Journal of Biotechnology 174 (2014) 1–6

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Enhancing expression of the classical swine fever virus glycoprotein E2 in yeast and its application to a blocking ELISA Chih-Yuan Cheng a,1 , Ching-Wei Wu a,1 , Guang-Jan Lin a , Wei-Cheng Lee b , Maw-Sheng Chien b,∗∗ , Chienjin Huang a,∗ a Graduate Institute of Microbiology and Public Health, College of Veterinary Medicine, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan, ROC b Graduate Institute of Veterinary Pathobiology, College of Veterinary Medicine, National Chung Hsing University, 250 Kuo Kuang Road, Taichung 40227, Taiwan, ROC

a r t i c l e

i n f o

Article history: Received 15 November 2013 Received in revised form 20 December 2013 Accepted 8 January 2014 Available online 24 January 2014 Keywords: Classical swine fever virus Subunit marker vaccine Codon optimization Monoclonal antibody Blocking ELISA

a b s t r a c t Classical swine fever virus (CSFV) infection is a severe swine disease, often causing large economic losses. A Pichia pastoris yeast-expressed CSFV glycoprotein E2 (yE2) has been shown to induce a protective immune response against the virus. To improve the expression level of yE2, the first codon of E2 gene, Arg (CGG), which is the least used in P. pastoris, was optimized to the most favorite codon AGA. The yield of E2 protein was remarkably increased in the codon optimized strain (N342). Three truncated E2 subunits encoding the N-terminal 330 (N330), 301 (N301), and 190 (N190) residues, respectively, were also constructed. The immunogenicity of each recombinant E2 subunits was confirmed by immunization of pigs, and all immunized groups demonstrated high neutralizing antibody titers after boost immunization, which lasted for a long period of time. In addition, a monoclonal antibody (MAb), 1B6, specific to yE2, was generated and shown to recognize CSFV-infected cells. A panel of swine sera were tested by peroxidase-conjugated MAb 1B6-based blocking enzyme-linked immunosorbent assay (ELISA) using N330 as coated antigen, and the assay demonstrated high sensitivity and specificity. The recombinant yE2 subunits may provide potential subunit vaccine candidates and useful diagnostic reagents for CSFV with easy manipulation and low cost. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Classical swine fever virus (CSFV) is a small enveloped virus belonging to the genus Pestivirus of the Flaviviridae family (Lindenbach et al., 2007). CSFV infection results in a highly contagious and severe disease characterized by fever (CSF), often causing large economic losses in the pig industry worldwide. The CSFV genome is a positive sense single-stranded RNA comprising a single, long, open-reading-frame (ORF) that encodes a polyprotein. This polyprotein is co- and post-translationlly processed by cellular and viral protease to yield all final viral proteins. Structural proteins include a nucleocapsid protein C and three envelope glycoproteins, Erns , E1, and E2 (Rümenapf et al., 1993). The glycoprotein E2 represents the most significant target for inducing the production of neutralizing antibodies in the host, and

∗ Corresponding author. Tel.: +886 4 22853906; fax: +886 4 22851741. ∗∗ Co-corresponding author. Tel.: +886 4 22851940. E-mail addresses: [email protected] (M.-S. Chien), [email protected], [email protected] (C. Huang). 1 These authors contributed equally to the article. 0168-1656/$ – see front matter © 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jbiotec.2014.01.007

can also protect pigs against CSF in different ways (Bouma et al., 2000; Dong and Chen, 2007; Hulst et al., 1993). Currently, commercially available CSF E2 subunit vaccines have been developed using the baculovirus expression system (Bouma et al., 1999; de Smit et al., 2001; Moormann et al., 2000), but the required insect cell culture is costly and the purification procedures are time consuming. Recently, we constructed a recombinant E2 protein using the yeast Pichia pastoris secreted expression system. This yeast-expressed E2 (yE2) could induce a protective immune response against lethal challenge infection (Lin et al., 2012, 2009). The advantages of this eukaryotic expression system include simple manipulation, easy purification, and less cost (Cereghino and Cregg, 2000). However, several genetic and physiological factors determine the productivity of a recombinant system (Hohenblum et al., 2003). Synonymous codon usage bias differences, one major factor among others, significantly affects heterologous gene expression (Sinclair and Choy, 2002; Su et al., 2007). To improve the expression yield of yE2, the first codon CGG (Arg) of the E2 gene, which is the least used in P. pastoris, was optimized to the most favorite codon AGA, and several truncated mutants were also constructed and evaluated for their immunogenicities in pigs. The expressed E2 recombinant protein was further utilized as an antigen to generate a monoclonal

