http://informahealthcare.com/rst ISSN: 1079-9893 (print), 1532-4281 (electronic) J Recept Signal Transduct Res, 2014; 34(6): 476–483 ! 2014 Informa Healthcare USA, Inc. DOI: 10.3109/10799893.2014.920393
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
RESEARCH ARTICLE
Enhanced proliferation and altered calcium handling in RGS2-deficient vascular smooth muscle cells Abdul Momen1, Talat Afroze1, Al-Muktafi Sadi1, Amir Khoshbin1, Hangjun Zhang2, Jaehyun Choi1, Steven Gu2, Syed H. Zaidi1, Scott P. Heximer2*, and Mansoor Husain1* 1
Division of Experimental Therapeutics, Toronto General Research Institute, University Health Network, Toronto, Ontario, Canada and Department of Physiology, Heart and Stroke/Richard Lewar Centre of Excellence in Cardiovascular Research, University of Toronto, 1 King’s College Circle, Toronto, Ontario, Canada
2
Abstract
Keywords
Context: Regulator of G-protein signaling-2 (RGS2) inhibits Gq-mediated regulation of Ca2+ signalling in vascular smooth muscle cells (VSMC). Objective: RGS2 knockout (RGS2KO) mice are hypertensive and show arteriolar remodeling. VSMC proliferation modulates intracellular Ca2+ concentration [Ca2+]i. RGS2 involvement in VSMC proliferation had not been examined. Methods: Thymidine incorporation and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) conversion assays measured cell proliferation. Fura-2 ratiometric imaging quantified [Ca2+]i before and after UTP and thapsigargin. [3H]-labeled inositol was used for phosphoinositide hydrolysis. Quantitative RT-PCR and confocal immunofluorescence of select Ca2+ transporters was performed in primary aortic VSMC. Results and discussion: Platelet-derived growth factor (PDGF) increased S-phase entry and proliferation in VSMC from RGS2KO mice to a greater extent than in VSMC from wild-type (WT) controls. Consistent with differential PDGFinduced changes in Ca2+ homeostasis, RGS2KO VSMC showed lower resting [Ca2+]i but higher thapsigargin-induced [Ca2+]i as compared with WT. RGS2KO VSMC expressed lower mRNA levels of plasma membrane Ca2+ ATPase-4 (PMCA4) and Na+ Ca2+ Exchanger (NCX), but higher levels of sarco-endoplasmic reticulum Ca2+ ATPase-2 (SERCA2). Western blot and immunofluorescence revealed similar differences in PMCA4 and SERCA2 protein, while levels of NCX protein were not reduced in RGS2KO VSMC. Consistent with decreased Ca2+ efflux activity, 45 Ca-extrusion rates were lower in RGS2KO VSMC. These differences were reversed by the PMCA inhibitor La3+, but not by replacing extracellular Na+ with choline, implicating differences in the activity of PMCA and not NCX. Conclusion: RGS2-deficient VSMC exhibit higher rates of proliferation and coordinate plasticity of Ca2+-handling mechanisms in response to PDGF stimulation.
Ca2+, PMCA4, proliferation, RGS2, vascular smooth muscle cell History Received 26 March 2014 Revised 29 April 2014 Accepted 29 April 2014 Published online 20 May 2014
Abbreviations: RGS: regulator of G-protein signalling; MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide; PMCA4: plasma membrane Ca2+ ATPase-4; NCX: Na+ Ca2+ exchanger; SERCA2: sarco-endoplasmic reticulum Ca2+ ATPase-2; PDGF: platelet-derived growth factor; G-protein: guanine nucleotide binding protein; GPCR: G-protein coupled receptor; VSMC: vascular smooth muscle cell; [Ca2+]i: intracellular Ca2+ concentrations; PDGF: platelet-derived growth factor; P2Y2R: purinergic receptor P2Y2; UTP: uridine tri-phosphate
Introduction Heterotrimeric G-protein coupled receptors (GPCR) are ubiquitously expressed throughout the cardiovascular system
*These senior authors have contributed equally to this work. Address for correspondence: Mansoor Husain, University Health Network, Toronto General Hospital Research Institute, TMDT-3-901, 101 College Street, Toronto, Ontario, Canada M5G 1L7. Tel: +1 416 581 7489. Fax: +1 416 581 7489. E-mail: [email protected]
and mediate cellular responses to a myriad of hormones and neurotransmitters (1,2). Hypertension often involves GPCR activation in vascular smooth muscle cells (VSMC), the end-effector cell-type controlling peripheral resistance to blood flow. This can lead to rapid transient increases in vascular constriction, whereas chronic increases in peripheral resistance may be mediated by more permanent vascular remodeling. Some of the most widely used drugs used to lower blood pressure (3) and reduce remodeling of arterial vessels (4) act upstream or at the level of GPCR in VSMC to reduce signal throughput (e.g. angiotensin receptor antagonists).
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
DOI: 10.3109/10799893.2014.920393
‘‘Regulators of G protein signalling’’ (RGS) is a protein superfamily whose members share a 120 amino acid homology domain (RGS domain), accelerate GTPase activity of G protein a subunits, and negatively regulate G protein signalling (5). One such family member, RGS2, is highly expressed in VSMC and is unique among the over 35 other RGS proteins in its ability to both selectively and potently attenuate Gqa-mediated signalling [reviewed in (6,7)]. Rgs2 knockout mice are hypertensive (8–10) and show pathological remodeling of kidney arterioles (9). While numerous studies have investigated the mechanisms whereby increased Gq-dependent Ca2+ signaling in the absence of a specific Gq inhibitor can lead to the enhanced vasoconstrictormediated responses in VSMC (10,11), no study to date has examined the potential effect of RGS2-deficiency on the phenotypic modulation of VSMC. Interestingly, RGS2 has been found to carry out a proangiogenic function in myeloid derived suppressor cells (MDSC) which sculpt the tumor microenvironment through increased vascularisation (12). This study found the target protein that mediates this pro-angiogenic function downstream of RGS2 to be monocyte chemoattractant protein-1 (MCP-1). Rgs2 knockout (RGS2KO) MDSC secreted lower levels of MCP-1, leading to reduced angiogenesis in tumors from RGS2KO mice. Not much is known about the signaling pathways employed by RGS2 in modulating growth of VSMC. In this context, an earlier study found that growth stimulation of VSMC via sphingosine-1-phosphate (S1P) treatment caused an up-regulation of Rgs2 mRNA by utilizing a signaling pathway independent of phosphatidylinositol 3-kinase, protein kinase C, and mitogen-activated protein kinase kinase (13). Coordinate increases in [Ca2+]i are also required for cell cycle progression in VSMC (14) and are achieved through the regulated expression of Ca2+-regulatory genes such as the ubiquitously expressed plasma membrane Ca2+ ATPases (PMCA)-1 and 4 (15–17) and the inositol 1,4,5-trisphosphate receptor type-1 (IP3R1) (18,19), and specific Ca2+-sensitive cell cycle proteins (20). Notably, manipulating expression levels of select Ca2+-regulatory genes can have effects on both VSMC proliferation (15) and vasomotor function (21,22), For example, overexpression of PMCA1 has been shown to inhibit cell cycle-associated increases in [Ca2+]i and G1 to S phase cell cycle progression and proliferation of cultured rat VSMC (15). However, potential links between RGS proteins (with their known ability to modulate Ca2+ transients), and VSMC proliferation had not previously been examined. To address this, we sought to determine the role of RGS2 as a regulator of [Ca2+]i in VSMC under proliferative stimuli. Our results show that chronic exposure to the mitogen platelet-derived growth factor (PDGF) resulted in differential changes in proliferation, and both resting and releasable [Ca2+]i in RGS2KO versus WT VSMC. We also demonstrate unique adaptive changes in the expression and activity of specific Ca2+-regulatory genes in RGS2-deficient cells, including PMCA4, which are consistent with the altered growth characteristics of these cells.
RGS2 regulates VSMC proliferation and PMCA4
477
Materials and methods Animals Mice genetically deficient in Rgs2 (RGS2KO) were kindly provided by Josef Penninger and David Siderovski (23). Mice used in all studies were backcrossed412 generations onto a C57BL/6J background. All animal protocols were approved by the institutional animal care committee. Reagents Unless specified otherwise, all chemicals were purchased from Sigma, Mississauga, ON, Canada. Cell culture conditions Primary mouse aortic SMC were isolated from RGS2KO and wild-type (WT) C57BL/6J mice (Charles River Laboratories, Wilmington, MA) as previously described (24) with modifications (17). Briefly, mice were euthanized with sodium pentobarbital. Descending aortae were collected (3–4 mice/ preparation) in isolation medium (DMEM with 25 mM HEPES, pH 7.4, 100 mg/l gentamicin, 2.5 mg/ml amphotericin B, and 1 mg/ml BSA). In a sterile hood, aortae were cleaned free of fat and connective tissue, and incubated for 30 min at 37 C in isolation medium containing 200 units/ml collagenase type III, 0.1 mg/ml elastase (132 units/mg), and 0.5 mg/ml soybean trypsin inhibitor. Tunica adventitia was removed as an everted tube and the remaining medial tubes were digested further for 45 min, before mincing and final digestion for 1 h. Following the removal of tissue pieces by gravity for 2 min, cells were collected by centrifugation (500 g). Cell pellets were re-suspended in the growth medium (DMEM, 10% FBS, 1% penicillin-streptomycin, 50 mg/l gentamicin, 2.5 mg/ml amphotericin B, and 50 ng/ml PDGF) in T-25 flasks in a humidified atmosphere of 5% CO2, 95% air, at 37 C. At confluence, cells were removed from flasks with a brief trypsin treatment (0.05%), suspended in the culture medium, and split 1:3. Experiments were carried out in cells at 90% confluence, passages 9–10, and in the presence of PDGF-containing medium. In experiments when cells were cultured at passage 0, PDGF was not added to the media. [3H]-thymidine incorporation Primary aortic SMC were seeded in 6 well plates (1 106 per well). The next day, synchronization was achieved by serum starvation (0.25% FBS) for 48 h. Following this, cells were treated with the growth medium containing 50 ng/ml PDGF for 16 h, to which 1 mCi/ml [3H]-thymidine was added for a further 4 h. At the end of the labeling period, cells were harvested and washed. Their incorporation of [3H]-thymidine was quantified by liquid scintillation counting. MTT colorimetric assay Active mitochondria cleave 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) to produce formazan in amounts directly proportional to the number of viable cells, representing thus an index of cell proliferation. Primary aortic SMC seeded in 96-well plates underwent PDGF treatment as
478
A. Momen et al.
J Recept Signal Transduct Res, 2014; 34(6): 476–483
described above. After two washes in PBS, they were incubated for 4 h at 37 C with 1 mg/ml of MTT (in phenol red-free DMEM supplemented with 2 mM L-glutamine and 1 mM sodium pyruvate) in a reaction volume of 100 ml. After the removal of MTT solution, DMSO was added to dissolve formazan crystals. The plate was shaken for 5 min at 55 C for complete dissolution. Dye absorbance in viable cells was measured at 595 nm, with 630 nm used as a reference wavelength.
