid from patients with meningitis of different etiology - high levels indicate bacterial meningitis. J Infect Dis, accepted for publication.

III

Glimaker M, Samuelson A, Magnius L, Ehrnst A, Olcen P, Forsgren M. Early diagnosis of enteroviral meningitis by detection of specific IgM antibodies with a solid-phase reverse immunosorbent test (SPRIST) and u-capture EIA. J Med Virol 36:193-202, 1992.

IV

Samuelson A, GlimAkerM, Skoog E, Cello J, Forsgren M. Diagnosis of enteroviral meningitis with IgG-EIA using heat-treated virions and synthetic peptides as antigens. J Med Virol, accepted for publication.

V

GlimAkerM, Abebe A, Johansson B, Ehrnst A, StrannegArd 6. Detection of enteroviral RNA by polymerase chain reaction in faecal samples from patients with aseptic meningitis. J Med ViroI38:54-61, 1992.

VI

GlimAkerM, Johansson B, Olcen P, Forsgren M. Detection of enteroviral RNA by PCR in cerebrospinal fluid from patients with aseptic meningitis. Submitted.

4

Contents Abbreviations Introduction Clinical manifestations Immune responses in CSF Distin~~ishi~g bact.erial from non-bacterial meningitis Specific diagnostic tests Non-specific diagnostic tests Neopterin B-2 microglobulin Tumor necrosis factor-a. Interferon-y


Etiology of aseptic meningitis Enteroviruses Virology Clinical features

Di8:gnost!C tec~niques for enteroviruses VIrus isolation Serological assays Electron microscopy and antigen detection Genomic assays

Aims of the study Material Methods Definitions Results and Discussion Non-specific diagnostic CSF parameters Routinely used CSF parameters Neopterin, B2-microglobulin, tumor necrosis factor-a. and interferon-s Diagnostic aspects Relationship between non-specific parameters and disease activity Aspects on the cellular immune response Sp~cifi~

en.terovirus diagnostic tests

Virus isolation Serolo~i~al. assays

. 5 . 6 .. . .

6

6

7 . 7 . 8 . 9 . 9 .. 10 . 10 . 11

. 12 . 12 . 13 . 14 . 14 .. 15 .. 16 .. 16

.. .. . . . ..