2

C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6

Table 1 Sequences of oligonucleotides used for cloning the defined coding region of the CSFV E2 protein. Oligonucleotide

Sequence in 5 –3 directiona

Restriction site

yE2N1F yE2N190F yE2N342R yE2N330R yE2N301R yE2N190R

TTATCGATTAGACTAGCCTGCAAGG GTATCGATTAGACTAGCCTGCAAG CGCTCTAGAAATTCTGCGAAGTAAT CGCTCTAGATCCAGGTCAAACCAGT CGCTCTAGAGTTTTTGCGTAATTGA CGGAATTCTTTCACACATGTCCAG

ClaI ClaI XbaI XbaI XbaI EcoRI

a The sequences recognized by the restriction enzyme are boxed and the first codon of the E2 gene was optimized to AGA and is underlined.

antibody specific to CSFV E2 and establish a blocking ELISA for detecting swine antibodies against E2. 2. Materials and methods 2.1. Construction of recombinant expression plasmids

PVDF transfer membrane (NEN) using semi-dry transfer cell (BioRad) according to the manufacturer’s instruction. The membrane was then treated sequentially with blocking solution (PBS containing 5% non-fat skim milk), with 1000-fold dilution of monoclonal antibody (MAb) WH303 specific to CSFV E2 (Veterinary Laboratory Agency), and 5000-fold dilution of anti-mouse IgG goat antibody conjugated to horseradish peroxidase (Zymed). Finally, the membrane was soaked in a chromogen/substrate solution (TMB single solution, Zymed) for color development. 2.4. Immunization of pigs Fifteen 6-week-old specific-pathogen-free (SPF) piglets were randomly allotted to four E2 subunit immunized groups and a control group (n = 3 for each group). Each piglet was immunized intramuscularly into the neck region with one dose of vaccine twice at 3-week intervals. Each dose of vaccine contained 300 ␮g total secreted proteins of each expressed E2 variants, including the N342, N330, N301, and N190 groups or normal saline (the control group) in a 1:1 water-in-oil emulsion with the adjuvant ISA563 (SEPPIC).

Plasmid pGAPZ␣C/E2dc containing the CSFV E2 gene encoding the amino acid (a.a.) residues 1–342 without the C-terminal transmembrane region of vaccine LPC strain was constructed previously (Lin et al., 2009). The defined coding region corresponding to the a.a. residues 1–342, 1–330, 1–301, and 1–190 of E2 was amplified by polymerase chain reaction (PCR) using the specific primer pair yE2N1F/yE2N342R, yE2N1F/yE2N330R, yE2N1F/yE2N301R, and yE2N190F/yE2N190R, with the first arginine codon changed to AGA, respectively (Table 1). The PCR reaction was carried out as described previously (Lin et al., 2009). The amplified E2 gene fragment was gel-purified and then treated with appropriate restriction enzymes for cloning into the yeast expression vector pGAPZ␣C (Invitrogen) to construct the expression plasmid pGAPZ␣C/E2N342, pGAPZ␣C/E2N330, pGAPZ␣C/E2N301, and pGAPZ␣C/E2N190, respectively. The recombinant E2 proteins were expressed as fusion to a C-terminal peptide containing the myc epitope and a polyhistidine tag. The accuracy of the ORF of the E2 coding sequences was confirmed by DNA sequencing.