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
Determination of [Ca2+]i Primary aortic SMC were seeded at low density onto #1 glass coverslips and cultured as described above in 6-well plates. Cells were loaded in culture media with 4 mM Fura-2-AM (Invitrogen-Molecular Probes, Burlington, ON) for 45 min at 37 C, washed, and incubated in PBS without Fura-2 for 10 min at 37 C to allow hydrolysis of the AM ester. Cover slips were mounted in a modified Leyden open-bath chamber (BioScience Tools, San Diego, CA) and imaged on an Olympus IX70 inverted microscope (Carsen Group, Markham, ON) using a 40 objective. Excitation light was provided by a DeltaRam monochrometer, and fluorescence imaging was performed with ImageMaster imaging software via an IC200-B camera (Photon Technologies Inc., London, ON). Cytosolic regions of cells were selected as regions of interest (ROIs). Alternating excitation wavelengths (340 ± 5/ 380 ± 5 nm) were provided at 1 excitation pair per second in conjunction with a 495-nm dichroic mirror and a 510 ± 20-nm emission filter (Chroma Technology Corp., Bellows Falls, VT). Paired images were collected after 100 ms exposure. Fluorescent ratio values for the image pairs were determined for each ROI. Baseline fluorescence ratios (FR) of nonstimulated cells were collected for 30 frames prior to the addition of 100 mM UTP or 2 mM thapsigargin. The percentage increase from baseline FR levels to the peak stimulated FR was calculated. Identical excitation/emission conditions and data collection parameters were maintained for all individual experiments performed in this study. Phosphoinositide hydrolysis assay Gq-dependent inositol phosphate production was measured as described previously (25) with the following modifications. After 24 h labeling with complete DMEM (with 10% fetal bovine serum and without inositol) containing 4 mCi/ml myo[3H]inositol, VSMCs were treated with 200 mM UTP in the presence of 5 mM LiCl. Incubations were carried out for exactly 45 min before stopping the reaction and collecting
total inositol-containing and inositol phosphate-containing fractions. Inositol phosphate levels were expressed as a fraction of the total soluble [3H]-labeled inositol material [inositol phosphate+ total inositol-containing fraction]. Data presented are means of triplicate samples and are representative of three independent experiments. Real-time RT-PCR Total RNA was extracted with Trizol (Invitrogen, Burlington, ON) from primary VSMC from WT or RGS2KO mice. RNA was DNAse-treated and used for reverse transcriptase realtime PCR reaction with microglobulin primers to validate the absence of genomic DNA. Then, cDNA was prepared using SuperScript II (Invitrogen, Burlington, ON) with random hexamers and treated with RNase H. Between 25 and 75 ng of cDNA was used for real-time PCR reactions in an ABI 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) using the SYBR GREEN kit (ABI) and employing primers for GAPDH, RGS2, and Ca2+ regulatory genes PMCA4, SERCA2a/b, IP3R1, and Na+ Ca2+ Exchanger-1 (NCX1; Table 1). Amounts (ng) of each specific mRNA were estimated from the standard curve and all data were normalized to the amount (ng) of the housekeeping gene GAPDH. Data were plotted as fold increases compared with the values of wild-type mice. Statistical analysis employed Student’s t test. Immunofluorescence Primary aortic SMCs cultured on coverslips were fixed, permeabilized, and stained with an anti-SERCA2 antibody (1:100 dilution) (Affinity Bioreagents, Golden, CO) and a Texas Red-conjugated fluorescent secondary antibody (1:500) (Invitrogen-Molecular Probes, Burlington, ON) as previously described (18). Quantification of relative SERCA2 fluorescence was conducted on an Olympus IX/81 Fluoview confocal imaging system (Olympus America Inc., Melville, NY). Briefly, cell boundaries were delineated from 3 or more observation fields on each cover slip (n410 cells from two separate experiments). Cell fluorescent intensity was quantified at 15 planes in 15 mm wide z-stacks using Olympus FV1000 software (Olympus Surgical Technologies, Southborough, MA) as described (26). Western blot Primary aortic SMC from 4 to 6 T-175 flasks were harvested and lysed in 4 ml hypotonic buffer containing 5 mM Tris-Cl, pH 8.0; 1 mM EDTA; 2 mM DTT; 1 mM PMSF; and
Table 1. Primer sequences employed for quantitative gene expression analyses. q-RT-PCR primers Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse
NCX1 forward NCX1 reverse PMCA4 forward PMCA4 reverse IP3R1 forward IP3R1 reverse SERCA2 common forward SERCA2a reverse SERCA2b reverse
Sequence (Ta) ATCTGCGTTGTGTTCGCGTGGGTAG (60 C) TCAATGATCATCCCCCTCTGCTTGC (60 C) ACGTCTTCCCACCCAAGGTTC (60 C) CCAGCAGCCCACACTCTGTC (60 C) AGTTTGGCCAACGATTTCCTG (67 C) GCTTCCTGAGCACGTCTCCTAC (67 C) TGAGACGCTCAAGTTTGTGG (60 C) ATGCAGAGGGCTGGTAGATG (60 C) ACAAACGGCCAGGAAATG (60 C)
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
DOI: 10.3109/10799893.2014.920393
1 COMPLETE protease inhibitor cocktail (Roche, Laval, PQ) with 50–100 strokes in a Dounce homogenizer. After clearing nuclei and debris with a spin at 900 g, the supernatant was centrifuged at 100 000 g for 1 h at 4 C. The microsomal pellet was then resuspended in 0.5–1.0 ml of resuspension buffer (25 mM HEPES, pH 7.5; 150 mM NaCl; 5 mM EDTA; 1 mM mercaptoethanol; 1% Triton X-100; COMPLETE protease inhibitor cocktail; 1 mM PMSF; 1 mM Na3VO4; 1 mM NaF). Membranes were spun again at 1000 g for 5 min at 4 C and supernatants were immediately frozen in liquid nitrogen in aliquots. Protein concentration was estimated with the BCA protein assay (Sigma, Oakville, ON). Microsomal suspension (250–500 mg) was used for immunoprecipitation with anti-PMCA4 (Husain lab developed; (27)), anti-SERCA2 (Affinity Bioreagents, Golden, CO) or anti-NCX1 (Abcam, Cambridge, MA) antibodies, and anti-mouse IgG immobilized to Sepharose (Pierce, Rockford, IL). The immunoprecipitate was resolved on 3–8% NuPage Tris-Acetate gels (Invitrogen, Burlington, ON), blotted, and hybridized with anti-PMCA4, SERCA2, or NCX1 antibodies. Non-immunoprecipitated microsomal proteins were resolved and blotted similarly, hybridized to a monoclonal anti-actin antibody (Sigma, Oakville, ON), and visualized by chemiluminescence. Band intensities were quantified on the BioRad GS800 densitometer using BioRad’s Quantity One software (BioRad, Mississauga, ON). 45
Ca efflux
These studies were conducted as previously described (15) with modifications. Aortic SMC were incubated with culture media containing 10 mCi/ml 45CaCl2 for 1 h at 37 C. Steady-state equilibration of intracellular 45Ca was inferred from maximum 45Ca uptake having occurred by 1 h of loading. Cells were washed five times with PBS to remove extracellular Ca2+. For experiments in which the extracellular Na+ concentration ([Na+]e) was manipulated, NaCl in the efflux solution was replaced with equimolar concentration of choline chloride (145 mM). In experiments involving La3+, 1 mM LaCl3 was added to the efflux solution. The amount of released 45Ca was determined over five consecutive 30-s intervals. Each experiment was repeated three times, with all experimental and control samples run in quadruplicates for each 30 s interval. Efflux data were plotted as an exponential decay of relative starting intracellular 45Ca over time. Statistical analysis Data are reported as mean ± SE. The data were analyzed using one-way and two-way ANOVA with Tukey’s or Dunn’s post-hoc analysis and Student’s t-tests. In all instances, p50.05 was considered significant.
Results RGS2-deficient VSMC exposed to PDGF show increased rates of proliferation To examine the role of RGS2 in the regulation of VSMC proliferation and Ca2+ signaling under conditions that simulate arterial remodeling in vivo, we cultured primary mouse aortic VSMC from wild-type (WT) and Rgs2-deficient
RGS2 regulates VSMC proliferation and PMCA4
479
Figure 1. RGS2KO VSMC show enhanced proliferation in response to PDGF. (A) In each experiment, triplicate wells of VSMC from wild-type (WT) and RGS2KO mice were cell cycle-synchronized (48 h serum starvation and 16 h PDGF stimulation) and labeled with 3[H]-thymidine for 4 h. Total acid-precipitable 3[H] cpm/well were determined for each well; data shown are mean ± SE of three independent experiments. (B) VSMC from WT and RGS2KO mice were seeded in 96-well plates (5000 cells per well), and the MTT assay was performed on subsequent days. Each experimental condition was repeated in quadruplicate; data shown are mean ± SE of three independent experiments. *p50.05 versus WT by two-way ANOVA.
