http://informahealthcare.com/grf ISSN: 0897-7194 (print), 1029-2292 (electronic) Growth Factors, 2015; 33(1): 31–39 ! 2014 Informa UK Ltd. DOI: 10.3109/08977194.2014.957759
RESEARCH PAPER
Enhanced osteoinductivity of recombinant human bone morphogenetic protein-2 in combination with epidermal growth factor in a rabbit tibial defect model Jae Hyup Lee1,2, Hae-Ri Baek1, Kyung Mee Lee1, Dong-Yeon Lee3, and A-Young Lee4 1
Department of Orthopedic Surgery, College of Medicine, SMG-SNU Boramae Medical Center, Seoul National University, Seoul, Korea, Institute of Medical and Biological Engineering, Seoul National University Medical Research Center, Seoul, Korea, 3Department of Orthopedic Surgery, College of Medicine, Seoul National University Hospital, Seoul National University, Seoul, Korea, and 4Bio-Division, DaeWoong Pharmaceuticals, Seoul, Korea
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
2
Abstract
Keywords
This study aims to explore the effect of recombinant human bone morphogenetic protein-2 (rhBMP-2) on bone formation when treated with epidermal growth factor (EGF) using human mesenchymal stem cells (hMSCs) and a rabbit tibial defect model. The rhBMP-2 (250 ng/ ml)+EGF (10 ng/ml) group showed higher alkaline phosphatase (ALP) activity, ALP expression, increased calcium amount than rhBMP-2 group. In micro-CT and histology results of animal experiments, the rhBMP-2+EGF group showed more amount of bone bridging compared to the rhBMP-2 group. Among the 8-week groups, the rhBMP-2+EGF group showed significantly higher percent bone volume and trabecular number compared to the rhBMP-2 group. The combined treatment with EGF and rhBMP-2 induced significantly higher bone formation compared to that of rhBMP-2 only in both hMSCs and a rabbit tibial defect model. Therefore, EGF is expected to facilitate bone formation effect of rhBMP-2 when both factors are treated in combination.
Bone morphogenetic protein-2, epidermal growth factor, osteogenesis, synergy
Introduction Recombinant human bone morphogenetic protein-2 (rhBMP2) and rhBMP-7 are known to play essential roles in bone formation, remodeling and engineering (Benglis et al., 2008). The proteins have been reported as good replacements of autologous bone graft in non-union, spine fusion and bone defect (Corenman et al., 2013; Moghaddam-Alvandi et al., 2012). However, rhBMP-2 is also known to cause soft tissue swelling, osteolysis and retrograde ejaculation by inducing ectopic bone formation, seroma formation and inflammation (Carragee et al., 2011; Helgeson et al., 2011; Smoljanovic et al., 2011). The occurrence of the side effect is known to be dependent on the rhBMP-2 dosage (Carragee et al., 2011). The lumbar spine fusion generally requires several milligrams of rhBMP-2, representing very high dose. Reduced amount of rhBMP-2 can lower possibility of the side effects, but at the same time, it can also decrease fusion rate or union rate and thereby reducing success rate of the surgery.
Correspondence: Dr. Jae Hyup Lee, Associate Professor of Department of Orthopaedic Surgery, College of Medicine, Institute of Medical and Biological Engineering, Seoul National University Medical Research Center, SMG-SNU Boramae Medical Center, Seoul National University, Boramae-gil, 5-ro, Dongjak-gu, Seoul 156-707, Korea. Tel: +82-2-8702314. Fax: +82-2-870-3863. E-mail: [email protected]
History Received 19 July 2014 Revised 19 August 2014 Accepted 20 August 2014 Published online 26 September 2014
Upon fracture, bone remodeling, formation and repair processes are induced by released growth factors including TGF-b family, fibroblast growth factor (FGF), epidermal growth factor (EGF), insulin-like growth factor (IGF) and platelet-derived growth factor (PDGF). These factors are also known to promote cell migration, proliferation and differentiation in human bone marrow stem cells (Lieberman et al., 2002). Therefore, combined use of the growth factors with rhBMP-2 can lower rhBMP-2 dose or enhance osteogenic effect. Recently, our group showed that EGF induces synergistic effect on early stage of rhBMP-2-mediated bone formation but the effect is gradually decreased as time passes in a rat calvarial defect model (Lee et al., 2014). However, in a calvarial defect model, the defect area is surrounded by remnant host bone and thus, spontaneous defect healing may occur due to bone formation activity of mesenchymal stem cells (MSCs) in the host bone. On the contrary, tibia consists of cortical bone. Especially, mid-shaft area has almost no cancellous bone and is hard to achieve bone union because the fracture area moves under weightbearing condition (Choi et al., 2011; Lee et al., 2010). Thus, the defect in tibial shaft is hard to expect spontaneous healing or bone union even after bone graft. Since a tibial critical bone defect is harder to treat than a calvarial defect, our study design with the tibial defect model is considered to provide more clinically relevant information for the effect of EGF on
32
J. H. Lee et al.
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
rhBMP-2-mediate bone formation. Thus, this research aims to evaluate if the rhBMP-2 treatment in combination with EGF or FGF shows synergistic effect on osteoinduction in osteoblastically differentiated human MSCs and a rabbit tibial bone defect model.
Growth Factors, 2015; 33(1): 31–39
Table 1. Primer sequences used for the RT-PCR.