19 20 23 29

31 31 31 33 34 36

. . . .. .. 37 . 39 . 39 . 41

41

~~~~m~~~~::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::: : 42

Additional etiological information assa~s: ..: In vitro sensitrvrty Sensi.tiyi~y in clinical samples Specificity Additional etiological information Technical aspects

Geno~ic

Practical diagnostic conssiderations Overview of etiological findings Clinical observations Neurological symptoms and follow-up

General summary and Conclusions Acknowledgements References

. . . . .. . .

43 44 44 45

47 47

48 . 49 . 50 . 52 . 54 . 56 . 58

. 59

5

ABBREVIATIONS ALAT ASAT BJent CFT CNS CPE CRP CSF DNA dNTP

EBV

EASIA EIA


GMK

HeLa H-EIA HIV HLA HSV IFN IL IRMA kb kD

LD NCR NT P-EIA PCR PMNL Rd RIA RNA Rot2

RT SD 8-2M

TBE

TCIDso TNF-a tRNA UV

VP

VZV

alanine amino transferase aspartate amino transferase enterovirus primer constructed by Bo Johansson complementfixation test central nervous system cytopathogeniceffect C-reactiveprotein cerebrospinal fluid deoxyribonucleic acid deoxyribonucleoside triphosphate Epstein-Barr virus enzyme-amplified sensitivityimmunoassay enzyme immunoassay green monkey kidney Helen Lane EIA using heat-treatedantigens human immunodeficiencyvirus human leukocyte antigen herpes simplex virus interferon interleukin immunoradiometricassay kilobases kilodalton lactate dehydrogenase non-coding region neutralization test EIA using peptide antigens polymerase chain reaction polymorphonuclear leukocytes rhabdomyosarcoma radioimmunoassay ribonucleic acid enterovirus primer constructed by Harley Rotbart reverse transcriptase standarddeviation B-2 microglobulin tick-borneencephalitis tissue culture infective doses 50 % tumor necrosis factor-a transfer-RNA ultraviolet viral protein varicella-zostervirus

6

INTRODUCTION Meningitis is often divided into purulent and aseptic (= lymphocytic or serous) forms according to the number of leukocytes in cerebrospinal fluid (CSF) [Christie, 1987; McGee and Baringer, 1990]. Purulent meningitis is usually caused by bacteria whereas the aseptic type in most cases is associated with viral infection. However, a viral meningitis may in some cases be associated with purulent CSF and an aseptic meningitis may sometimes occur in bacterial CNS infections. Thus, meningitis caused by Mycobacterium tuberculosis, Borrelia burgdorferi and Treponema pallidum are as a rule aseptic. Non-purulent CSF may also be

seen in meningitis caused by bacteria that usually are associated with a purulent CSF if this Downloaded by [RMIT University Library] at 01:08 25 April 2016

specimen is sampled very early in the course of the disease or if the patient is treated with antibiotics. Thus, the classification in purulent and aseptic meningitis does not unequivocally indicate the etiological cause of the meningitis.

Clinical manifestations The symptoms are often similar in purulent bacterial and aseptic meningitis but are frequently more severe in the former condition. The onset is usually abrupt and the clinical picture dominated by headache, fever, neck rigidity and nausea. Meningitis caused by Haemophilus influenzae and Streptococcus pneumoniae is often preceded by symptoms from the respiratory

tract. If the etiological agent is Neisseria meningitidis the meningitis is frequently accompanied by petechiae, and severe septic shock and disseminated intravasal coagulation may also be present. Whereas these three microorganisms strongly dominate in purulent bacterial meningitis enteroviruses cause the majority of cases with aseptic meningitis. Meningitis due to enteroviruses may be associated with a diphasic onset of symptoms, upper respiratory tract symptoms, muscular tenderness, a mild rash, conjunctivitis and, in small children, diarrhoea. Extra-CNS symptoms like parotitis, varicella and genital blisters often, but not always, accompany aseptic meningitis caused by mumps virus, varicella-zoster virus (VZV) and herpes simplex virus (HSV) type 2, respectively.

Immune responses in CSF The immunoglobulin levels in CSF are, under normal conditions, very low; 0.1 - 0.5 % of the blood levels. Complement, which is vital for opsonization and hence phagocytosis, is also present in very low concentrations; less than 1 % of the serum levels. A small number of mononuclear leukocytes may be present in the normal CSF, the upper normal limit usually being set at 5 x 106/l. The initial events in meningitis are related to a diminishing blood brain barrier function. In viral meningitis B-Iymphocytes appear in CSF and synthesize virus specific antibodies locally within approximately one week after onset of infection [Vandvik et aI., 1978, Griffin, 1981,

7 Kinnman et al., 1981]. An antibody response may also be present in bacterial meningitis but this is probably of less importance for the clearing of bacteria since the complement content is low in CSF. Polymorphonuclear leucocytes comprise the main host-defense against invasion of bacteria [Quagliarello and Scheld, 1992]. In contrast, the successful immune response to viral infection is dependent upon cytotoxic T-lymphocytes. Astrocytes are glial cells of the central nervous system (CNS) that are of great immunological importance [Fontana and Fierz, 1985; Fierz et aI., 1985; Lieberman et al., 1989]. Activation of the cellular immune system is, in bacterial as well as in viral meningitis, associated with a complex pattern of signal substances (cytokines) that act as critical inflammatory mediators in the local and general host response. One of the most prominent of these cytokines is tumor necrosis factor (TNF)-a in


bacterial meningitis [Beutler and Cerami, 1987; Lieberman et al., 1989; Quagliarello and Scheld, 1992] whereas interferon (IFN)-g as well as IFN-a seem to play important roles in viral CNS infections [Fierz et aI., 1985, Frei et al., 1987 and 1988; Ho-Yen and Carrington, 1987].

Distinguishing bacterial from non-bacterial meningitis Purulent bacterial meningitis is a life-threatening but potentially treatable disease whereas viral meningitis usually subsides spontaneously. Thus, it is of critical importance to rapidly differentiate between these two conditions. Distinguishing a bacterial from a viral meningitis in the acute phase of disease may, especially in children, be vexing for the clinician since the symptoms often are similar and the rapid laboratory tests not always unequivocally indicative of a bacterial or viral etiology [Lindquist, 1987].

Specific diagnostic tests A rapid bacterial diagnosis may often be obtained by microscopy of Gram-stained smears of CSF and/or antigen detection assays on CSF like countercurrent immunoelectrophoresis, latex agglutination, co-agglutination and enzyme immunoassays (EIA) for H. influenzae, S.

pneumoniae andN. meningitides [Olcen, 1978; Thirumoorthi and Dajani, 1979; Salih et al., 1989]. Negative results by these tests do not rule out a bacterial etiology. Bacterial culture of CSF, which is the most reliable diagnostic tool for bacterial meningitis, requires one to two days in the laboratory. In the acute phase of meningitis a viral etiology is usually based on the exclusion of a bacterial diagnosis. Relatively rapid diagnostic assays for some of the most common viral agents that cause meningitis, i.e. enterovirus and HSV, have recently been developed [Aurelius et aI., 1991; Aurelius et aI., in press; Rotbart, 1990, King et al.,1983, GlimAkeret al., 1990] but these tests require at least one day for completion.

8

Non-specific diagnostic tests

Table I. Sensitivity and specificity of tests measuring differentCSF-parameters for the distinction between purulentbacterial and non-bacterial meningitis. The presented data wereobtainedafter recalculation by inclusion of only patientsclassifiedas having meningitis.


Reference

No of patients WBC counts Bacterial Non-bact. Sens. Spec.

Protein Sens. Spec.

Glucose Sens. Spec.

0.51 1.2 gil

0.76 0.55 g/1

Lactate CRP Sens. Spec. Sens. Spec.

Geiseler et aI., 1980 Discriminating limit

1316

Briem, 1983 Discriminating limit

56

102

Mandai et aI., 1983 Discriminating limit

26

59