(RGS2KO) mice in PDGF-containing medium for 9–10 passages. Consistent with a role for RGS2 in the suppression of VSMC proliferation, RGS2KO cells showed greater incorporation of 3H-thymidine (Figure 1A), and increased mitochondrial conversion of the MTT substrate to a colorimetric product, an indirect measure of cell number (Figure 1B), when compared with WT controls. As VSMC proliferation is regulated by coordinated control of [Ca2+]i (16,18), and RGS2 is a highly selective inhibitor of Gq-mediated Ca2+ signaling (6,7), we anticipated that altered Ca2+ dynamics may play a role in the increased proliferative response of RGS2KO cells. Ca2+ homeostasis is altered in PDGF-treated VSMC from RGS2-deficient mice To determine whether the accelerated proliferation of RGS2KO VSMC is associated with differences in [Ca2+]i, we used ratiometric imaging of Fura-2AM-loaded VSMC from RGS2KO and WT mice to define basal [Ca2+]i and Ca2+ responses to (i) activation of a G-protein coupled purinergic receptor (P2Y2R), and (ii) blockade of the sarco/endoplasmic reticulum Ca2+ ATPase (SERCA), with UTP and thapsigargin, respectively. Previously, we and others showed that
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
480
A. Momen et al.
J Recept Signal Transduct Res, 2014; 34(6): 476–483
Figure 3. RGS2KO VSMC show altered expression of Ca2+ regulatory genes. Wild-type (WT) and RGS2KO VSMC were cultured at passage 10 in media supplemented with PDGF and the mRNA expression levels of Ca2+ transporters PMCA4, NCX, SERCA2a, SERCA2b, and IP3R1 were measured by quantitative real-time RT-PCR. Absolute quantities of each Ca2+ transporter mRNA (ng) were first normalized to GAPDH mRNA levels. Then, the GAPDH-normalized value of each Ca2+ transporter in RGS2KO cells was divided by the mean GAPDHnormalized value in WT cells to obtain expression values in RGS2KO relative to WT cells. Data shown are mean ± SE (n¼ 3 independent experiments); *p50.01 by Students’ t-test.
Figure 2. RGS2KO VSMC show altered regulation of resting and releasable [Ca2+]i following chronic PDGF treatment. (A) Passage 9–10 VSMC from wild-type (WT) and RGS2KO mice were Fura-2 loaded and stimulated with UTP (100 mM) or thapsigargin (Tg; 2 mM) in the presence of PDGF. Peak [Ca2+]i were measured as the stimulusdependent maximum relative change in the 340/380 fluorescence ratio (FR). Data shown are mean FR ± SE, with 17–75 cells imaged for each experimental condition over the course of five independent experiments. *p50.001 versus WT by two-way ANOVA. (B) Basal and UTPstimulated inositol phosphate production of VSMC from WT and RGS2KO mice. Cells were labeled overnight with myo-[3H]inositol, and treated with either water (baseline) or 200 mM UTP in the presence of 10 mM LiCl. Inositol phosphate (IPx) levels were measured 45 min after treatment, expressed as the mean percentage (soluble IPx/total soluble inositol-containing material) of triplicate samples. The ability of UTP to elicit an increased second messenger (IP3) response was retained in chronic PDGF-treated cultures from RGS2KO VSMC. Data shown are mean ± SE (n¼ 3 experiments; each experiment consisting of three replicates); *p50.001 versus WT by two-way ANOVA.
freshly isolated RGS2KO VSMC, cultured in the absence of PDGF, showed increased peak [Ca2+]i following a Gqdependent stimulus (9,10). Unlike previous observations, after chronic PDGF exposure (up to passage 10), GPCR-mediated increases in Ca2+ no longer differed between RGS2KO and WT VSMC (Figure 2A). As RGS2KO cells continued to show increased levels of GPCR-dependent second messenger inositol phosphates in response to UTP (Figure 2B), the loss of an enhanced [Ca2+]i response to UTP cannot be attributed to a PDGF-induced loss of Gq-dependent signaling. Rather, RGS2KO VSMC showed decreased resting [Ca2+]i and increased [Ca2+]i in response to thapsigargin treatment as compared with WT VSMC after long-term PDGF exposure (Figure 2A). Together, these data suggest that Ca2+ handling mechanisms in RGS2KO cells were adapted in a different (and somewhat unexpected) manner following
PDGF-stimulation, as compared with identically harvested and cultured WT cells. Expression of Ca2+ regulatory genes is altered in RGS2KO cells To explore the molecular bases of our findings, we next examined the expression and activity of the major Ca2+regulators known to be expressed in VSMC (16–18). In RGS2KO VSMCs at passage 0 (without PDGF treatment), quantitative real-time RT-PCR revealed that PMCA4 mRNA levels were 75% lower than in WT VSMC (WT: 1.0 ± 0.2 versus RGS2KO: 0.25 ± 0.05; n¼ 3; p50.05), while the expression levels of other Ca2+ regulatory genes (NCX, SERCA2, and IP3R1) were unchanged (p¼ NS). Consistent with the unique adaptive changes in Ca2+ regulation observed, later passage PDGF-treated VSMCs from RGS2deficient animals showed marked differences in the relative mRNA expression levels for several genes known to regulate Ca2+ homeostasis in VSMCs (Figure 3). Specifically, SERCA2a and SERCA2b message levels appeared higher in RGS2KO versus WT VSMC, however, neither increase was statistically significant. Rather, support for our findings that RGS2KO VSMC contained relatively increased expression of SERCA2 came from both immunofluorescent labeling of SERCA2 (Figure 4A–C) and immunoblotting of microsomal preparations (Figure 4D). In both cases, RGS2KO VSMC showed increased levels of immunoreactive SERCA2 protein compared with WT controls. Together, these data provided one potential explanation for the observed lower levels of basal [Ca2+]i and the heightened response to thapsigargin observed in RGS2KO VSMC. In addition, these later passage PDGF-treated VSMC from RGS2-deficient animals showed significant decreases in the
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
DOI: 10.3109/10799893.2014.920393
Figure 4. RGS2KO VSMC show increased expression of SERCA2 protein. Cover slips with passage 9–10 VSMC from WT (panel A) and RGS2KO mice (panel B) were simultaneously processed for immunofluorescent detection of SERCA2 and imaged by confocal microscopy as described in Methods section. (C) Relative fluorescence intensity from (n410) cells was quantified under identical imaging conditions, and expressed as mean ± SE (from two separate experiments). (D) Representative immunoblots (n¼ 2 blots) demonstrating relative abundance of SERCA2 (110 kDa band) is shown for equal amounts of membrane protein (actin served as a loading control) from cultured VSMC of WT and RGS2KO mice. Arrows represent molecular weight markers 117 and 71 kDa.
mRNA expression levels of plasma membrane Ca2+ extruders, namely PMCA4 and NCX were observed (Figure 3). While NCX mRNA levels were reduced, NCX protein levels were not decreased in RGS2KO VSMC. In contrast, antibodies developed for proteins produced by the PMCA4a and PMCA4b splice variants (27) confirmed by immunoblot that RGS2KO VSMC express lower levels of both PMCA4 variants as compared with WT cells (Figure 5A). PMCA-mediated Ca2+ extrusion is compromised in RGS2-deficient cells To determine the relative functional effect of reduced PMCA4 and unchanged NCX expression levels on Ca2+ extrusion in
RGS2 regulates VSMC proliferation and PMCA4
481
Figure 5. RGS2KO VSMC show decreased expression of PMCA4 protein and decreased PMCA-dependent 45Ca efflux. (A) Representative immunoblots demonstrating relative abundance of NCX, PMCA4a and PMCA4b in equal amounts of microsomal protein obtained from VSMC of WT and RGS2KO mice (n¼ 2 blots). (B) 45Ca efflux assays were performed in 90% confluent asynchronous VSMC (see Methods section for details). The mean relative residual intracellular 45Ca (± SE; NB: log scale) over time (four consecutive 30 s intervals) are shown (n¼ 3 experiments, with quadruplicate samples per time point). VSMC from WT mice (open circles) have higher rates of 45Ca efflux than those from KO mice (*p50.05, by two-way ANOVA). Replacing extracellular Na+ with choline ([choline]e¼ 145 mM; [Na+]e¼ 0 mM) did not diminish the higher rate of 45Ca efflux observed in WT (open triangles) versus RGS2KO (closed triangles) cells (*p50.05, by two-way ANOVA). In contrast, the non-selective PMCA-inhibitor La3+ (1 mM) abolished the difference in 45Ca efflux rate between WT (open squares) and RGS2KO (closed squares) (p¼ NS).
RGS2KO cells, we next performed 45Ca loading and measurements of Ca2+-efflux in identically cultured VSMC. Baseline rates of Ca2+-efflux were greater in WT VSMC (open circles) as compared with RGS2KO cells (closed circles) (Figure 5B). Notably, replacing extracellular Na+ with choline (i.e. disabling NCX) reduced Ca2+ efflux to a similar extent in both WT (open triangles) and RGS2KO (closed triangles) VSMC, suggesting that the difference in Ca2+efflux rates between these groups was not due to differences
482
A. Momen et al.
in NCX activity. Indeed, when the non-selective PMCA inhibitor La3+ was tested, it reduced the Ca2+-efflux rate of WT VSMC (open squares) to a greater extent than in RGS2KO cells (closed squares), such that the net Ca2+-efflux rates of the two groups no longer differed after La3+ treatment. Taken together, these data suggest that the primary difference in Ca2+-efflux rates between WT and RGS2KO cells is mediated by differences in PMCA4 expression and function.