Serum blood samples were collected from each pig before vaccination and at biweekly intervals after vaccination. Serum samples were tested for CSFV E2-specific antibodies with a commercial E2 blocking ELISA (HerdChek CSFV Antibody Test Kit, IDEXX Laboratories) according to the manufacturer’s instruction. The CSFV neutralizing antibody titers in serum were determined by the serum neutralization test as described previously (Lin et al., 2009). Replicates of two-fold dilutions of heat-inactivated (30 min, 56 ◦ C) serum samples (50 ␮l) were mixed with 200 TCID50 CSFV LPC strain (50 ␮l) in a microtitration plate, and incubated at 37 ◦ C for 1 h. After adding 1 × 104 PK-15 cells (100 ␮l) and incubating at 37 ◦ C for 72 h, the cells were subjected to immunofluorescence staining with the MAb WH303. Neutralizing antibody titers were presented as the reciprocal of the highest dilution that completely inhibited replication of the virus.

2.2. Expression of E2 protein in Pichia pastoris

2.6. Preparation of the monoclonal antibody against E2

Recombinant expression plasmids were transformed into P. pastoris SMD1168 competent cells using a Pichia EasyCompTM Kit (Invitrogen) according to the manufacturer’s instructions. Transformed cells were then plated onto yeast extract peptone dextrose (YPD; 1% yeast extract, 2% peptone, 2% glucose) agar containing 100 ␮g/ml Zeocin (Invitrogen) and incubated at 30 ◦ C for 2–3 days until single colonies were formed. A single colony of recombinant yeast was inoculated in 5 ml YPD medium and incubated at 30 ◦ C in a shaking incubator (250 rpm) overnight. Then 0.1 ml of the overnight culture was transferred to 50 ml fresh YPD medium in a 250 ml baffled flask and continuously incubated for 4 days. The supernatants were clarified by centrifugation (20 min, 12,000 × g, 4 ◦ C) and the secreted protein was concentrated by ultrafiltration using Centricon YM-10 or 30 (Millipore) filter devices, followed by dialysis against phosphate-buffered saline (PBS). The protein concentration was determined by a Bradford protein assay kit (Bio-Rad).

Five 6-week-old female BALB/c mice were immunized subcutaneously with 100 ␮l of a mixture of 50 ␮g purified N342 and an equal volume of Freund’s complete adjuvant (Sigma). A similar immunization was given 2 weeks later using Freund’s incomplete adjuvant. After an additional 3 weeks, the immunized mice intraperitoneally received a final booster with 200 ␮l of 30 ␮g purified N342 without adjuvant. The fusion was carried out 5 days later according to the methods described previously (Huang et al., 1994). The hybridoma secreting specific antibody to E2 was selected by ELISA and further characterized by indirect immunofluorescence (IIF) analysis with CSFV-infected PK-15 cells (ATCC-CCL33) as described previously (Wu et al., 2013). The subclass of the MAb was determined by Mouse MonoAb-ID kit (Zymed).

2.3. Western blotting analysis Yeast-secreted proteins were treated in equal volumes of the unreduced 2× sample buffer (125 mM Tris–Cl [pH 6.8], 20% glycerol, 4% SDS, 0.25% bromophenol blue). Proteins were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred by electroblotting onto PolyScreen

2.5. Serological examination

2.7. Preparation of horseradish peroxidase (HRP) linked MAb against E2 conjugate The MAb was purified by the Protein A/G affinity column (Pierce) followed by conjugating with HRP using SureLINKTM Activated HRP (KPL) according to the manufacturer’s instruction. 2.8. Blocking ELISA for detecting antibody against E2 ELISA plates (Corning) were coated at 4 ◦ C overnight with 50 ␮l of 1 ␮g/ml purified N330 in coating buffer (carbonate buffer, pH

C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6

3

Fig. 1. Schematic diagram of the expressed coding regions of E2 recombinant subunits. Bars represent expressed coding sequences. The amino acid residue numbers at both termini and the first codon for arginine are indicated. Potential glycosylation sites are indicated by an asterisk, and the epitope recognized by the MAb WH303 is indicated by a gray box. The conformational antigenic domains B ± C and D ± A characterized by van Rijn et al. (1994) are also showed.