0.92 0.92 3.9 mmo1/1

Lester et aI., 1985 Discriminating limit

16

15

0.94 0.87 3.5 mmo1/1

Abramson et aI., 1985 Discriminating limit

74

92

Gray et aI., 1986 Discriminating limit

48

32

Lindquist, 1987 Discriminating limit

79

218

0.68 1000 x 10 6/1

0.82 0.96 1.2 gil

0.57 1.0 1.0 0.98 2 mmo1/1 3.5 mmo1/1 0.75 0.99 CSF/blood =0.4

0.97 0.93 agglutination a 0.86 0.94 100 ng/ml 0.39 0.98 1000 x 10 6/1

0.69 0.88 1.0 gil

0.53 0.98 2.2 mmo1/1

0.89 0.96 0.77 0.98 3.5 mmo1/1 0.5 mgll

aAgglutination in a latex test (CR-TEST, Hyland Diagnostics, Deerfield, USA) WBC = white blood cells, CRP = C-reactive protein.

Analyzing non-specific parameters like the cell counts, protein-, lactate- and glucose levels in CSF is the cornerstone in distinguishing purulent bacterial from viral meningitis in the acute phase of disease [Geiseler et al., 1980; Briem, 1983; Mandal et al., 1983; Lester et al., 1985; Valmari et al., 1986; Linquist et al., 1988]. C-reactive protein (CRP) in serum [Roine et al., 1991] and CSF [Gray et al., 1985; Abramson et al. 1985], may also often be of diagnostic help. However, none of these parameters can unequivocally discriminate between bacterial and viral meningitis with 100% accuracy (Table I). According to available data in this table CRP appears to be a good discriminating parameter. However, the CRP level in CSF is frequently elevated during disease outside the CNS [Abramson et al., 1985, Gray et al., 1985]. The typical patterns of these substances in different types of neurological disorders are listed in Table II.

9 Table Il. Typical patterns of leukocyte counts with distribution in poly-/mononuclear cell ratios, protein levels in CSF, and CSF/serum ratios of glucose in different neurological disorders. CSF-findings


Diagnosis

Pleocytosis

Viral meningitis Herpes simplex encephalitis Purulent bacterial meningitis Tuberculous meningitis Lues meningitis Borrelia meningitis Brain abscess Staphylococcal endocarditis Fungal meningitis Toxoplasma meningitis Guillain-Barre syndrome Cerebral tumors Cerebrallymphoma/leukemia Sarcoidosis Vasculitis

+ + +++ + + + (+) + + + (+) + ++ + +

poly-/mono nuclear cells

< I < 1 > 1 < 1 < 1 < 1 '" 1 < 1 < 1 < 1 < 1 < 1 1 < 1 < 1

Protein level

(+) ++ ++ +++ + ++ (+) (+) ++ ++ ++ ++ + ++ (+) to +++

CSF-glucose/ blood glucose Normal Normal Markedly lowered Markedly lowered Usually normal Sometimes lowered Lowered in late stage Normal Sometimes lowered Usually normal Normal Sometimes lowered Sometimes lowered Normal Normal

Neopterin is a pyrazino-pyrimidine compound that is produced by macrophages and monocytes mainly after stimulation by IFN-y [Huber et al., 1984; Bitterlich et aI., 1988; Troppmair et aI., 1988]. Interleukin (IL)-2, TNF-a and IFN-a may also stimulate neopterin secretion, probably via a cytokine cascade that includes production of IFN-y (Bitterlich et al., 1988; Troppmair et aI., 1988; Ho-Yen and Carrington, 1987). IFN-y is produced by Tlymphocytes and constitutes a major activator of antigen presenting cells [pierz et aI., 1985]. Thus, neopterin may be considered as an indirect marker of IFN-y production and may give information about the activity of T lymphocytes. Elevated levels of neopterin in serum and urine have been found in patients with different viral infections [Wachter et al., 1979]. Raised levels in CSF have been recorded in patients with meningitis of different etiologies [Fredriksson et al., 1987; Dotevall et al., 1990; Koelfen et al., 1990] and in HIV-encephalopathy [Sonnerborg et al., 1989]. 8-2 microglobulin (8-2M) is a low molecular weight protein that forms the light chain of the major histocompatibility, class I, antigens (HI...A, A, B, C). The substance is derived from HI...A-turnover and is synthezised and secreted by many types of normal and malignant cells of hematopoietic, mesenchymal and epithelial origin [Bernier and Fanger, 1972; Evrin and Nilsson, 1974; Poulik and Bloom, 1972]. Increased serum levels of 8-2M have been considered to reflect an activation of T-Iymphocytes in viral diseases [Lamelin et al., 1982; Cooper et al., 1984].

10

Raised CSF levels have been observed in patients with bacterial and viral meningitis as well as in individuals with brain infarction-hemorrhage [Terent et al., 1981; Starmans et al., 1977; Us et al., 1989; Peterslund et aI., 1989] and HIY-encephalopathy [Sonnerborg et aI., 1989]. Since B-2M is cleared by glomerular filtration, the serum and CSF levels tend to increase with age [Peterslund et aI., 1989; Berggard and Beam, 1968]. Tumor necrosis factor (TNF)-a, which is a 17 kD polypeptide produced mainly by cells of monocyte/macrophage lineage, has been implicated in the pathogenesis of both local and systemic inflammatory reactions [Dofferhoff et aI., 1991]. Interest has been focused mainly


on patients with septicemia and/or shock and TNF-a has been shown to act in synergy with IL-l in producing tissue damage and shock as a response to infection or thermal injuries [Fong and Lowry, 1990]. The most potent known inducer ofTNF-a production is endotoxin from Gram-negative bacteria but other pathogens or stimuli have also been found to be capable of inducing secretion of TNF-a [Dofferhoff et aI., 1991; Fong and Lowry, 1990; Saukkonen et aI., 1990; Tracey et aI., 1989]. Of relevance to meningitis, TNF-a may be produced by astrocytes and microglial cells [Robbins et aI., 1987; Frei et aI., 1987], and cause vascular endothelial damage by alteration of endothelial homeostasis [Nawroth and Stem, 1986] and increase the vascular permeability leading to leakage [Tracey et aI., 1987]. This agrees with the findings that the CSF levels of TNF-a correlated with the degree of blood brain barrier damage [Sharief et al., 1992]. Thus, this cytokine acts as an inflammatory mediator in meningitis. Corticosteroids which inhibit the production of TNF-a in vitro [Mustafa et aI., 1989], have been found to have a beneficial effect on the clinical outcome of meningitis due to H. influenzae [McCracken and Lebel, 1989; Odio et al., 1991]. Therefore, it has been claimed that TNF-a may cause worsening of the inflammation and increase the severity of bacterial meningitis [Saez-Llorens et aI., 1990]. Several reports have established that TNF-a is elevated in CSF from many patients with acute bacterial meningitis whereas normal CSF levels of the substance have been found in CSF from children with aseptic meningitis [Leist et aI., 1988; Waage et aI., 1989; Nadal et al., 1989; McCracken et al., 1989; Mustafa et al., 1990; Ramilo et aI., 1990]. However, it is not clear whether or not determination of TNF-a in CSF may add further information related to the routinely used CSF parameters for the distinction between bacterial and non-bacterial meningitis. Interferon (IFN)-y is produced by T-helper cells type 1 and cytotoxic T-lymphocytes following antigenic stimulation as well as IL-2 exposure. In addition to its antiviral capacity and well-demonstrated effects on the activity of macrophages against intracellular microbes, IFN-y also enhances the function of polymorhonuclear leukocytes (PMNL) and monocytes against bacteria and fungi [Murray, 1988 and 1990]. Natural killer and B-cells, and

11 expression of HLA antigens class I and II are also stimulated by IFN-y [Murray, 1988]. Of importance in meningitis is that IFN-y enhances or induces the expression of class II histocompatibility antigens in macrophages [Fierz et al., 1985] and endothelial cells [Vesikari and Vaheri, 1968]. Local production of IFN-y in CSF has been observed in viral meningitis in mice [Frei et al., 1988] as well as in humans with herpes simplex encephalitis [Lebon et al., 1988] and enteroviral meningitis [Raymond et al., 1992]. Since IFN-y was not detected in the majority of cases with purulent bacterial meningitis [Raymond et al., 1992], measurement of this


cytokine has been suggested to be helpful in discriminating between viral and bacterial meningitis.