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
Discussion Using two different but complementary methods, 3H-thymidine incorporation and mitochondrial MTT conversion, our results demonstrate that RGS2-deficient (RGS2KO) VSMC cultured in the presence of PDGF show increased rates of proliferation as compared with similarly treated wild-type (WT) VSMC. This is the first direct demonstration of a role for RGS2 in the regulation of VSMC proliferation. Based on our previous data in freshly isolated cells (9), and because the best characterized function of RGS2 in VSMC is inhibition of Gq-mediated IP3/calcium signaling, we anticipated larger GPCR-mediated [Ca2+]i responses in RGS2KO VSMC. As RGS2-deficient cells exposed to chronic PDGF treatment retained enhanced levels of inositol phosphate generation following UTP stimulation, we were surprised to find that peak [Ca2+]i in response to this Gq-mediated signal did not differ between RGS2KO and WT cells. These data indicated that adaptation of the Ca2+ handling mechanisms had occurred. In support of this, RGS2-deficient pancreatic acinar cells have also been shown to have profoundly adaptive calcium handling and control mechanisms (28). Moreover, differences in baseline [Ca2+]i and the peak [Ca2+]i response to thapsigargin were consistent with a more global adaptation of Ca2+ handling mechanisms, since these were identified in the absence of a GPCR agonist. Upon examination of several important regulators of VSMC Ca2+ handling, our real-time RT-PCR analysis of RGS2-deficient cells demonstrated that these cells expressed significantly reduced levels of PMCA4, a molecule involved in extrusion of cytosolic Ca2+. Immunoprecipitation and immunoblotting studies confirmed that protein expression of two PMCA4 isoforms, PMCA4a and PMCA4b, were reduced in RGS2KO VSMC. The likely functional consequence of reduced PMCA4 expression in RGS2-deficient cells is reduced net Ca2+ efflux and an increased [Ca2+]i response to SERCA blockade, in complete agreement with our assessment of these cells. Consistent with a relatively greater functional importance of PMCA4, our data also showed that treatment of VSMC with La3+, but not choline, abolished differences in Ca2+ efflux rates between the RGS2-deficient and WT VSMC. Thus, it seems likely that differential PMCA4 regulation in response to chronic PDGF stimulus is a major contributor to the overall differences in Ca2+ efflux between WT and RGS2-deficient cells. Notably, this difference may reflect a VSMC-specific mechanism, since pancreatic acinar cells lacking RGS2 show increased efflux rates relative to WT controls (28). It is also noteworthy that following chronic PDGF treatment, SERCA2a mRNA and SERCA2 protein levels
J Recept Signal Transduct Res, 2014; 34(6): 476–483
were increased in RGS2KO as compared with WT VSMC, which may explain the lower baseline [Ca2+]i observed in RGS2-deficient cells. These data are also in agreement with previous work showing that RGS2-deficient pancreatic acinar cells also express higher levels of SERCA2b as compared with WT controls (28). Although we were regrettably not able to parse the physiological effects of altered PMCA4 versus SERCA2 expression levels in RGS2KO cells from our Fura2AM-defined Ca2+-imaging experiments (data not shown), results from our mRNA, protein, and 45Ca efflux analyses are consistent with a role for PMCA4 in the phenotype of RGS2KO VSMC. It is interesting to speculate on the mechanisms whereby loss of a Gq inhibitor in VSMC can lead to the profound change in proliferation and adaptation of Ca2+-regulatory mechanisms observed. It remains to be determined whether increased levels of Gq or PLCb activity, or their downstream effector molecules, can directly regulate the promoters of PMCA, NCX, or SERCA. Alternatively, the amino terminal domain of RGS2 has also been shown to functionally interact with other intracellular signaling partners including adenylyl cyclase (29), TRPV6 channels (30), and tubulin (31), all of which may result in the observed changes in proliferation and calcium handling through a less conspicuous mechanism. Independent of the mechanism, our current data support a model whereby the loss of RGS2 results in the adaptation of PMCA4 and SERCA expression that tunes the cells differently to mitogenic stimuli.
Conclusions RGS2-deficient VSMC exhibit higher rates of proliferation and coordinate plasticity of Ca2+-handling mechanisms in response to PDGF stimulation. These data are the first to link RGS2 (and its well-established role in the modulation of vasoconstrictor responses and blood pressure in vivo), with a primary VSMC phenotype of enhanced proliferation and growth-permissive calcium dynamics in mitogen-stimulated conditions ex vivo. The significance of this finding in latestage (passages 9–10) cultures is that it implicates RGS2 in the regulation of VSMC proliferation (and, therefore, in potential disorders of VSMC proliferation, such as atherosclerosis, restenosis, and hypertension) independent of its effects on systemic hemodynamics in vivo.
Acknowledgements This work received technical support from the Cell Biology of Atherosclerosis Group at the University of Toronto and the Heart & Stroke/Richard Lewar Centre of Excellence (HSRLCE) in Cardiovascular Research.
Declaration of interest There are no conflicts of interest to report. This study was supported by a Canadian Institutes of Health Research (CIHR) Operating Grant (FRN: MOP-64352) to M. H., and a Heart and Stroke Foundation of Ontario (HSFO) Grant-in-Aid (NA5921) to S. P. H. M. H. is a Career Investigator of the HSFO (CI5503) and S. P. H. is a Canada Research Chair. A. M. S. was supported by a Canadian Hypertension Society (CHS)/Canadian Institutes of Health Research (CIHR) Postdoctoral Fellowship (FRN: JHF-64595). J. C. was supported in part by doctoral student stipend awards from the Ontario Graduate Scholarship and the CIHR.
RGS2 regulates VSMC proliferation and PMCA4
DOI: 10.3109/10799893.2014.920393
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
References 1. Bridges TM, Lindsley CW. G-protein-coupled receptors: from classical modes of modulation to allosteric mechanisms. ACS Chem Biol 2008;3:530–41. 2. Wang G, Wu G. Small GTPase regulation of GPCR anterograde trafficking. Trends Pharmacol Sci 2012;33:28–34. 3. Trenkwalder P. Combination therapy with AT(1)-receptor blockers. J Hum Hypertens 2002;16:S17–25. 4. Mulvany MJ. Small artery remodeling in hypertension. Curr Hypertens Rep 2002;4:49–55. 5. Wieland T, Mittmann C. Regulators of G-protein signalling: multifunctional proteins with impact on signalling in the cardiovascular system. Pharmacol Ther 2003;97:95–115. 6. Gu S, Cifelli C, Wang S, Heximer SP. RGS proteins: identifying new GAPs in the understanding of blood pressure regulation and cardiovascular function. Clin Sci (Lond) 2009;116:391–9. 7. Zhang P, Mende U. Functional role, mechanisms of regulation, and therapeutic potential of regulator of G protein signaling 2 in the heart. Trends Cardiovasc Med 2013;24:85–93. 8. Hercule HC, Tank J, Plehm R, et al. Regulator of G protein signalling 2 ameliorates angiotensin II-induced hypertension in mice. Exp Physiol 2007;92:1014–22. 9. Heximer SP, Knutsen RH, Sun X, et al. Hypertension and prolonged vasoconstrictor signaling in RGS2-deficient mice. J Clin Invest 2003;111:445–52. 10. Sun X, Kaltenbronn KM, Steinberg TH, Blumer KJ. RGS2 is a mediator of nitric oxide action on blood pressure and vasoconstrictor signaling. Mol Pharmacol 2005;67:631–9. 11. Tang KM, Wang GR, Lu P, et al. Regulator of G-protein signaling2 mediates vascular smooth muscle relaxation and blood pressure. Nat Med 2003;9:1506–12. 12. Boelte KC, Gordy LE, Joyce S, et al. Rgs2 mediates pro-angiogenic function of myeloid derived suppressor cells in the tumor microenvironment via upregulation of MCP-1. PLoS One 2011;6: e18534. 13. Hendriks-Balk MC, Hajji N, van Loenen PB, et al. Sphingosine1-phosphate regulates RGS2 and RGS16 mRNA expression in vascular smooth muscle cells. Eur J Pharmacol 2009;606:25–31. 14. Husain M, Bein K, Jiang L, et al. c-Myb-dependent cell cycle progression and Ca2+ storage in cultured vascular smooth muscle cells. Circ Res 1997;80:617–26. 15. Husain M, Jiang L, See V, et al. Regulation of vascular smooth muscle cell proliferation by plasma membrane Ca(2+)-ATPase. Am J Physiol 1997;272:C1947–59. 16. Afroze T, Husain M. c-Myb-binding sites mediate G(1)/Sassociated repression of the plasma membrane Ca(2+)-ATPase-1 promoter. J Biol Chem 2000;275:9062–9. 17. Afroze T, Yang LL, Wang C, et al. Calcineurin-independent regulation of plasma membrane Ca2+ ATPase-4 in the vascular
18.
19.
20.
21.
22.
23.
24.
25. 26.
27.
28.
29.
30. 31.
483
smooth muscle cell cycle. Am J Physiol Cell Physiol 2003;285: C88–95. Afroze T, Sadi AM, Momen MA, et al. c-Myb-dependent inositol 1,4,5-trisphosphate receptor type-1 expression in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 2007;27: 1305–11. Wang Y, Chen J, Wang Y, et al. Crucial role of type 1, but not type 3, inositol 1,4,5-trisphosphate (IP(3)) receptors in IP(3)induced Ca(2+) release, capacitative Ca(2+) entry, and proliferation of A7r5 vascular smooth muscle cells. Circ Res 2001;88: 202–9. Choi J, Chiang A, Taulier N, et al. A calmodulin-binding site on cyclin E mediates Ca2+-sensitive G1/s transitions in vascular smooth muscle cells. Circ Res 2006;98:1273–81. Gros R, Afroze T, You XM, et al. Plasma membrane calcium ATPase overexpression in arterial smooth muscle increases vasomotor responsiveness and blood pressure. Circ Res 2003;93: 614–21. Schuh K, Quaschning T, Knauer S, et al. Regulation of vascular tone in animals overexpressing the sarcolemmal calcium pump. J Biol Chem 2003;278:41246–52. Oliveira-Dos-Santos AJ, Matsumoto G, Snow BE, et al. Regulation of T cell activation, anxiety, and male aggression by RGS2. Proc Natl Acad Sci USA 2000;97:12272–7. Cornwell TL, Lincoln TM. Regulation of intracellular Ca2+ levels in cultured vascular smooth muscle cells. Reduction of Ca2+ by atriopeptin and 8-bromo-cyclic GMP is mediated by cyclic GMPdependent protein kinase. J Biol Chem 1989;264:1146–55. Heximer SP, Srinivasa SP, Bernstein LS, et al. G protein selectivity is a determinant of RGS2 function. J Biol Chem 1999;274:34253–9. Kolodziejska KM, Noyan-Ashraf MH, Nagy A, et al. c-Mybdependent smooth muscle cell differentiation. Circ Res 2008;102: 554–61. Afroze T, Yang G, Khoshbin A, et al. Calcium efflux activity of plasma membrane Ca2+ ATPase-4 (PMCA4) mediates cell cycle progression in vascular smooth muscle cells. J Biol Chem 2014; 289:7221–31. Wang X, Huang G, Luo X, et al. Role of regulator of G protein signaling 2 (RGS2) in Ca(2+) oscillations and adaptation of Ca(2+) signaling to reduce excitability of RGS2/ cells. J Biol Chem 2004;279:41642–9. Salim S, Sinnarajah S, Kehrl JH, Dessauer CW. Identification of RGS2 and type V adenylyl cyclase interaction sites. J Biol Chem 2003;278:15842–9. Schoeber JP, Topala CN, Wang X, et al. RGS2 inhibits the epithelial Ca2+ channel TRPV6. J Biol Chem 2006;281:29669–74. Heo K, Ha SH, Chae YC, et al. RGS2 promotes formation of neurites by stimulating microtubule polymerization. Cell Signal 2006;18:2182–92.