9.6). The plate was then thoroughly washed with PBS containing 0.05% Tween-20 (PBST) and blocked with PBS containing 3% bovine serum albumin (BSA) 37 ◦ C for 1 h. After washing, each well received 50 ␮l of 2-fold dilution of tested swine serum in dilution buffer (PBS containing 1% BSA) and was incubated at 37 ◦ C for 1 h. Subsequently, the plate was thoroughly washed with PBST and each well received 50 ␮l of 500-fold dilution of HRP-MAb anti-E2 conjugate in dilution buffer at 37 ◦ C for 45 min. Finally, the plate was washed with PBST three times and PBS twice. Then, 100 ␮l of freshly prepared chromogen/substrate solution (ABTS single solution, Zymed) was added into each well and the plate was incubated at room temperature for 15 min. The optical density (OD) of each well was read at 405 nm using a microplate reader (MRXII, Dynex). Each sample was analyzed in duplicate, and the mean OD value of each tested sample (ODTEST ) and that of the negative control (ODNEG ) were calculated. The inhibition percentage of each sample was calculated according to the following formula: Blocking % =

ODNEG − ODTEST × 100 ODNEG

3. Results 3.1. Expression of CSFV E2 protein variants in Pichia pastoris Various coding regions of the CSFV E2 gene with the first arginine codon optimized to AGA were introduced into the genome of

the yeast P. pastoris using recombinant expression plasmids, including pGAPZ␣C/E2N342, pGAPZ␣C/E2N330, pGAPZ␣C/E2N301, and pGAPZ␣C/E2N190 for expressing different E2 recombinant proteins. The yeast ␣-factor signal sequence efficiently channels into a secretion pathway. Schematic diagrams of N342, N330, N301, and N190 are shown in Fig. 1. Expressed recombinant E2 proteins were analyzed by Western blotting analysis with MAb, WH303, specific to E2 (Fig. 2A) N342 and N330 could form homodimers about 110 kDa in size while N301 and N190 predominantly exhibited monomers about 52 and 43 kDa in size, respectively. The expression level of N342 was further compared with yE2 at 24 h-interval for 4 days. Remarkable increases of yield in N342 were revealed during the entire expression course (Fig. 2B). 3.2. Immunization of pigs To evaluate the immunogenicity of various E2 recombinant proteins, three 6-week-old SPF piglets of each group were immunized intramuscularly with 300 ␮g of each total secreted protein. All recombinant E2-immunized pigs showed strong antibody responses and seroconverted to CSFV-E2-specific antibody after booster vaccination, as determined by a commercial E2-blocking ELISA test (40%), while no antibody was detected in the control pigs (Fig. 3A) All of the N342, N330, N301, and N190 groups could mount anamnestic responses following booster vaccination with average neutralizing antibody titers of 1:1789, 1:1448, 1:1708, and

Fig. 2. Characterization of recombinant E2 proteins by Western blotting analysis. The culture supernatant of each recombinant E2 proteins including N190, N301, N330 and N342 were harvested at 96 h (A). For comparison of the expression levels between the yE2 and codon optimized strain (N342), the culture supernatants of N342 and yE2 were harvested at 24 h, 48 h, 72 h, and 96 h, respectively (B). The expressed E2 proteins were separated by 12% SDS-PAGE in the absence of ␤-mercaptoethanol followed by Western blotting analysis with the monoclonal antibody (WH303) specific to E2. The expected E2 protein is indicated by an arrow.

4

C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6

Fig. 3. Time course of ELISA antibody development (A) and neutralizing antibody (B) of variant E2 recombinant proteins immunized pigs after vaccination. All of the pigs received a booster immunization (↓) at 3 weeks post-immunization.

1:2572, respectively that lasted for at least 12 weeks with titers above the protective titer of 1:32 (Fig. 3B). 3.3. Preparation of MAb specific to the CSFV E2 A stable hybridoma secreting antibody reacting specifically with CSFV-infected cells in IIF (Fig. 4A) and yE2 subunits in Western blotting analysis (Fig. 4B) was selected and cloned. This MAb, 1B6, was determined to be the IgG1 subclass type, and also demonstrated neutralizing antibody activity to all three different genotypes of CSFV infection, including strain LPC, 96TD and 94.4, in the neutralization assay (data not shown). The MAb was purified and then coupled with HRP to generate the HRP-anti-E2 (1B6) conjugate.