Etiology of aseptic meningitis Enteroviruses have been estimated to account for up to about 80 % of aseptic meningitis cases where an etiology can be determined [CDC, annual report, 1979]. The proportion of etiologically undiagnosed cases has, however, been as large as 45 - 80 % [Skoldenberg, 1972; CDC annual report, 1979]. In the survey in Stockholm 1955 - 1964 performed by Skoldenberg 34 % out of the 1 878 cases, with meningitis as the main manifestation, were caused by enteroviruses [Skoldenberg, 1972], and in a study of 111 patients in New York 1982 enteroviruses were detected in 41 % [Chonmaitree et al., 1982]. When recently developed serological assays for enterovirus were added to the diagnostic arsenal enterovirus diagnoses were obtained in up to about 70 % of individuals with aseptic meningitis [Bell et al., 1986; Day et al., 1989; Glimaker et al., 1990]. Mumps virus which earlier was an important etiological agent in aseptic meningitis has, since the introduction of immunization against it in the early 1980s, almost disappeared from the stage in Sweden. HSV type 2, VZV, tick-borne encephalitis (TBE) virus, Epstein-Barr virus (EBV), adenovirus and influenzavirus as well as the bacteria, Borrelia burgdorferi , Mycoplasma pneumoniae and Mycobacterium tuberculosis, may also cause aseptic meningitis

in Sweden. With the development of antiviral drugs, meningitis due to HSV is nowadays treatable. This indicates the importance not only to differentiate between purulent bacterial and aseptic meningitis but also to identify the etiological agent in cases with aseptic meningitis. Non-steroid anti-inflammatory drugs, trimethoprim and other drugs are also possible inducers of aseptic meningitis [Marinac, 1992]. Table III lists different etiologies of aseptic meningitis worldwide.

12 Table III. Different etiological causes of aseptic meningitis or meningoencephalitis.


Viruses

Enteroviruses Mumps Herpes simplex types 1 and 2 Varicella- zoster Epstein-Barr Lymphocytic choriomeningitis Arboviruses tick-borneeastern equinewestern equineSt. LouisCalifornia-encephalitis

Bacterial spirochets

Fungi

M. tuberculosis

Protozoa/metozoa/ Drugs/ rickettsia intoxication

Cryptococcus Malaria Toxoplasmosis Leptospirosis Amoebiasis T. pallidum Histoplasma Cysticercosis M. pneumoniae Coccidioides Trichinosis Incompletely treated Blastomyces Rocky mountain purulent infection spotted fever Brain abscess Parameningeal infection

B. burgdorferi

Candida Nocardia

Systemic diseases

Ibuprofen Sarcoidosis Trimethoprim- Hyperglobulinsulphamet. emia Azathioprine Collagen diseases Sulindac Neoplasms Tolmetin Endocarditis Trimethoprim Porphyria Intoxication with salicylates barbiturates heavy metals

Adeno Influenza

mv

Bunya

Enteroviruses Virology Enteroviruses comprise a major subgroup of picomaviridae and include the polio- (3 serotypes), coxsackie A- (23 serotypes), coxsackie B- (6 serotypes), echoviruses (31 serotypes), and more recently discovered agents that simply are called enteroviruses (5 serotypes; enterovirus 68 - 72) [Grandien et aI., 1988]. Thus, altogether 68 different serotypes of enterovirus have been detected. Enterovirus 72, which is identical with hepatatis A virus, is only minimally related to the other enterovirus serotypes and a reclassification of this virus would be appropriate [Cohen et al., 1987]. Otherwise, the different enterovirus types are all morphologically similar having a naked, spherical nucleocapsid, 22 - 30 nm in diameter, with icosahedral symmetry. A single-stranded, plus-sense RNA of about 7500 nucleotide bases constitutes the genome. The viral capsid contains 60 capsomers which are built up by four major polypeptides, viral protein (VP) 1 - 4. Different epitopes on the virion surface have type specific and/or group specific antigenic characteristics. The major antigens are: 1) epitopes responsible for inducing neutralizing antibodies, located on VP 1 - 3; 2) complement fixing antigen which is cross-reactive within the enterovirus group; 3) typespecific epitopes; 4) group-specific antigens. Some antigenic homologies, based on complement fixation, exist between different enterovirus serotypes [Grandien et al., 1989]. Enteroviruses may be distinguished from their generic relatives, rhinoviruses, by their resistance to acid pH, ether and bile, lower buoyant density in cesium chloride and by the fact

13 that they replicate better at 37 than at 33°C. Enteroviruses are relatively resistant to many common disinfectants such as 70 % ethanol and phenol. The viruses are, like other picornaviridae, thermolabile and inactivated by ultraviolet light, but stable at freezing temperature for many years.

Clinical features Enteroviral infections are, in temperate climate, far more common during the late summer and early fall than during the rest of the year. The viruses mainly affect children and young adults. Beside the CNS enterovirus may cause symptoms from a great variety of different organ systems (Table IV). Subclinical infections are very common but at the other end of the


spectrum severe generalized sepsis-like conditions can occur, especially in infants. Paralytic disease and encephalitis have been caused by non-polio enteroviruses as well [Grist et al., 1978]. Recent studies have suggested that latent or chronic enterovirus infections may be associated with dilated cardiomyopathy [Bowles et aI., 1986; Muir et al., 1990] and chronic fatigue syndrome [Yousef et aI., 1988; Gow et al., 1991]. Some investigators have also claimed that the viruses may playa role in the development of juvenile diabetes mellitus [King et al., 1983; Jenson and Rosenberg, 1984; Frisk et aI., 1985]. Table IV. Clinical syndromes reported to be associated with enteroviral serotypes [from Grist et al., 1978 and Ray, 1990]. Coxsackievirus types Syndrome

Group A

Aseptic meningitis, encephalitis 1-10, 14, 16-18,22,24

Echovirus and enterovirus (E) types GroupB 1-6

1-7,9, 11, 14-22,30, 31, 33, E71

Paralyticdisease

4,6,7,9, 11, 14,21

1-6

1-4,6, 7, 9, 11, 14, 16, E70, E7l

Cerebellar ataxia

2,4,7,9

3,4

4,6,9

1-5

3,6,9, 11, 14, 17, 19

Generalizeddisease(infants) Exanthems and enanthems

1-10, 16,22

1-5

1-7, 11, 14, 16, 18, 19,25,30,32, 33, E71

Pericarditis, myocarditis

4, 16

1-5

1, 6, 8, 9, 19, 22

Epidemic myalgia (pleurodynia) 4,9,10

1-5

1,6,9

Respiratory symptoms

2,9, 10, 16,21, 24

1-5

1 ,4,9, 11, 19,20,22

Conjunctivitis

24

1,5

7,E70

Orchitis

4

14

Diagnostic techniques for enteroviruses Several studies have emphasized that 20 - 75 % of patients with aseptic meningitis due to enteroviruses show a predominance of PMNL in the initial CSF sample [Gray et aI., 1969; Karandanis and Shulman, 1976; Singer et al., 1980; Feigin and Shackelford, 1973]. Furthermore, CSF glucose levels well below 50 % of the blood glucose concentration and CSF protein contents of more than 1 gil may also be found in patients with enteroviral meningitis [Singer et aI., 1980; Avner et aI.,1975; Kinnunen et aI., 1987; Malcom et aI., 1980]. These facts and the increasing possibilities to treat aseptic meningitis (e.g. due to HSV or B. burgdorferi) make it important to establish an etiological diagnosis early in the course of disease. Thus, it has been shown that confirmation of an enteroviral etiology early in the Downloaded by [RMIT University Library] at 01:08 25 April 2016