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
RESEARCH ARTICLE
Enhanced proliferation and altered calcium handling in RGS2-deficient vascular smooth muscle cells Abdul Momen1, Talat Afroze1, Al-Muktafi Sadi1, Amir Khoshbin1, Hangjun Zhang2, Jaehyun Choi1, Steven Gu2, Syed H. Zaidi1, Scott P. Heximer2*, and Mansoor Husain1* 1
Division of Experimental Therapeutics, Toronto General Research Institute, University Health Network, Toronto, Ontario, Canada and Department of Physiology, Heart and Stroke/Richard Lewar Centre of Excellence in Cardiovascular Research, University of Toronto, 1 King’s College Circle, Toronto, Ontario, Canada
2
Abstract
Keywords
Context: Regulator of G-protein signaling-2 (RGS2) inhibits Gq-mediated regulation of Ca2+ signalling in vascular smooth muscle cells (VSMC). Objective: RGS2 knockout (RGS2KO) mice are hypertensive and show arteriolar remodeling. VSMC proliferation modulates intracellular Ca2+ concentration [Ca2+]i. RGS2 involvement in VSMC proliferation had not been examined. Methods: Thymidine incorporation and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) conversion assays measured cell proliferation. Fura-2 ratiometric imaging quantified [Ca2+]i before and after UTP and thapsigargin. [3H]-labeled inositol was used for phosphoinositide hydrolysis. Quantitative RT-PCR and confocal immunofluorescence of select Ca2+ transporters was performed in primary aortic VSMC. Results and discussion: Platelet-derived growth factor (PDGF) increased S-phase entry and proliferation in VSMC from RGS2KO mice to a greater extent than in VSMC from wild-type (WT) controls. Consistent with differential PDGFinduced changes in Ca2+ homeostasis, RGS2KO VSMC showed lower resting [Ca2+]i but higher thapsigargin-induced [Ca2+]i as compared with WT. RGS2KO VSMC expressed lower mRNA levels of plasma membrane Ca2+ ATPase-4 (PMCA4) and Na+ Ca2+ Exchanger (NCX), but higher levels of sarco-endoplasmic reticulum Ca2+ ATPase-2 (SERCA2). Western blot and immunofluorescence revealed similar differences in PMCA4 and SERCA2 protein, while levels of NCX protein were not reduced in RGS2KO VSMC. Consistent with decreased Ca2+ efflux activity, 45 Ca-extrusion rates were lower in RGS2KO VSMC. These differences were reversed by the PMCA inhibitor La3+, but not by replacing extracellular Na+ with choline, implicating differences in the activity of PMCA and not NCX. Conclusion: RGS2-deficient VSMC exhibit higher rates of proliferation and coordinate plasticity of Ca2+-handling mechanisms in response to PDGF stimulation.
Ca2+, PMCA4, proliferation, RGS2, vascular smooth muscle cell History Received 26 March 2014 Revised 29 April 2014 Accepted 29 April 2014 Published online 20 May 2014
Abbreviations: RGS: regulator of G-protein signalling; MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide; PMCA4: plasma membrane Ca2+ ATPase-4; NCX: Na+ Ca2+ exchanger; SERCA2: sarco-endoplasmic reticulum Ca2+ ATPase-2; PDGF: platelet-derived growth factor; G-protein: guanine nucleotide binding protein; GPCR: G-protein coupled receptor; VSMC: vascular smooth muscle cell; [Ca2+]i: intracellular Ca2+ concentrations; PDGF: platelet-derived growth factor; P2Y2R: purinergic receptor P2Y2; UTP: uridine tri-phosphate
Introduction Heterotrimeric G-protein coupled receptors (GPCR) are ubiquitously expressed throughout the cardiovascular system
*These senior authors have contributed equally to this work. Address for correspondence: Mansoor Husain, University Health Network, Toronto General Hospital Research Institute, TMDT-3-901, 101 College Street, Toronto, Ontario, Canada M5G 1L7. Tel: +1 416 581 7489. Fax: +1 416 581 7489. E-mail: [email protected]
and mediate cellular responses to a myriad of hormones and neurotransmitters (1,2). Hypertension often involves GPCR activation in vascular smooth muscle cells (VSMC), the end-effector cell-type controlling peripheral resistance to blood flow. This can lead to rapid transient increases in vascular constriction, whereas chronic increases in peripheral resistance may be mediated by more permanent vascular remodeling. Some of the most widely used drugs used to lower blood pressure (3) and reduce remodeling of arterial vessels (4) act upstream or at the level of GPCR in VSMC to reduce signal throughput (e.g. angiotensin receptor antagonists).
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
DOI: 10.3109/10799893.2014.920393
‘‘Regulators of G protein signalling’’ (RGS) is a protein superfamily whose members share a 120 amino acid homology domain (RGS domain), accelerate GTPase activity of G protein a subunits, and negatively regulate G protein signalling (5). One such family member, RGS2, is highly expressed in VSMC and is unique among the over 35 other RGS proteins in its ability to both selectively and potently attenuate Gqa-mediated signalling [reviewed in (6,7)]. Rgs2 knockout mice are hypertensive (8–10) and show pathological remodeling of kidney arterioles (9). While numerous studies have investigated the mechanisms whereby increased Gq-dependent Ca2+ signaling in the absence of a specific Gq inhibitor can lead to the enhanced vasoconstrictormediated responses in VSMC (10,11), no study to date has examined the potential effect of RGS2-deficiency on the phenotypic modulation of VSMC. Interestingly, RGS2 has been found to carry out a proangiogenic function in myeloid derived suppressor cells (MDSC) which sculpt the tumor microenvironment through increased vascularisation (12). This study found the target protein that mediates this pro-angiogenic function downstream of RGS2 to be monocyte chemoattractant protein-1 (MCP-1). Rgs2 knockout (RGS2KO) MDSC secreted lower levels of MCP-1, leading to reduced angiogenesis in tumors from RGS2KO mice. Not much is known about the signaling pathways employed by RGS2 in modulating growth of VSMC. In this context, an earlier study found that growth stimulation of VSMC via sphingosine-1-phosphate (S1P) treatment caused an up-regulation of Rgs2 mRNA by utilizing a signaling pathway independent of phosphatidylinositol 3-kinase, protein kinase C, and mitogen-activated protein kinase kinase (13). Coordinate increases in [Ca2+]i are also required for cell cycle progression in VSMC (14) and are achieved through the regulated expression of Ca2+-regulatory genes such as the ubiquitously expressed plasma membrane Ca2+ ATPases (PMCA)-1 and 4 (15–17) and the inositol 1,4,5-trisphosphate receptor type-1 (IP3R1) (18,19), and specific Ca2+-sensitive cell cycle proteins (20). Notably, manipulating expression levels of select Ca2+-regulatory genes can have effects on both VSMC proliferation (15) and vasomotor function (21,22), For example, overexpression of PMCA1 has been shown to inhibit cell cycle-associated increases in [Ca2+]i and G1 to S phase cell cycle progression and proliferation of cultured rat VSMC (15). However, potential links between RGS proteins (with their known ability to modulate Ca2+ transients), and VSMC proliferation had not previously been examined. To address this, we sought to determine the role of RGS2 as a regulator of [Ca2+]i in VSMC under proliferative stimuli. Our results show that chronic exposure to the mitogen platelet-derived growth factor (PDGF) resulted in differential changes in proliferation, and both resting and releasable [Ca2+]i in RGS2KO versus WT VSMC. We also demonstrate unique adaptive changes in the expression and activity of specific Ca2+-regulatory genes in RGS2-deficient cells, including PMCA4, which are consistent with the altered growth characteristics of these cells.
RGS2 regulates VSMC proliferation and PMCA4
477
Materials and methods Animals Mice genetically deficient in Rgs2 (RGS2KO) were kindly provided by Josef Penninger and David Siderovski (23). Mice used in all studies were backcrossed412 generations onto a C57BL/6J background. All animal protocols were approved by the institutional animal care committee. Reagents Unless specified otherwise, all chemicals were purchased from Sigma, Mississauga, ON, Canada. Cell culture conditions Primary mouse aortic SMC were isolated from RGS2KO and wild-type (WT) C57BL/6J mice (Charles River Laboratories, Wilmington, MA) as previously described (24) with modifications (17). Briefly, mice were euthanized with sodium pentobarbital. Descending aortae were collected (3–4 mice/ preparation) in isolation medium (DMEM with 25 mM HEPES, pH 7.4, 100 mg/l gentamicin, 2.5 mg/ml amphotericin B, and 1 mg/ml BSA). In a sterile hood, aortae were cleaned free of fat and connective tissue, and incubated for 30 min at 37 C in isolation medium containing 200 units/ml collagenase type III, 0.1 mg/ml elastase (132 units/mg), and 0.5 mg/ml soybean trypsin inhibitor. Tunica adventitia was removed as an everted tube and the remaining medial tubes were digested further for 45 min, before mincing and final digestion for 1 h. Following the removal of tissue pieces by gravity for 2 min, cells were collected by centrifugation (500 g). Cell pellets were re-suspended in the growth medium (DMEM, 10% FBS, 1% penicillin-streptomycin, 50 mg/l gentamicin, 2.5 mg/ml amphotericin B, and 50 ng/ml PDGF) in T-25 flasks in a humidified atmosphere of 5% CO2, 95% air, at 37 C. At confluence, cells were removed from flasks with a brief trypsin treatment (0.05%), suspended in the culture medium, and split 1:3. Experiments were carried out in cells at 90% confluence, passages 9–10, and in the presence of PDGF-containing medium. In experiments when cells were cultured at passage 0, PDGF was not added to the media. [3H]-thymidine incorporation Primary aortic SMC were seeded in 6 well plates (1 106 per well). The next day, synchronization was achieved by serum starvation (0.25% FBS) for 48 h. Following this, cells were treated with the growth medium containing 50 ng/ml PDGF for 16 h, to which 1 mCi/ml [3H]-thymidine was added for a further 4 h. At the end of the labeling period, cells were harvested and washed. Their incorporation of [3H]-thymidine was quantified by liquid scintillation counting. MTT colorimetric assay Active mitochondria cleave 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) to produce formazan in amounts directly proportional to the number of viable cells, representing thus an index of cell proliferation. Primary aortic SMC seeded in 96-well plates underwent PDGF treatment as
478
A. Momen et al.
J Recept Signal Transduct Res, 2014; 34(6): 476–483
described above. After two washes in PBS, they were incubated for 4 h at 37 C with 1 mg/ml of MTT (in phenol red-free DMEM supplemented with 2 mM L-glutamine and 1 mM sodium pyruvate) in a reaction volume of 100 ml. After the removal of MTT solution, DMSO was added to dissolve formazan crystals. The plate was shaken for 5 min at 55 C for complete dissolution. Dye absorbance in viable cells was measured at 595 nm, with 630 nm used as a reference wavelength.