Fig. 5. Reactivities of swine sera to yE2 (N330) in the blocking ELISA (A) and the comparison to a commercial ELISA kit (B).

3.4. Development of a blocking ELISA for detecting antibody against E2 The optimal concentration of antigen coated on the plate was determined by checkerboard titration. The best positive/negative (P/N) ratio was obtained when the N330 was diluted at a concentration of 1 ␮g/ml, the tested swine serum was diluted at 1:2, and the HRP-anti-E2 (1B6) conjugate was diluted at 1:500 (data not shown). A panel of swine serum samples collected from the Animal Disease Diagnostic Center, National Chung Hsing University (NCHU) were determined by the commercial E2 blocking ELISA kit (IDEXX). Fifty-two sera were tested by N330 and MAb 1B6-based blocking ELISA and the results expressed as blocking % are shown in Fig. 5A The blocking percentages of 17 negative sera ranged from 16.8% to 33.1% with an average of 23.9%, while 35 positive sera ranged from 43.3% to 69.9% with an average of 60%. When the blocking percentage cut-off value was set at 40%, 17 negative sera were

Fig. 4. Characterization of the specificity of the MAb 1B6 by IIF (A) and Western blotting analysis (B). (A) Normal (PK-15) or CSFV-infected PK-15 (CSFV/PK-15) cells were subjected to immunofluorescence staining with the MAb 1B6. (B) Yeast-expressed E2 subunit N190 (lane 1) and N330 (lane 2), and the wild-type yeast-secreted protein (lane 3) were separated by 12% SDS-PAGE followed by Western blotting analysis with 1B6.

C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6

determined as negative and resulted in a specificity of 100%, and all the positive sera were positive with the corresponding sensitivities of 100%. When the cut-off value was set more restricted at 45% or 50%, the sensitivities were slightly decreased to 94.3% (33/35) and 91.4% (32/35), respectively. A correlation coefficient between our established blocking ELISA (NCHU) and the commercial ELISA kit (IDEXX) was determined using the other 40 selected serum samples with even distribution of blocking percentages determined by IDEXX ELISA. A regression line was plotted between the blocking percentages of the corresponding serum sample using Microsoft Excel. High correlation (R = 0.9250) between two ELISAs was demonstrated as shown in Fig. 5B.

5

status of animals that have been vaccinated or CSFV infected (König et al., 1995; Weiland et al., 1992). Currently, commercially available diagnostic ELISA kits mostly use baculovirus-expressed recombinant E2 or Erns as ELISA antigens (Moormann et al., 2000; Windisch et al., 1996). However, the cost of insect cell culture and timeconsumption to purify the expressed product are major concerns. A more economical yeast-expressed Erns (yErns )-based indirect sandwich ELISA was developed in a previous study and demonstrates high sensitivity and specificity (Wu et al., 2011). In the present study, a MAb specific to E2 (1B6)- and yE2 subunit (N330)-based blocking ELISA was established. This assay demonstrates a high sensitivity and specificity, and high correlation with a commercial CSFV E2 blocking ELISA kit. It may offer a useful and inexpensive method for routine diagnosis of swine antibody to E2.