course of meningitis may eliminate unnecessary investigations and therapy, and also shorten the duration of hospital stay [Chonmaitree et aI., 1982, Wildin and Chonmaitree, 1987]. Virus isolation Since its inception more than 40 years ago, virus isolation in cell culture continues to be the mainstay of enteroviral diagnosis. Most serotypes of enterovirus can be propagated in cell culture, e.g. HeLa-, green monkey kidney (GMK)-, rhabdomyosarcoma (Rd)-, Vero E6- and Ma 104-cells [Grandien et aI., 1989]. A cytopathogenic effect, typical for enteroviruses, may be observed after 2 - 13 days. Reported mean isolation times for enterovirus from CSF range from 3.7 to 8.2 days [Chonmaitree et al., 1982; Jarvis and Tucker, 1981]. However, as many as 25 to 35 % of the enterovirus serotypes, particularly the coxsackievirus A group, do not grow in cell culture [Chonmaitree et aI., 1982; Lipson et al., 1988; Wildin and Chonmaitree, 1987]. The latter can be identified by inoculation in suckling mice, a technique too cumbersome to be widely used. Thus, a lack of sensitivity of virus isolation is well recognized in many coxsackie A virus serotypes and may exist also regarding other serotypes of enteroviruses. The virus isolation technique is labor intensive and requires a high level of experience. During meningitis the enteroviruses may be isolated from CSF, feacal and throat samples. In the study of 2 488 cases with aseptic meningitis in Stockholm 1955 - 1964 Skoldenberg [Skoldenberg, 1972] found, in collaboration with the Central Microbiological Laboratory, an enterovirus isolation rate of 19 % in CSF and 28 % in stool samples. In New York in 1982 Chonmaitree et ai. [Chonmaitree et aI., 1982] isolated enterovirus from CSF in 46 out of 111 (41 %) patients with aseptic meningitis. Higher proportions of isolation verified enterovirus cases with meningitis have been observed during enterovirus epidemic situations [Hinuma et al., 1966; Kinnunen et al., 1987; Glimaker et al., 1990].

15

Serological assays The serological diagnosis of enteroviral infection has for many years been based on the complement fixation test (CFT) and neutralization test (NT) but during the last decade several other techniques have been developed and evaluated. During the course of enteroviral infections antibodies directed against antigens, present on the virions (N-antigen) as well as the empty capsid (procapsidlheated virions: H-antigen), are produced. In the very young child, with limited experience of enteroviral infections, the antibody response to both antigens is restricted to the infecting type. This antibody response is detected by type specific serological assays like NT. With repeated exposure to closely related enterovirus serotypes the response to the N-antigens remains type narrow whereas antibodies


of broader reactivity to H-antigens appear [Schmidt et al., 1968]. The spectrum of antibodies formed will be influenced by the patient's previous experience of related antigens and the antigen composition of the infecting serotype. Assays based on purified virions as antigens (N-antigens) will primarily show homotypic reactions [Torfason et al., 1984; Frisk et al., 1984 and 1989] whereas the use of heat-treated (H) antigens renders the assay more broadreactive [Frisk et al., 1989; Samuelson et al., 1990; Boman et al., 1992]. For serological diagnosis of enterovirus infections an assay of broad reactivity within the enterovirus group is desired since many different serotypes exist. Demonstration of a titre rise of enterovirus specific antibodies between acute and convalescent sera indicates a current enteroviral infection. This may be accomplished by NT or CFT. As NT is type narrow, many serotypes of enterovirus have to be included as test antigens which makes the test laborious. However, NT may contribute with etiological support in cases with meningitis where an enterovirus has been isolated from a faecal or throat sample but not from CSF, or may be used as a diagnostic tool during epidemics with known enterovirus serotypes. The CFT based on H-antigens is broad-reacting but the sensitivity has not been quite satisfactory [Skoldenberg, 1972; Kinnunen et al., 1987; Grandien et al., 1989]. Detection of enterovirus specific IgM enables an early serological diagnosis of a present or recent enteroviral infection. Different assays for the detection of heterotypic enteroviral IgM antibody responses have been reported [Schmidt et al., 1973; Minor et al., 1979; El-Hagrassy et al., 1980; King et al., 1983; Dorries and ter Meulen, 1983; Morgan-Capner and McSorley, 1983; Pozzetto et al., 1986; Magnius et al., 1988; Frisk et al., 1989; Samuelson et al., 1990; Boman et al., 1992]. All-capture EIA of broad reactivity has been described [El-Hagrassy et al., 1980; King et al., 1983] as an early diagnostic test for enterovirus infections. This test, that showed high sensitivity in patients with aseptic meningitis [Bell et al., 1986], is however time consuming. We have recently developed all-capture EIA technique based on H-antigens, which showed a sensitivity of 0.75 using virus isolation as reference method [Samuelson et al., 1990]. Previous studies have indicated that the solid phase reverse immunosorbent test

16 (SPRIST) [Magnius et aI., 1988] is useful for the diagnosis of enterovirus myocarditis [Vikerfors et aI., 1988] and meningitis [Glimaker et al., 1990]. Different IgG-EIA techniques have been developed for the diagnosis of enterovirus infections [Dorries and ter Meulen, 1980; Katze and Crowell, 1980; Frisk et aI., 1984; Torfason et al., 1988; Samuelson et al., 1990; Boman et al., 1992] but none of these assays have been evaluated in aseptic meningitis.

Electron microscopy and antigen detection Enteroviruses may be detected by electron microscopy but the sensitivity is not satisfactory. The technique may, however, be useful by its ability to detect enteroviruses after propagation Downloaded by [RMIT University Library] at 01:08 25 April 2016

in cell culture which may be of diagnostic help if the cytopathogenic effect in virus isolation is not typical for enterovirus. The absence of a widely shared antigen has hampered the development of immunoassays for enteroviral antigen detection [Herrmann et al., 1979; Yolken and Torsch, 1980 and -81]. Recent reports of shared VP3 antigens among many serotypes [Romero et aI., 1986] and of a monoclonal antibody that cross-reacts with the VPl capsid protein of multiple serotypes (Yousef et al., 1987] were promising. However, further evaluation to confirm these observations and determine the clinical relevance of these tests is lacking.

Genomic assays Although the complete nucleotide sequences of all enterovirus serotypes have not yet been determined, certain sequences in the 5' non-coding region have been found to be highly conserved in all the enteroviruses sequenced to date [Young 1973; Hyypia et aI., 1984 and 1987; Rotbart et al. 1985, 1988 and 1991; Tracy et al1985; Iizuka et al., 1987; Jenkins et al., 1987; Newman et al. 1989; Bruce et al. 1989; Chang et al. 1989; Takeda 1989; Petitjaen et al. 1990]. Thus, nucleic acid techniques for group specific enterovirus diagnosis hold great promise. Enteroviral RNA has been identified utilizing complementary DNA- or RNA-probes in different specimens including CSF and stool samples from patients with enterovirus infections [Hyypia et al., 1984, Rotbart et al. 1988, Cova et al. 1988, Tracy et al. 1990, Petitjaen et al. 1990]. The sensitivity of these assays have, however, not been high enough (Table V). By performing a hybridization technique after biologic amplification of the virus in cell culture an improved sensitivity was observed [Rotbart, 1991]. The hybridization assay yielded positive results about 20 hours before a cytopathogenic effect was noticed in cell culture. Attempts with coxsackie A serotypes, that were not cytopathogenic in cell culture, did not result in any detectable hybridization signals. Thus, this technique does not seem advantageous compared to virus isolation. The polymerase chain reaction (PCR) technique has made it possible to rapidly amplify nucleic acid by 5 to 6 logs in a few hours [Saiki et al. 1985, Mullis et al. 1987]. This

17 technique, which is gaining widespread use in the field of virology [Eisenstein, 1990], is based on the repetitive cycling of three simple reactions, the conditions of which vary only regarding the temperature of incubation. All three reactions occur in the same small tube and with temperature-stable reagents; the repetitive cycling is therefore self-contained and can be fully automated. In addition to the target DNA to be amplified, the important reagents are two single-stranded oligonucleotides (""primers"), synthesized to be complementary to known sequences of the target DNA, larger amounts of the four deoxyribonucleoside triphosphates (dNTP), and the heat-stable Taq DNA polymerase which is isolated from the thermophilic bacterium Thermus aquaticum . The first step is the heat denaturation of native doublestranded DNA resulting in two single strands. As the temperature is lowered to 40 - 55°C in Downloaded by [RMIT University Library] at 01:08 25 April 2016