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
Determination of [Ca2+]i Primary aortic SMC were seeded at low density onto #1 glass coverslips and cultured as described above in 6-well plates. Cells were loaded in culture media with 4 mM Fura-2-AM (Invitrogen-Molecular Probes, Burlington, ON) for 45 min at 37 C, washed, and incubated in PBS without Fura-2 for 10 min at 37 C to allow hydrolysis of the AM ester. Cover slips were mounted in a modified Leyden open-bath chamber (BioScience Tools, San Diego, CA) and imaged on an Olympus IX70 inverted microscope (Carsen Group, Markham, ON) using a 40 objective. Excitation light was provided by a DeltaRam monochrometer, and fluorescence imaging was performed with ImageMaster imaging software via an IC200-B camera (Photon Technologies Inc., London, ON). Cytosolic regions of cells were selected as regions of interest (ROIs). Alternating excitation wavelengths (340 ± 5/ 380 ± 5 nm) were provided at 1 excitation pair per second in conjunction with a 495-nm dichroic mirror and a 510 ± 20-nm emission filter (Chroma Technology Corp., Bellows Falls, VT). Paired images were collected after 100 ms exposure. Fluorescent ratio values for the image pairs were determined for each ROI. Baseline fluorescence ratios (FR) of nonstimulated cells were collected for 30 frames prior to the addition of 100 mM UTP or 2 mM thapsigargin. The percentage increase from baseline FR levels to the peak stimulated FR was calculated. Identical excitation/emission conditions and data collection parameters were maintained for all individual experiments performed in this study. Phosphoinositide hydrolysis assay Gq-dependent inositol phosphate production was measured as described previously (25) with the following modifications. After 24 h labeling with complete DMEM (with 10% fetal bovine serum and without inositol) containing 4 mCi/ml myo[3H]inositol, VSMCs were treated with 200 mM UTP in the presence of 5 mM LiCl. Incubations were carried out for exactly 45 min before stopping the reaction and collecting
total inositol-containing and inositol phosphate-containing fractions. Inositol phosphate levels were expressed as a fraction of the total soluble [3H]-labeled inositol material [inositol phosphate+ total inositol-containing fraction]. Data presented are means of triplicate samples and are representative of three independent experiments. Real-time RT-PCR Total RNA was extracted with Trizol (Invitrogen, Burlington, ON) from primary VSMC from WT or RGS2KO mice. RNA was DNAse-treated and used for reverse transcriptase realtime PCR reaction with microglobulin primers to validate the absence of genomic DNA. Then, cDNA was prepared using SuperScript II (Invitrogen, Burlington, ON) with random hexamers and treated with RNase H. Between 25 and 75 ng of cDNA was used for real-time PCR reactions in an ABI 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) using the SYBR GREEN kit (ABI) and employing primers for GAPDH, RGS2, and Ca2+ regulatory genes PMCA4, SERCA2a/b, IP3R1, and Na+ Ca2+ Exchanger-1 (NCX1; Table 1). Amounts (ng) of each specific mRNA were estimated from the standard curve and all data were normalized to the amount (ng) of the housekeeping gene GAPDH. Data were plotted as fold increases compared with the values of wild-type mice. Statistical analysis employed Student’s t test. Immunofluorescence Primary aortic SMCs cultured on coverslips were fixed, permeabilized, and stained with an anti-SERCA2 antibody (1:100 dilution) (Affinity Bioreagents, Golden, CO) and a Texas Red-conjugated fluorescent secondary antibody (1:500) (Invitrogen-Molecular Probes, Burlington, ON) as previously described (18). Quantification of relative SERCA2 fluorescence was conducted on an Olympus IX/81 Fluoview confocal imaging system (Olympus America Inc., Melville, NY). Briefly, cell boundaries were delineated from 3 or more observation fields on each cover slip (n410 cells from two separate experiments). Cell fluorescent intensity was quantified at 15 planes in 15 mm wide z-stacks using Olympus FV1000 software (Olympus Surgical Technologies, Southborough, MA) as described (26). Western blot Primary aortic SMC from 4 to 6 T-175 flasks were harvested and lysed in 4 ml hypotonic buffer containing 5 mM Tris-Cl, pH 8.0; 1 mM EDTA; 2 mM DTT; 1 mM PMSF; and
Table 1. Primer sequences employed for quantitative gene expression analyses. q-RT-PCR primers Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse Mouse
NCX1 forward NCX1 reverse PMCA4 forward PMCA4 reverse IP3R1 forward IP3R1 reverse SERCA2 common forward SERCA2a reverse SERCA2b reverse
Sequence (Ta) ATCTGCGTTGTGTTCGCGTGGGTAG (60 C) TCAATGATCATCCCCCTCTGCTTGC (60 C) ACGTCTTCCCACCCAAGGTTC (60 C) CCAGCAGCCCACACTCTGTC (60 C) AGTTTGGCCAACGATTTCCTG (67 C) GCTTCCTGAGCACGTCTCCTAC (67 C) TGAGACGCTCAAGTTTGTGG (60 C) ATGCAGAGGGCTGGTAGATG (60 C) ACAAACGGCCAGGAAATG (60 C)
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
DOI: 10.3109/10799893.2014.920393
1 COMPLETE protease inhibitor cocktail (Roche, Laval, PQ) with 50–100 strokes in a Dounce homogenizer. After clearing nuclei and debris with a spin at 900 g, the supernatant was centrifuged at 100 000 g for 1 h at 4 C. The microsomal pellet was then resuspended in 0.5–1.0 ml of resuspension buffer (25 mM HEPES, pH 7.5; 150 mM NaCl; 5 mM EDTA; 1 mM mercaptoethanol; 1% Triton X-100; COMPLETE protease inhibitor cocktail; 1 mM PMSF; 1 mM Na3VO4; 1 mM NaF). Membranes were spun again at 1000 g for 5 min at 4 C and supernatants were immediately frozen in liquid nitrogen in aliquots. Protein concentration was estimated with the BCA protein assay (Sigma, Oakville, ON). Microsomal suspension (250–500 mg) was used for immunoprecipitation with anti-PMCA4 (Husain lab developed; (27)), anti-SERCA2 (Affinity Bioreagents, Golden, CO) or anti-NCX1 (Abcam, Cambridge, MA) antibodies, and anti-mouse IgG immobilized to Sepharose (Pierce, Rockford, IL). The immunoprecipitate was resolved on 3–8% NuPage Tris-Acetate gels (Invitrogen, Burlington, ON), blotted, and hybridized with anti-PMCA4, SERCA2, or NCX1 antibodies. Non-immunoprecipitated microsomal proteins were resolved and blotted similarly, hybridized to a monoclonal anti-actin antibody (Sigma, Oakville, ON), and visualized by chemiluminescence. Band intensities were quantified on the BioRad GS800 densitometer using BioRad’s Quantity One software (BioRad, Mississauga, ON). 45
Ca efflux
These studies were conducted as previously described (15) with modifications. Aortic SMC were incubated with culture media containing 10 mCi/ml 45CaCl2 for 1 h at 37 C. Steady-state equilibration of intracellular 45Ca was inferred from maximum 45Ca uptake having occurred by 1 h of loading. Cells were washed five times with PBS to remove extracellular Ca2+. For experiments in which the extracellular Na+ concentration ([Na+]e) was manipulated, NaCl in the efflux solution was replaced with equimolar concentration of choline chloride (145 mM). In experiments involving La3+, 1 mM LaCl3 was added to the efflux solution. The amount of released 45Ca was determined over five consecutive 30-s intervals. Each experiment was repeated three times, with all experimental and control samples run in quadruplicates for each 30 s interval. Efflux data were plotted as an exponential decay of relative starting intracellular 45Ca over time. Statistical analysis Data are reported as mean ± SE. The data were analyzed using one-way and two-way ANOVA with Tukey’s or Dunn’s post-hoc analysis and Student’s t-tests. In all instances, p50.05 was considered significant.
Results RGS2-deficient VSMC exposed to PDGF show increased rates of proliferation To examine the role of RGS2 in the regulation of VSMC proliferation and Ca2+ signaling under conditions that simulate arterial remodeling in vivo, we cultured primary mouse aortic VSMC from wild-type (WT) and Rgs2-deficient
RGS2 regulates VSMC proliferation and PMCA4
479
Figure 1. RGS2KO VSMC show enhanced proliferation in response to PDGF. (A) In each experiment, triplicate wells of VSMC from wild-type (WT) and RGS2KO mice were cell cycle-synchronized (48 h serum starvation and 16 h PDGF stimulation) and labeled with 3[H]-thymidine for 4 h. Total acid-precipitable 3[H] cpm/well were determined for each well; data shown are mean ± SE of three independent experiments. (B) VSMC from WT and RGS2KO mice were seeded in 96-well plates (5000 cells per well), and the MTT assay was performed on subsequent days. Each experimental condition was repeated in quadruplicate; data shown are mean ± SE of three independent experiments. *p50.05 versus WT by two-way ANOVA.