4. Discussion Conflict of interest The yeast P. pastoris has been used as an efficient system for recombinant protein production (Cereghino and Cregg, 2000). Several factors such as gene dosage, promoter activity, codon usage of the expressed gene, and protein processing and folding may influence the expression levels of heterologous proteins (Hohenblum et al., 2004; Outchkourov et al., 2002). Low yield of human endostatin in P. pastoris has been attributed to translational inefficiencies and synonymous codon usage bias which is the more probable cause of the translational barriers (Sinclair and Choy, 2002; Su et al., 2007). According to Zhang et al. (1991), there are eight low-usage codons including AGG (Arg), CGA (Arg), CGG (Arg), CGC (Arg), CCG (Pro), CUC (Leu), and GCG (Ala) in yeast. Among those synonymous codons for Arg, CGG is the least-used (2%), while AGA is the most favored (54%). Few codons of the CSFV E2 gene are low-usage in yeast, though it was successfully expressed in our previous study (Lin et al., 2009). To improve the yield of yE2, the first codon (CGG) of E2 gene was optimized to AGA, and shorter coding regions were also constructed. The expression level of yE2 increased remarkably after the first codon changed (Fig. 2B), while all the truncated subunits demonstrated higher yields especially for N330 (Fig. 2A). Successful translation passed the first codon of the heterologous gene with high frequency and certainly circumvented the bottleneck of the P. pastoris expression system. More rare-usage codons of E2 have now been altered and the expression levels are currently under study. The yeast-expressed E2 (yE2) is capable of inducing a complete protective immune response and preventing horizontal transmission of CSFV, and appears to be a potential subunit marker vaccine (Lin et al., 2012). The immunogenicity of each truncated yE2 recombinant proteins was evaluated by the immunization of pigs. All of the recombinant yE2 subunit-immunized pigs, including N342, N330, N301 and N190 groups, could mount anamnestic responses following booster immunization with high neutralizing antibody titers of an average above 1:1448 (Fig. 3B), that reveals much higher efficacy than yE2-induced averaged neutralizing titer of 1:132 in the previous study (Lin et al., 2009). A quantitative assay for CSFV E2 glycoprotein is currently under construction. In addition, N301 and N190 are present predominantly monomer forms (Fig. 2A), suggesting C-terminal truncation hampers formation of E2 homodimer, and the region of a.a. residues 302–330 is indispensible for dimerization. Moreover, the N-terminal 190 residues, which consist of major conformational antigenic domains, B ± C and D ± A, (van Rijn et al., 1994) retain correct immunogenicity that is capable of inducing a high neutralizing antibody response. Therefore, those recombinant yE2 subunits represent a potential subunit E2 marker vaccine candidate with advantages of easy manipulation and low cost. CSF is an economically important swine disease that has received widespread attention. Detecting antibodies to Erns and E2 in swine serum provides a direct measure of the immune