the second step, the two oppositely directed oligonucleotide "primers" anneal to complementary sequences on the target DNA, which acts as a template. During the third step, performed at about noc, the Taq polymerase enzymatically extends the primers covalently in the presence of excess dNTP. One cycle, which is performed in 2 - 5 min., results in doubling of the number of target sequences and after 30 cycles the target DNA may be amplified million-fold. The polymerase does not work with RNA which means that RNA (e.g. enteroviral RNA) has to be transcribed to DNA. This can be accomplished by reverse transcription but often results in a loss of target sequences. Another drawback in genomic diagnostic tests for RNA-viruses is that RNA is less stable than DNA and that many body fluds (e.g. CSF) contain RNA-endonuclease (RNase) which degrades free RNA [Rotbart et al., 1987]. Thus, it is of utmost importance to preserve the virions intact until analysis (by freezing the specimen) and to add an RNase inhibitor during the extraction of RNA and the reverse transcription. The use of the PCR technique has resulted in sensitive assays which have been successfully utilized for the diagnosis of enterovirus meningitis. Thus, Rotbart detected enteroviral RNA in CSF from 12 patients with aseptic meningitis from whom an enterovirus was isolated in nine cases [Rotbart 1990 a+b]. The protocol with double phenol-chloroform extraction is cumbersome and combined with the large number of cycles in the PeR (30 + 30) the methodology involves a liability for contamination according to our experience. By using the same primers, enteroviral RNA was also detected by Thoren et al. in serum from seven of 12 patients with enteroviral meningitis [Thoren et al., 1992] (Table V). Abebe et al. have recently presented a PCR technique by which all 27 different enterovirus serotypes were detected in faecal samples from altogether 89 patients [Abebe et al., 1992]. However, none of these PCR techniques have been evaluated in a large and etiologically well characterized patient material.

18


Table V. Genomic assays for detection of enteroviral nucleic acid in clinical samples. Reference

Year

Assay(s)

Probe(s)

Specimen(s)

Sensitivity

Hyypia et aI.

1984

Dot blot hybridization

Coxsackie B3 cDNA

Stool

0.13

Cova et al.

1988


Polio 1 RNA

Stool

0.26

Rotbart

1989


Polio 1 and coxsackie B3 cDNA

CSF

0.33

Petitjean et aI.

1990


Polio 1 RNA

Stool 0.33 CSF 0.025 Throat and nasal 0.18

Rotbart et aI.

1990

PCR + dot blot hybridization

Oligomer

CSF

1.0

Thoren et aI.

1992

PCR + slot blot hybridization

Oligomer

Serum

0.58

Abebeetal.

1992

PCR + slot-blot hybridization

Oligomer

Stool

1.0

19

Aims of the study This study was conducted in order to: 1. Evaluate the diagnostic potential of determination of neopterin, 6-2 microglobulin and tumor necrosis factor-a in meningitis;


2. Evaluate new serologic techniques for the diagnosis of enteroviral meningitis; 3. Develop and evaluate PCR-assays for diagnostic purposes by detection of enteroviral RNA in stool and CSF from patients with meningitis.

20

MATERIAL Patients During the 5-year-period from January 1985 to December 1989 a total of 164 patients with aseptic meningitis were treated at the Department of Infectious Diseases, Orebro Medical Center Hospital, Sweden. The inclusion criteria for participation in the prospective study were symptoms indicative of aseptic meningitis, pleocytosis (>5 x 106 leucocytesll) in CSF and negative culture for bacteria and fungi in blood and CSF. Seventyeight patients were females and 86 were males. The median age was 27 years (range 3-82). The median duration from


onset of symptoms to admission to hospital was 3 days (range 0-13). The majority of the cases occurred in the late summer and in the autumn (Figure 1). 30 25

~ 20

.~

5 x 106 leukocytes Il) and positive bacterial culture in CSF. All these 57 individuals were included in paper II and 14 of the cases with purulent bacterial meningitis were also included in paper I. Four patients with HSV-2 meningitis attending Danderyds Hospital, Stockholm during the period 1988-1992 (samples kindly provided by Dr E. Aurelius) were included in paper I. All clinical samples were stored at -200C and transported frozen to the laboratory.

22 Table VII. Sex distribution, median (range) age and duration from onset of meningeal symptoms to sampling of CSF in 61 patients with bacterial meningitis included in paper II. Etiology

Number of patients

Females /males

Age (years)

24 14 7 6a 51

16/8 6/8 1/6 4/2 27/24

2 64 22 62 20

6 4

2/4 3/1

Onset of symptoms to sampling of CSF in days (range)

Bacterial meningitis

Haemophilus injluenzae Streptococcus pneumoniae Neisseriameningitidis Other bacteria Subtotal


Mycobacterium tuberculosis Borrelia burgdorferi

(0-77) (0-90) (15-81) (0-83) (0-90)

46 (27-89) 48 (16-64)

1 2 1 5 1

(0-3) (0-4)

(0-2) (1-30) (0-30)

12 (7-27) 14 (10-30)

a 1 Staphylococcus aureus, 1 S. epidermidis, 2 Listeriamonocytogenes, 1 Escherichia coli, and 1 Pasteurella

multocido

Control groups (Papers I, II and VI) CSF was sampled, before administration of spinal anesthesia, from 20 individuals without CNS symptoms but who were undergoing surgery outside the CNS and spinal room. The median age of these individuals was 62 (range 51-69) years. Serum was sampled from another group of 20 healthy individuals with a median age of 43 (range 20-60) years. The study was approved by the ethical committee of Orebro Medical Center Hospital and informed consent was obtained from all individuals included in the study according to the Helsinki declaration.

23

METHODS Determination of neopterin, 6-2M, TNF -o and IFN -'¥ (Paper

I and II)

Neopterin (Paper I) was analysed by a radioimmunoassay (Neopterin-RIAcid, Henning Berlin GMBH, Germany). The upper normal limits for neopterin have, according to the manufacturer, been estimated at 10 nmol/l in serum and 3.4 nmol/l in CSF [Fredriksson et al., 1987; Honlinger et al., 1989]. 8·2M (Paper I) was assayed by a competitive EIA as previously described Hemmingsen and Skaaru, 1985; Strannegard et al., 1987]. Polystyrene microplates (Nunc, Roskilde, Denmark)


were used as solid-phase and the wells were coated with rabbit anti-human B-2M (Dakopatts, Denmark) at pH 9.6. Horse-radish peroxidase-conjugated rabbit anti-human B-2M was used as second antibody. The upper normal limits for B-2M in serum and CSF increase with age. Normal ranges for B-2M reported in the literature are 0.6-3.0 mg/l in serum [Evrin and Wibell, 1972] and 0.3-3.1 mg/l in CSF [Peterslund et al., 1989]. The ranges for reliable measurements were 0.5-729 nmol/l and 0.5-13 mg/l for neopterin and B-2M, respectively. Standard curves were performed in duplicate with good reproducibility for both substances. TNF·a (Paper II) was measured by a TNF-a-IRMA kit (Medgenix, Brussels, Belgium) according to the instructions of the manufacturer. Briefly, the lower-inner surface of plastic tubes were coated with monoclonal antibodies directed against specific epitopes on TNF-a. After addition of the samples and 1251-labelled anti-TNF-a antibodies, the tubes were incubated for 16-20 hours at room temperature and washed carefully. Bound radioactivity was counted in a y counter for 60 seconds. A standard curve was performed in duplicate for each run. Due to limited amount of specimens, the CSF samples from patients with bacterial meningitis were diluted 1 in 5 whereas the non-bacterial CSF and the sera were diluted 1 in 2. IFN-y was analysed by an enzyme-amplified sensitivity immunoassay (EASIA; Medgenix). Incubations with serum standards and conjugate were done according to the manufacturer except that the substrate activation by horse-radish peroxidase was measured by chemoluminiscence (Lumiscan; Labsystems, Tyreso, Sweden) as previously described [Linde et al., 1992]. The results were expressed in international units per ml after comparison with the standards for IFN-y included in the test.