(RGS2KO) mice in PDGF-containing medium for 9–10 passages. Consistent with a role for RGS2 in the suppression of VSMC proliferation, RGS2KO cells showed greater incorporation of 3H-thymidine (Figure 1A), and increased mitochondrial conversion of the MTT substrate to a colorimetric product, an indirect measure of cell number (Figure 1B), when compared with WT controls. As VSMC proliferation is regulated by coordinated control of [Ca2+]i (16,18), and RGS2 is a highly selective inhibitor of Gq-mediated Ca2+ signaling (6,7), we anticipated that altered Ca2+ dynamics may play a role in the increased proliferative response of RGS2KO cells. Ca2+ homeostasis is altered in PDGF-treated VSMC from RGS2-deficient mice To determine whether the accelerated proliferation of RGS2KO VSMC is associated with differences in [Ca2+]i, we used ratiometric imaging of Fura-2AM-loaded VSMC from RGS2KO and WT mice to define basal [Ca2+]i and Ca2+ responses to (i) activation of a G-protein coupled purinergic receptor (P2Y2R), and (ii) blockade of the sarco/endoplasmic reticulum Ca2+ ATPase (SERCA), with UTP and thapsigargin, respectively. Previously, we and others showed that
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
480
A. Momen et al.
J Recept Signal Transduct Res, 2014; 34(6): 476–483
Figure 3. RGS2KO VSMC show altered expression of Ca2+ regulatory genes. Wild-type (WT) and RGS2KO VSMC were cultured at passage 10 in media supplemented with PDGF and the mRNA expression levels of Ca2+ transporters PMCA4, NCX, SERCA2a, SERCA2b, and IP3R1 were measured by quantitative real-time RT-PCR. Absolute quantities of each Ca2+ transporter mRNA (ng) were first normalized to GAPDH mRNA levels. Then, the GAPDH-normalized value of each Ca2+ transporter in RGS2KO cells was divided by the mean GAPDHnormalized value in WT cells to obtain expression values in RGS2KO relative to WT cells. Data shown are mean ± SE (n¼ 3 independent experiments); *p50.01 by Students’ t-test.
Figure 2. RGS2KO VSMC show altered regulation of resting and releasable [Ca2+]i following chronic PDGF treatment. (A) Passage 9–10 VSMC from wild-type (WT) and RGS2KO mice were Fura-2 loaded and stimulated with UTP (100 mM) or thapsigargin (Tg; 2 mM) in the presence of PDGF. Peak [Ca2+]i were measured as the stimulusdependent maximum relative change in the 340/380 fluorescence ratio (FR). Data shown are mean FR ± SE, with 17–75 cells imaged for each experimental condition over the course of five independent experiments. *p50.001 versus WT by two-way ANOVA. (B) Basal and UTPstimulated inositol phosphate production of VSMC from WT and RGS2KO mice. Cells were labeled overnight with myo-[3H]inositol, and treated with either water (baseline) or 200 mM UTP in the presence of 10 mM LiCl. Inositol phosphate (IPx) levels were measured 45 min after treatment, expressed as the mean percentage (soluble IPx/total soluble inositol-containing material) of triplicate samples. The ability of UTP to elicit an increased second messenger (IP3) response was retained in chronic PDGF-treated cultures from RGS2KO VSMC. Data shown are mean ± SE (n¼ 3 experiments; each experiment consisting of three replicates); *p50.001 versus WT by two-way ANOVA.
freshly isolated RGS2KO VSMC, cultured in the absence of PDGF, showed increased peak [Ca2+]i following a Gqdependent stimulus (9,10). Unlike previous observations, after chronic PDGF exposure (up to passage 10), GPCR-mediated increases in Ca2+ no longer differed between RGS2KO and WT VSMC (Figure 2A). As RGS2KO cells continued to show increased levels of GPCR-dependent second messenger inositol phosphates in response to UTP (Figure 2B), the loss of an enhanced [Ca2+]i response to UTP cannot be attributed to a PDGF-induced loss of Gq-dependent signaling. Rather, RGS2KO VSMC showed decreased resting [Ca2+]i and increased [Ca2+]i in response to thapsigargin treatment as compared with WT VSMC after long-term PDGF exposure (Figure 2A). Together, these data suggest that Ca2+ handling mechanisms in RGS2KO cells were adapted in a different (and somewhat unexpected) manner following
PDGF-stimulation, as compared with identically harvested and cultured WT cells. Expression of Ca2+ regulatory genes is altered in RGS2KO cells To explore the molecular bases of our findings, we next examined the expression and activity of the major Ca2+regulators known to be expressed in VSMC (16–18). In RGS2KO VSMCs at passage 0 (without PDGF treatment), quantitative real-time RT-PCR revealed that PMCA4 mRNA levels were 75% lower than in WT VSMC (WT: 1.0 ± 0.2 versus RGS2KO: 0.25 ± 0.05; n¼ 3; p50.05), while the expression levels of other Ca2+ regulatory genes (NCX, SERCA2, and IP3R1) were unchanged (p¼ NS). Consistent with the unique adaptive changes in Ca2+ regulation observed, later passage PDGF-treated VSMCs from RGS2deficient animals showed marked differences in the relative mRNA expression levels for several genes known to regulate Ca2+ homeostasis in VSMCs (Figure 3). Specifically, SERCA2a and SERCA2b message levels appeared higher in RGS2KO versus WT VSMC, however, neither increase was statistically significant. Rather, support for our findings that RGS2KO VSMC contained relatively increased expression of SERCA2 came from both immunofluorescent labeling of SERCA2 (Figure 4A–C) and immunoblotting of microsomal preparations (Figure 4D). In both cases, RGS2KO VSMC showed increased levels of immunoreactive SERCA2 protein compared with WT controls. Together, these data provided one potential explanation for the observed lower levels of basal [Ca2+]i and the heightened response to thapsigargin observed in RGS2KO VSMC. In addition, these later passage PDGF-treated VSMC from RGS2-deficient animals showed significant decreases in the
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
DOI: 10.3109/10799893.2014.920393
Figure 4. RGS2KO VSMC show increased expression of SERCA2 protein. Cover slips with passage 9–10 VSMC from WT (panel A) and RGS2KO mice (panel B) were simultaneously processed for immunofluorescent detection of SERCA2 and imaged by confocal microscopy as described in Methods section. (C) Relative fluorescence intensity from (n410) cells was quantified under identical imaging conditions, and expressed as mean ± SE (from two separate experiments). (D) Representative immunoblots (n¼ 2 blots) demonstrating relative abundance of SERCA2 (110 kDa band) is shown for equal amounts of membrane protein (actin served as a loading control) from cultured VSMC of WT and RGS2KO mice. Arrows represent molecular weight markers 117 and 71 kDa.
mRNA expression levels of plasma membrane Ca2+ extruders, namely PMCA4 and NCX were observed (Figure 3). While NCX mRNA levels were reduced, NCX protein levels were not decreased in RGS2KO VSMC. In contrast, antibodies developed for proteins produced by the PMCA4a and PMCA4b splice variants (27) confirmed by immunoblot that RGS2KO VSMC express lower levels of both PMCA4 variants as compared with WT cells (Figure 5A). PMCA-mediated Ca2+ extrusion is compromised in RGS2-deficient cells To determine the relative functional effect of reduced PMCA4 and unchanged NCX expression levels on Ca2+ extrusion in
RGS2 regulates VSMC proliferation and PMCA4
481
Figure 5. RGS2KO VSMC show decreased expression of PMCA4 protein and decreased PMCA-dependent 45Ca efflux. (A) Representative immunoblots demonstrating relative abundance of NCX, PMCA4a and PMCA4b in equal amounts of microsomal protein obtained from VSMC of WT and RGS2KO mice (n¼ 2 blots). (B) 45Ca efflux assays were performed in 90% confluent asynchronous VSMC (see Methods section for details). The mean relative residual intracellular 45Ca (± SE; NB: log scale) over time (four consecutive 30 s intervals) are shown (n¼ 3 experiments, with quadruplicate samples per time point). VSMC from WT mice (open circles) have higher rates of 45Ca efflux than those from KO mice (*p50.05, by two-way ANOVA). Replacing extracellular Na+ with choline ([choline]e¼ 145 mM; [Na+]e¼ 0 mM) did not diminish the higher rate of 45Ca efflux observed in WT (open triangles) versus RGS2KO (closed triangles) cells (*p50.05, by two-way ANOVA). In contrast, the non-selective PMCA-inhibitor La3+ (1 mM) abolished the difference in 45Ca efflux rate between WT (open squares) and RGS2KO (closed squares) (p¼ NS).
RGS2KO cells, we next performed 45Ca loading and measurements of Ca2+-efflux in identically cultured VSMC. Baseline rates of Ca2+-efflux were greater in WT VSMC (open circles) as compared with RGS2KO cells (closed circles) (Figure 5B). Notably, replacing extracellular Na+ with choline (i.e. disabling NCX) reduced Ca2+ efflux to a similar extent in both WT (open triangles) and RGS2KO (closed triangles) VSMC, suggesting that the difference in Ca2+efflux rates between these groups was not due to differences
482
A. Momen et al.
in NCX activity. Indeed, when the non-selective PMCA inhibitor La3+ was tested, it reduced the Ca2+-efflux rate of WT VSMC (open squares) to a greater extent than in RGS2KO cells (closed squares), such that the net Ca2+-efflux rates of the two groups no longer differed after La3+ treatment. Taken together, these data suggest that the primary difference in Ca2+-efflux rates between WT and RGS2KO cells is mediated by differences in PMCA4 expression and function.