None declared. Acknowledgement This work was supported in part by grant NSC101-2313-B-005012-MY3 from the National Science Council, Taiwan, Republic of China. References Bouma, A., de Smit, A.J., de Kluijver, E.P., Terpstra, C., Moormann, R.J.M., 1999. Efficacy and stability of a subunit vaccine based on glycoprotein E2 of classical swine fever virus. Vet. Microbiol. 66, 101–114. Bouma, A., De Smit, A.J., De Jong, M.C.M., De Kluijver, E.P., Moormann, R.J.M., 2000. Determination of the onset of the herd-immunity induced by the E2 sub-unit vaccine against classical swine fever virus. Vaccine 18, 1374–1381. Cereghino, J.L., Cregg, J.M., 2000. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol. Rev. 24, 45–66. de Smit, A.J., Bouma, A., de Kluijver, E.P., Terpstra, C., Moormann, R.J.M., 2001. Duration of the protection of an E2 subunit marker vaccine against classical swine fever after a single vaccination. Vet. Microbiol. 78, 307–317. Dong, X.N., Chen, Y.H., 2007. Marker vaccine strategies and candidate CSFV marker vaccines. Vaccine 25, 205–230. Hohenblum, H., Borth, N., Mattanovich, D., 2003. Assessing viability and cellassociated product of recombinant protein producing Pichia pastoris with flow cytometry. J. Biotechnol. 102, 281–290. Hohenblum, H., Gasser, B., Maurer, M., Borth, N., Mattanovich, D., 2004. Effects of gene dosage, promoters, and substrates on unfolded protein stress of recombinant Pichia pastoris. Biotechnol. Bioeng. 85, 367–375. Huang, C., Chien, M.S., Landolt, M., Winton, J., 1994. Characterizatrion of the infectious hematopoietic necrosis virus glycoprotein using neutralizing monoclonal antibodies. Dis. Aquat. Org. 18, 29–35. Hulst, M.M., Westra, D.F., Wensvoort, G., Moormann, R.J.M., 1993. Glycoprotein E1 of hog cholera virus expressed in insect cells protects swine from hog cholera. J. Virol. 67, 5435–5442. König, M., Lengsfeld, T., Pauly, T., Stark, R., Thiel, H.J., 1995. Classical swine fever virus independent induction of protective immunity by two structural glycoproteins. J. Virol. 69, 6479–6486. Lindenbach, B.D., Thiel, H.J., Rice, C.M., 2007. Flaviviridae: the viruses and their replication. In: Knipe, D.M., Howley, P.M. (Eds.), Fields Virology. , 5th ed. Lippincott Williams & Wilkins, Philadelphia, pp. 1101–1152. Lin, G.J., Liu, T.Y., Tseng, Y.Y., Chen, Z.W., You, C.C., Hsuan, S.L., Chien, M.S., Huang, C., 2009. Yeast expressed classical swine fever virus glycoprotein E2 induces a protective immune response. Vet. Microbiol. 139, 369–374. Lin, G.J., Deng, M.C., Chen, Z.W., Liu, T.Y., Wu, C.W., Cheng, C.Y., Chien, M.S., Huang, C., 2012. Yeast expressed classical swine fever E2 subunit vaccine candidate provides complete protection against lethal challenge infection and prevents horizontal virus transmission. Vaccine 30, 2336–2341. Moormann, R.J.M., Bouma, A., Kramps, J.A., Terpstra, C., De Smit, H.J., 2000. Development of a classical swine fever subunit marker vaccine and companion diagnostic test. Vet. Microbiol. 73, 209–219. Outchkourov, N.S., Stiekema, W.J., Jongsma, M.A., 2002. Optimization of the expression of equistatin in Pichia pastoris. Protein Expr. Purif. 1, 18–24. Rümenapf, T., Unger, G., Strauss, J.H., Thiel, H.J., 1993. Processing of the envelope glycoproteins of pestiviruses. J. Virol. 67, 3288–3294. Sinclair, G., Choy, F.Y., 2002. Synonymous codon usage bias and the expression of human glucocerebrosidase in the methylotrophic yeast, Pichia pastoris. Protein Expr. Purif. 1, 96–105. Su, C., Duan, X., Wang, X., Wang, C., Cao, R., Zhou, B., Chen, P., 2007. Heterologous expression of FMDV immunodominant epitopes and HSP70 in P. pastoris and the subsequent immune response in mice. Vet. Microbiol. 124, 256–263.

6

C.-Y. Cheng et al. / Journal of Biotechnology 174 (2014) 1–6

van Rijn, P.A., Miedema, G.K.W., Wensvoort, G., van Gennip, H.G.P., Moormann, R.J.M., 1994. Antigenic structure of envelope glycoprotein E1 of hog cholera virus. J. Virol. 68, 3934–3942. Weiland, E., Ahl, R., Stark, R., Weiland, F., Thiel, H.J., 1992. A second envelop glycoprotein mediates neutralization of a Pestivirus, hog cholera virus. J. Virol. 66, 3677–3682. Windisch, J.M., Schneider, R., Stark, R., Weiland, E., Meyers, G., Thiel, H.J., 1996. RNase of classical swine fever virus: biochemical characterization and inhibition by virus-neutralizing monoclonal antibodies. J. Virol. 70, 352–358.

Wu, C.W., Chien, M.S., Liu, T.Y., Lin, G.J., Lee, W.C., Huang, C., 2011. Characterization of the monoclonal antibody against classical swine fever virus glycoprotein Erns and its application to an indirect sandwich ELISA. Appl. Microbiol. Biotechnol. 92, 815–821. Wu, C.W., Chien, M.S., Huang, C., 2013. Characterization of the swine U6 promoter for short hairpin RNA expression and its application to inhibition of virus replication. J. Biotechnol. 168, 78–84. Zhang, S., Zubay, G., Goldman, E., 1991. Low-usage codons in Escherichia coli, yeast, fruit fly and primates. Gene 105, 61–72.