24

Virus isolation (Paper I-VI) Virus isolation on GMK- and Rd cells were performed from CSF (0.2 ml/tube) in 150 cases. Virus isolation from fecal samples (0.2 ml 10% stool suspension) on GMK-, Rd- and HeLacells was performed in 86 cases. The cells were shown to be free of mycoplasma contaminants by aerobic and anaerobic culture. The cells were read by microscopy the first two days and then every second or third day. The virus isolation was judged as negative if no cytopathogenic effect had been observed after 14 days of culture. The virus isolates were typed by a complement fixation test [Halonen et al., 1958; Grandien et al., 1989].

Serological tests for enterovirus (Paper I-VI) Downloaded by [RMIT University Library] at 01:08 25 April 2016

CFT, using heat-treated (H) antigen preparations of echovirus type 18 and coxsackievirus type B5 [Grandien et al., 1989], was performed on paired sera from the 127 patients from whom paired sera were available. A four-fold titre rise was judged as significant, NT, using a prototype strain of the isolated enterovirus (31 isolation-positive patients) or echovirus type 30 from six isolation-negative patients, was performed on paired sera from 37 individuals as described by Grandien et al, (1989). A five-fold titre rise was judged as indicative of enteroviral infection. IgM-assays (Paper III and IV) SPRIST was performed as previously described [Magnius et al., 1988; Vikerfors et al., 1988]. In brief, IgM from patient serum was captured by anti-human IgM on microhemagglutination plates. Tissue culture antigen containing virions (N antigen) and crossreacting empty capsids (H antigen) from prototype strains of coxsackievirus type B3 and echovirus type 3,5 and 7 were used. The four antigens were added separately. Bound antigen was indicated by hemadsorption of human red blood cells to the solid phase. If hemadsorption occurred with a dilution of patient serum of 1 in 100 or more the result was judged as positive. A significant titre rise or fall was defined as an at least four-fold titre difference between paired sera.

u-capture enzyme immunoassay (EIA) was performed as previously described [Samuelson et al., 1990]. In brief, patient serum diluted 1 in 200 was added to polystyrene microtitre plates, coated with rabbit antihuman IgM. Heat-treated (56 0 C for 60 min.), horseradish-peroxidase conjugated coxsackievirus type A9- or echovirus type 6-antigens (H antigen) were added separately. Bound antigen was indicated by reaction with orthophenylenediamine. The absorbance was read at 492 nm. Cut off was defined as twice the absorbance value of the negative control. An absorbance value above the cut off and at minimum 0.200 was judged as a positive result. A significant titre rise or fall was defined as an absorbance difference of >0.200 between paired sera.

25 IgG assays (Paper IV and VI) EIA using heat-treated antigens (H-EIA). An indirect EIA with the use of heat treated virions of echovirus type 9 and 30, and coxsackievirus type B5 as antigens was developed in the laboratory [Samuelson et al.,1990]. Briefly, antigens were prepared by differential centrifugation, heated at 56°C and coated separately on polystyrene microtitre plates (Maxisorp, Nunc AS, Denmark). Sera diluted 1 in 500 were added in duplicate wells and incubated overnight. Following 90 min. incubation with alkaline phosphatase-conjugated rabbit anti-human IgG, the substrate was added.


EIA using synthetic peptide antigens (P-EIA). The peptides were selected and synthesized, and the assay was performed as described elsewhere [Cello et al., submitted, Samuelson et al., submitted]. In short, three different peptides from viral protein VPl of enterovirus were chosen as antigens. They had the following sequences: PALTAVETGATNPL =El, PALTAAETG =E2 and SRSESSIENF =E4. Polystyrene microtitre plates (Maxisorp, Nunc AS, Denmark) were coated with a pool of the three antigens (pooled antigen) and the El-antigen separately. 100 III of patient serum diluted 1 in 100 and 1 in 500 was added in duplicate wells. Following incubation overnight alkaline phosphataseconjugated goat anti-human IgG was added and after another 90 min. incubation at room temperature the substrate was added. A difference in net absorbance, i.e.sample absorbance minus absorbance of negative antigen control (H-EIA) or of buffer control (P-EIA), of >0.200 between convalescent and acute phase sera was judged as significant in these IgG-EIA techniques.

Genomic tests for enterovirus (Paper V and VI) Polymerase chain reaction (PCR) assay on feacal samples (Paper V) The PCR assay was performed as described elsewhere [Abebe 1991]. Primers and probe: The primers were derived from the 5' non-coding region of the enterovirus genome by use of computer assisted analysis. Two regions of 21 and 26 bases, respectively, showing complete sequence conservation were selected. Amplification of enteroviral cDNA using these primers (BJentl and BJent2) resulted in the synthesis of a 120 base-pair fragment (Figure 2). The probe (BJcoxpro), specific for this amplified product, is positioned at nucleotide number 510 - 538 in the genome of coxsackievirus type B3 and also has specific homology with the genomes of coxsackievirus types Bl, B4 and A9 [data obtained from GenBank]. Five hundred III of stool suspension was treated with Proteinase-K, RNasin and lysis buffer. The nucleic acid was extracted by phenol-chloroform (1:1) and precipitated by ethanol. Extracted RNA was transcribed to cDNA by incubation for 90 min. in the presence of reverse transcriptase. The DNA was then amplified in a thermocycler, using 95°C for

26

NCR

1 kb

3 kb

5 kb

7 kb

7"t'''''''OOO"'::''''''''''=''''''''':''''''':'''''''':OO'OO'OI 5' 445~~~~~ 470 BJent 1

3' 584::i1ll(~~603 Rot2

544111( BJent 2


AAA3'

564

PCRl PCR2 semi-nested

Figure 2. Genomic position and structure of the enterovirus primers (BJentl, BJent2 and Rot2) utilized in the polymerase chain reaction (PCR) assays (pcR 1 in the faeces-PCR and PCR 1+2 in the CSF-PCR) BJentl: 5TCCTCCGGCCCCTGAATGCGGCTAAT3' BJent2: 5'GAAACACGGACACCCAAAGTA3' Rot2: 5'ACCGACGAATACCACTGTIA3'

denaturation, 55°C for annealing of the primers and 72°C as extension temperature.After performing 30 cycles 5 III of the amplified product was subjected to another 10 cycles with the same temperatures.

PCR assay on CSF samples (Paper VI) In order to enhance the sensitivity without jeopardizing the specificity, compared to the PCR technique used for feacal samples, a "semi-nested" primer system was developed by amplifying a larger fragment initially and in a second PCR-run a smaller one. This was accomplished by using the BJentl primer together with the downstream primer used by Rotbart et al. [Rotbart et al., 1988], positioned at nucleotide number 584 - 603 in the genome of coxsackievirus type B3 (Rot2), resulting in amplification of a 159 base pair fragment after the first run (fig. 2). This amplified product was then subjected to another PCR-run by using the BJentl and BJent2 primers resulting in amplification of a 120 base pair fragment.

Extraction of RNA: Fifty III CSF specimen was mixed with 500 III "solution D" (4 M guanidiumthiocyanate, 5 mM sodiumcitrate, 0.1 M 2-mercaptoethanol and 0.5 % Nlauroylsarcosine sodium salt in pyrocarbonate-treated water; pH 5.9), 100 III sodiumacetate (2 M; pH 4.0) and 10 III tRNA (11lg/1l1). Nucleic acid was extracted by adding 500 III phenol and 100 III chloroform. This was vortexed carefully, incubated on ice for 15 min. and centrifuged at 4°C and 12000 G for 20 min. The supernatant and an equal volume of isopropanol was incubated at -200C for at least 1 hour and centrifuged as above. This mixture was together with 150 III solution D and 150 III isopropanol incubated at -20°C for 1 hour