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
Discussion Using two different but complementary methods, 3H-thymidine incorporation and mitochondrial MTT conversion, our results demonstrate that RGS2-deficient (RGS2KO) VSMC cultured in the presence of PDGF show increased rates of proliferation as compared with similarly treated wild-type (WT) VSMC. This is the first direct demonstration of a role for RGS2 in the regulation of VSMC proliferation. Based on our previous data in freshly isolated cells (9), and because the best characterized function of RGS2 in VSMC is inhibition of Gq-mediated IP3/calcium signaling, we anticipated larger GPCR-mediated [Ca2+]i responses in RGS2KO VSMC. As RGS2-deficient cells exposed to chronic PDGF treatment retained enhanced levels of inositol phosphate generation following UTP stimulation, we were surprised to find that peak [Ca2+]i in response to this Gq-mediated signal did not differ between RGS2KO and WT cells. These data indicated that adaptation of the Ca2+ handling mechanisms had occurred. In support of this, RGS2-deficient pancreatic acinar cells have also been shown to have profoundly adaptive calcium handling and control mechanisms (28). Moreover, differences in baseline [Ca2+]i and the peak [Ca2+]i response to thapsigargin were consistent with a more global adaptation of Ca2+ handling mechanisms, since these were identified in the absence of a GPCR agonist. Upon examination of several important regulators of VSMC Ca2+ handling, our real-time RT-PCR analysis of RGS2-deficient cells demonstrated that these cells expressed significantly reduced levels of PMCA4, a molecule involved in extrusion of cytosolic Ca2+. Immunoprecipitation and immunoblotting studies confirmed that protein expression of two PMCA4 isoforms, PMCA4a and PMCA4b, were reduced in RGS2KO VSMC. The likely functional consequence of reduced PMCA4 expression in RGS2-deficient cells is reduced net Ca2+ efflux and an increased [Ca2+]i response to SERCA blockade, in complete agreement with our assessment of these cells. Consistent with a relatively greater functional importance of PMCA4, our data also showed that treatment of VSMC with La3+, but not choline, abolished differences in Ca2+ efflux rates between the RGS2-deficient and WT VSMC. Thus, it seems likely that differential PMCA4 regulation in response to chronic PDGF stimulus is a major contributor to the overall differences in Ca2+ efflux between WT and RGS2-deficient cells. Notably, this difference may reflect a VSMC-specific mechanism, since pancreatic acinar cells lacking RGS2 show increased efflux rates relative to WT controls (28). It is also noteworthy that following chronic PDGF treatment, SERCA2a mRNA and SERCA2 protein levels
J Recept Signal Transduct Res, 2014; 34(6): 476–483
were increased in RGS2KO as compared with WT VSMC, which may explain the lower baseline [Ca2+]i observed in RGS2-deficient cells. These data are also in agreement with previous work showing that RGS2-deficient pancreatic acinar cells also express higher levels of SERCA2b as compared with WT controls (28). Although we were regrettably not able to parse the physiological effects of altered PMCA4 versus SERCA2 expression levels in RGS2KO cells from our Fura2AM-defined Ca2+-imaging experiments (data not shown), results from our mRNA, protein, and 45Ca efflux analyses are consistent with a role for PMCA4 in the phenotype of RGS2KO VSMC. It is interesting to speculate on the mechanisms whereby loss of a Gq inhibitor in VSMC can lead to the profound change in proliferation and adaptation of Ca2+-regulatory mechanisms observed. It remains to be determined whether increased levels of Gq or PLCb activity, or their downstream effector molecules, can directly regulate the promoters of PMCA, NCX, or SERCA. Alternatively, the amino terminal domain of RGS2 has also been shown to functionally interact with other intracellular signaling partners including adenylyl cyclase (29), TRPV6 channels (30), and tubulin (31), all of which may result in the observed changes in proliferation and calcium handling through a less conspicuous mechanism. Independent of the mechanism, our current data support a model whereby the loss of RGS2 results in the adaptation of PMCA4 and SERCA expression that tunes the cells differently to mitogenic stimuli.
Conclusions RGS2-deficient VSMC exhibit higher rates of proliferation and coordinate plasticity of Ca2+-handling mechanisms in response to PDGF stimulation. These data are the first to link RGS2 (and its well-established role in the modulation of vasoconstrictor responses and blood pressure in vivo), with a primary VSMC phenotype of enhanced proliferation and growth-permissive calcium dynamics in mitogen-stimulated conditions ex vivo. The significance of this finding in latestage (passages 9–10) cultures is that it implicates RGS2 in the regulation of VSMC proliferation (and, therefore, in potential disorders of VSMC proliferation, such as atherosclerosis, restenosis, and hypertension) independent of its effects on systemic hemodynamics in vivo.
Acknowledgements This work received technical support from the Cell Biology of Atherosclerosis Group at the University of Toronto and the Heart & Stroke/Richard Lewar Centre of Excellence (HSRLCE) in Cardiovascular Research.
Declaration of interest There are no conflicts of interest to report. This study was supported by a Canadian Institutes of Health Research (CIHR) Operating Grant (FRN: MOP-64352) to M. H., and a Heart and Stroke Foundation of Ontario (HSFO) Grant-in-Aid (NA5921) to S. P. H. M. H. is a Career Investigator of the HSFO (CI5503) and S. P. H. is a Canada Research Chair. A. M. S. was supported by a Canadian Hypertension Society (CHS)/Canadian Institutes of Health Research (CIHR) Postdoctoral Fellowship (FRN: JHF-64595). J. C. was supported in part by doctoral student stipend awards from the Ontario Graduate Scholarship and the CIHR.
RGS2 regulates VSMC proliferation and PMCA4
DOI: 10.3109/10799893.2014.920393
Journal of Receptors and Signal Transduction Downloaded from informahealthcare.com by The University of Manchester on 11/21/14 For personal use only.
References 1. Bridges TM, Lindsley CW. G-protein-coupled receptors: from classical modes of modulation to allosteric mechanisms. ACS Chem Biol 2008;3:530–41. 2. Wang G, Wu G. Small GTPase regulation of GPCR anterograde trafficking. Trends Pharmacol Sci 2012;33:28–34. 3. Trenkwalder P. Combination therapy with AT(1)-receptor blockers. J Hum Hypertens 2002;16:S17–25. 4. Mulvany MJ. Small artery remodeling in hypertension. Curr Hypertens Rep 2002;4:49–55. 5. Wieland T, Mittmann C. Regulators of G-protein signalling: multifunctional proteins with impact on signalling in the cardiovascular system. Pharmacol Ther 2003;97:95–115. 6. Gu S, Cifelli C, Wang S, Heximer SP. RGS proteins: identifying new GAPs in the understanding of blood pressure regulation and cardiovascular function. Clin Sci (Lond) 2009;116:391–9. 7. Zhang P, Mende U. Functional role, mechanisms of regulation, and therapeutic potential of regulator of G protein signaling 2 in the heart. Trends Cardiovasc Med 2013;24:85–93. 8. Hercule HC, Tank J, Plehm R, et al. Regulator of G protein signalling 2 ameliorates angiotensin II-induced hypertension in mice. Exp Physiol 2007;92:1014–22. 9. Heximer SP, Knutsen RH, Sun X, et al. Hypertension and prolonged vasoconstrictor signaling in RGS2-deficient mice. J Clin Invest 2003;111:445–52. 10. Sun X, Kaltenbronn KM, Steinberg TH, Blumer KJ. RGS2 is a mediator of nitric oxide action on blood pressure and vasoconstrictor signaling. Mol Pharmacol 2005;67:631–9. 11. Tang KM, Wang GR, Lu P, et al. Regulator of G-protein signaling2 mediates vascular smooth muscle relaxation and blood pressure. Nat Med 2003;9:1506–12. 12. Boelte KC, Gordy LE, Joyce S, et al. Rgs2 mediates pro-angiogenic function of myeloid derived suppressor cells in the tumor microenvironment via upregulation of MCP-1. PLoS One 2011;6: e18534. 13. Hendriks-Balk MC, Hajji N, van Loenen PB, et al. Sphingosine1-phosphate regulates RGS2 and RGS16 mRNA expression in vascular smooth muscle cells. Eur J Pharmacol 2009;606:25–31. 14. Husain M, Bein K, Jiang L, et al. c-Myb-dependent cell cycle progression and Ca2+ storage in cultured vascular smooth muscle cells. Circ Res 1997;80:617–26. 15. Husain M, Jiang L, See V, et al. Regulation of vascular smooth muscle cell proliferation by plasma membrane Ca(2+)-ATPase. Am J Physiol 1997;272:C1947–59. 16. Afroze T, Husain M. c-Myb-binding sites mediate G(1)/Sassociated repression of the plasma membrane Ca(2+)-ATPase-1 promoter. J Biol Chem 2000;275:9062–9. 17. Afroze T, Yang LL, Wang C, et al. Calcineurin-independent regulation of plasma membrane Ca2+ ATPase-4 in the vascular
18.
19.
20.
21.
22.
23.
24.
25. 26.
27.
28.
29.
30. 31.
483
smooth muscle cell cycle. Am J Physiol Cell Physiol 2003;285: C88–95. Afroze T, Sadi AM, Momen MA, et al. c-Myb-dependent inositol 1,4,5-trisphosphate receptor type-1 expression in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 2007;27: 1305–11. Wang Y, Chen J, Wang Y, et al. Crucial role of type 1, but not type 3, inositol 1,4,5-trisphosphate (IP(3)) receptors in IP(3)induced Ca(2+) release, capacitative Ca(2+) entry, and proliferation of A7r5 vascular smooth muscle cells. Circ Res 2001;88: 202–9. Choi J, Chiang A, Taulier N, et al. A calmodulin-binding site on cyclin E mediates Ca2+-sensitive G1/s transitions in vascular smooth muscle cells. Circ Res 2006;98:1273–81. Gros R, Afroze T, You XM, et al. Plasma membrane calcium ATPase overexpression in arterial smooth muscle increases vasomotor responsiveness and blood pressure. Circ Res 2003;93: 614–21. Schuh K, Quaschning T, Knauer S, et al. Regulation of vascular tone in animals overexpressing the sarcolemmal calcium pump. J Biol Chem 2003;278:41246–52. Oliveira-Dos-Santos AJ, Matsumoto G, Snow BE, et al. Regulation of T cell activation, anxiety, and male aggression by RGS2. Proc Natl Acad Sci USA 2000;97:12272–7. Cornwell TL, Lincoln TM. Regulation of intracellular Ca2+ levels in cultured vascular smooth muscle cells. Reduction of Ca2+ by atriopeptin and 8-bromo-cyclic GMP is mediated by cyclic GMPdependent protein kinase. J Biol Chem 1989;264:1146–55. Heximer SP, Srinivasa SP, Bernstein LS, et al. G protein selectivity is a determinant of RGS2 function. J Biol Chem 1999;274:34253–9. Kolodziejska KM, Noyan-Ashraf MH, Nagy A, et al. c-Mybdependent smooth muscle cell differentiation. Circ Res 2008;102: 554–61. Afroze T, Yang G, Khoshbin A, et al. Calcium efflux activity of plasma membrane Ca2+ ATPase-4 (PMCA4) mediates cell cycle progression in vascular smooth muscle cells. J Biol Chem 2014; 289:7221–31. Wang X, Huang G, Luo X, et al. Role of regulator of G protein signaling 2 (RGS2) in Ca(2+) oscillations and adaptation of Ca(2+) signaling to reduce excitability of RGS2/ cells. J Biol Chem 2004;279:41642–9. Salim S, Sinnarajah S, Kehrl JH, Dessauer CW. Identification of RGS2 and type V adenylyl cyclase interaction sites. J Biol Chem 2003;278:15842–9. Schoeber JP, Topala CN, Wang X, et al. RGS2 inhibits the epithelial Ca2+ channel TRPV6. J Biol Chem 2006;281:29669–74. Heo K, Ha SH, Chae YC, et al. RGS2 promotes formation of neurites by stimulating microtubule polymerization. Cell Signal 2006;18:2182–92.