27 and centrifuged as above. The pellet was washed with 1 ml 75 % ethanol which was centrifuged at 1200 G and 4°C for 10 min.. The pellet was dried in vacuum and dissolved in 25 III distilled water with 1 III RNasin. This extraction protocol was shown to be more efficient than the one used for stool samples. Reverse transcription and amplification; 10 IIIof the dissolved pellet was incubated with the following solutions: 1 III 5xRT buffer (pH 8.3), 4 III lOxPCR buffer (pH 8.4), 2 III MgCh, (2 mM), 4 III dNTP (0.1 mM), 1111 RNasin (40 units), 0.5 III reverse transcriptase (25 units), 0.1 III Taq polymerase (0.5 units), 2 III of the primers BJentl and Rot2 (10 pmoles/ul) diluted 1 to 20, and 23.5 III distilled water. The mixture was incubated at


43°C for 60 min. followed by 20 cycles with denaturation at 95°C for 1 min., primer annealing at 45°C for 1 min. and DNA extension at 72°C for 2 min. Five III of this amplified product was added to the following mixtures: 5 III lOxPCR buffer, 2111 MgCI2, 4111 dNTP, 0.2 III Taq polymerase, the primers BJentl and BJent2 diluted 1 to 4, and 28 III distilled H20. This was subjected to 35 cycles with the following temperatures and time intervals; 95°C for 1 min., 55°C for 1 min, and 72°C for 2 min.. Visualization of amplified DNA (Paper V and VI): The amplified cDNA product was

subjected to agarose gel electrophoresis in the presence of ethidium bromide, and visualized by UV-illumination. Phi X 174 digested with HaeIII (Pharmacia, Uppsala, Sweden) was used as molecular weight standard [Maniatis et al., 1982]. A visible band at the 120 base-pair position in the gel electrophoresis was considered indicative of enteroviral RNA. Two samples - a prototype strain of coxsackievirus type B5 equivalent to about 6.5 and 2.5 log tissue culture infective doses 50 % (TCIDSO), respectively, were included in each run of the feaces-PCR as a strongly and a weakly positive control. A prototype strain of echovirus type 30 equivalent to approximatively 2.5 TCIDSO was included in each run of the CSF-PCR as a positive control. To determine the limits of detectability of the PCR assays compared to virus isolation, prototype strains of echovirus type 11 and coxsackievirus type B5 (Paper V), and echovirus type 30 (Paper VI) were titrated (Parker medium) and simultanously tested to establish the TCIDSO in cell culture (microtitre wells) [Grandien et aI., 1989] and the highest dilution (=highest titre) with positive results in the PCR assay. Every fourth sample was a negative control (Parker medium) in order to detect possible contamination. Guidelines for contamination-free routines were strictly adhered to [Kwok et al., 1989]. The samples were coded and the results of both the gel electrophoresis and slot-blot hybridization were read blindly by an independent observer.

28

Non-enterovirus serological assays (Papers I - VI) CF tests for HSV, VZV and mumps virus, M. pneumoniae and Chlamydia, and EIA tests with HSV-2 specific glycoprotein antigen [Olofsson et al., 1986] and HSV type common membrane associated antigen [Jeansson et alI983], were performed on paired sera from 127 patients. A single serum from 153 patients was analysed for EBV infection by ox blood hemolysis antibody test (confirmed by immunofluorescence of EBV viral capsid antigen specific IgM), human immunodeficiency virus (Hl'V) infection by EIA (Abbott laboratories) and TBE by EIA-IgG (FSME-Quick, Immuno AG, Vienna). Positive TBE results were confrrmed with EIA and hemagglutination inhibition test for IgM [Hofmann et al., 1979;


Kunz et al., 1971]. In 146 cases both serum and CSF were available from the day of admission for an EIA for detection of intrathecally produced IgG- and IgM-antibodies to B. burgdorferi [von Stedingk et al., 1990; Olsson et al., 1991]. In six cases with clinical

suspicion of HSV encephalitis EIA tests for intrathecal response against HSV were performed [Mathiesen et al., 1988].

Clinical evaluation A study protocol with a questionnaire about clinical and epidemiological as well as follow-up information was set up prospectively when the study started in 1985. All physicians and nursing personnel at the Department of Infectious Diseases, Orebro Medical Center Hospital were requested to fill in this protocol in all cases with suspected aseptic meningitis. Such protocol was filled in adequately in 80 out of the 164 patients with aseptic meningitis treated during 1985 to 1989. Clinical information about the remaining patients was obtained retrospectively from the patient records by which the demanded information was available in the majority of the cases.

Statistical methods (Paper I - VI) Chi-square analysis, Mann-Whitney V-test, McNemar's test, Student's t-test, simple regression analysis, Spearman's rank correlation test and Wilcoxon signed-rank test were used when appropriate.

29

DEFINITIONS (Paper I-VI) Viral diagnoses Patients with an enterovirus isolated from CSF and/or fecal sample and/or four-fold titre rise in CFf for enterovirus were judged to have enteroviral meningitis. Patients with significant titre rises of enteroviral IgG antibodies measured by H-EIA and/or P-EIA were also defined as enteroviral cases in the papers I, II and VI. HSV-2 meningitis was defined by


seroconversion in EIA with HSV-2 antigen and/or clinical signs of genital HSV-infection in combination with seroconversion in CFf and/or EIA with HSV type common antigen. VZV etiology was defined by 4 fold titre rise in CFf for VZV and/or clinical evidence of VZV infection. All other diagnoses were defined by positive results including confirmation tests as mentioned above or by other extra-CNS symptoms or clinical findings clearly indicating an etiological diagnosis.

Bacterial diagnoses (Paper I and II) Microscopy of Gram-stained smear of CSF as well as routinely used aerobic and anaerobic bacterial culture, including enrichment, was performed on CSF and blood from all patients. The bacterial isolates were identified and typed by routinely used methods. The M. tuberculosis diagnoses were based on culture in Lowenstein medium and the B. burgdorferi diagnoses on detection of intrathecal production of IgM- and/or IgG antibodies specific for this bacteria Purulent bacterial meningitis Patients suffering from meningitis, caused by bacteria other than M. tuberculosis, B. burgdorferi and M. pneumoniae were judged as having purulent bacterial meningitis. Aseptic meningitis Cases with negative results in ordinary bacterial culture from CSF and blood.were designated aseptic meningitis. Thus, cases with B. burgdorferi and M. tuberculosis were allocated to this group.


30

31

RESULTS and DISCUSSION Non-specific diagnostic CSF parameters (Paper I and II) Routinely used CSF parameters Table VIII. Proportions of markedly elevated CSF levels of leukocyte counts and protein, and decreased CSF to blood ratios of glucose concentrations in the total patient material.


Etiology

Non-bacterial meningitis Enterovirus HSV-2 VZV Miscellaneous Unknown Subtotal Purulent bacterial meningitis H. influenzae S. pneumoniae

Leukocytes >500x106 /l a

4/85 2/12 0/5 1/6 6/54 13/162=8%

Protein >1.0 gila

Glucose ratio

Bacterial meningitis. Some aspects of diagnosis and treatment.

Bacterial meningitis.

Enteroviral Meningitis in Neonates and Children of Mashhad, Iran.

Counterimmunoelectrophoresis and bacterial meningitis.

Diagnosis of enteroviral meningitis with the polymerase chain reaction.

The challenge of bacterial meningitis.

Anaerobic bacterial meningitis.

Corticosteroids in bacterial meningitis.

[Recurrent bacterial meningitis].

Changes in bacterial meningitis.

Hypothermia for bacterial meningitis.

Bacterial meningitis in the USA.

Hypothermia for bacterial meningitis.

Deafness after bacterial meningitis.

Serum antibodies and bacterial meningitis.

Clinical and Laboratory Findings That Differentiate Herpes Simplex Virus Central Nervous System Disease from Enteroviral Meningitis.

Acute bacterial meningitis in childhood.

Hypothermia for bacterial meningitis--reply.

Persistent pleocytosis in bacterial meningitis.

Bacterial meningitis in emergency departments.

Surgical management of bacterial meningitis.

Bacterial meningitis in Navojo Indians.

Understanding coma in bacterial meningitis.

Cochlear implant after bacterial meningitis.