Primer ALP
Methods
BSP
Cell culture
Collagen I
Human mesenchymal stem cells (hMSCs) (Lonza, Walkersville, MD) were cultured up to five passages in low glucose-Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum and 1% antibiotic–antimycotics (Gibco, Carlsbad, CA). The cells were cultured in a humidified incubator setting at 37 C with 5% CO2 and the medium supplemented with 108 M dexamethasone, 100 mM ascorbic acid-2-phosphate and 10 mM b-glycerophosphate (Sigma, St. Louis, MO) up to 21 days and was changed every 2–3 days. The differentiated or non-differentiated cells were further divided into five groups as follows: (i) control group: control medium, (ii) induce group: medium for osteogenic differentiation, (iii) BMP2 group: 250 ng/ml rhBMP-2 (Novosis; Daewoong Pharmaceuticals Co., Ltd, Seoul, Korea) in osteogenic medium, (iv) BMP2+EGF group: 250 ng/ml rhBMP-2 and 10 ng/ml EGF (Daewoong Pharmaceuticals Co., Ltd, Seoul, Korea) in osteogenic medium and (v) BMP2+FGF group: 250 ng/ml rhBMP-2 and 10 ng/ml FGF (Fiblast; Kaken Pharmaceutical Co., Ltd, Tokyo, Japan) in osteogenic medium. Alkaline phosphatase staining and alkaline phosphatase activity assay Alkaline phosphatase (ALP) staining was performed at 3, 7 and 14 days after the treatments. The treated cells were washed with phosphate-buffered saline solution (Gibco, Carlsbad, CA), fixed with 10% formalin for 30 s, and rinsed with distilled water for 45 s. And then, the cells were stained with fast blue RR salt (Sigma-Aldrich Denmark A/S, Brondby, Denmark) and 0.25% naphthol AS-MX phosphate alkaline solution buffer (Sigma, Munich, Germany) for 20 min at room temperature. ALP hydrolyzes p-nitrophenyl phosphate and produces p-nitrophenol, a yellow product measured for estimating the enzyme activity. The absorbance was compared with a standard curve prepared with nitrophenol standard solution and the enzyme activity was normalized to total protein concentration of the lysate. Alizarin red-S staining and calcium assay hMSCs were cultured in 24-well plates and left untreated or treated with rhBMP-2 alone or in combination with EGF or FGF for 7, 14 and 21 days. During the entire course of the experiments, medium was changed and the factors (rhBMP-2, EGF and FGF) were freshly added every 3 days. The treated cells were fixed in 70% ethanol at 4 C for 1 h, rinsed with distilled water and stained with 40 mM alizarin red-S (Sigma, St. Louis, MO) at pH 4.2 at room temperature for 10 min. For quantitation of calcium concentration, hMSCs were treated for 7, 14 and 21 days in 96-well plates. The level of
GAPDH
Sequence (50 !30 ) F: TGGAGCTTCAGAAGCTCAACACCA R: ATCTCGTTGTCTGAGTACCAGTCC F: CGAAGACAACAACCTCTCCAAATG R: ACCATCATAGCCATCGTAGCCTTG F: CATGAGAGCCCTCACA R: AGAGCGACACCCTAGAC F: GGGCTGCTTTTAACTCTGGT R: TGGCAGGTTTTTCTAGACGG
Anneal temperature ( C)
Product (bp)
65
454
53
257
44
300
54
702
calcium was measured using the QuantiChrom calcium assay kit (BioAssay Systems, Hayward, CA) according to the manufacturer’s instruction. All measurements were done in triplicate. The calcium level was normalized to total protein concentration of the cell lysates. Reverse-transcription polymerase chain reaction ALP, BSP and type I collagen was measured and normalized to the level of GAPDH. Total RNA was isolated from each group of hMSCs using Trizol reagent (Invitrogen Canada Inc., Burlington, Canada) according to the manufacturer’s instruction. The sequences of primers used for osteogenic markers are listed in Table 1. The PCR buffer composition was 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 25 mM MgCl2, 10 mM dNTPs (2.5 mM each) and 0.5 units of i-TaqÔ was used as a DNA polymerase. PCR conditions were as follows: 30 s at 95 C, 30 s at annealing temperature (28–32 cycles) and 60 s at 72 C. The PCR products were separated in 1.5% agarose gels and analyzed by densitometry using the Leica imaging software (Leica Microsystems, Wetzlar, Germany). Animal model and surgical procedure A total of 48 New Zealand white male rabbits (3–3.5 kg) were allocated into the following groups; eight rabbits for 2-week group, eight for 4-week group and 32 for 8-week group. This study was permitted by the Standing Committee on Ethics at the Institutional Animal Care and Use Protocol Approval at the Clinical Research Institute (IACUC No. 10-0034) of Seoul National University Hospital Biomedical Research Institute. Zoletil and rumpun were intramuscularly injected for general anesthesia and one side of tibial area was shaved and sterilized with betadine. The hind limb was covered with sterilized drapes and skin incision was made at the medial border along longitudinal axis. The tibia was exposed by dissecting fascia and periosteum. Using a vertical saw, 1 cm length of a defect was generated in the middle of tibia diaphysis and 2 K-wires per each part were inserted perpendicularly into upper and lower parts of the defect. The defect was irrigated with saline after fixation with an external fixator (Figure 1). Type II collagen was used as a carrier for rhBMP-2, EGF and FGF. Each week group of rabbits was further divided into four groups based on graft material as follows: (i) collagen group: collagen only, (ii) BMP-2 group: rhBMP-2 10 mg group, (iii) EGF group: rhBMP-2 10 mg and EGF 10 mg group and (iv) FGF group: rhBMP-2 10 mg and FGF 10 mg group. The animals were intramuscularly injected
EGF with rhBMP-2 enhances osteoinductivity
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
DOI: 10.3109/08977194.2014.957759
33
Figure 1. Surgical procedures. (A) A K-wire was inserted in the proximal portion of the tibia. (B) Another K-wire was inserted in the distal portion of the tibia and an external fixator was installed. (C) A defect with 1 cm length was generated. (D) The exposed tibial defect. (E) The defect was removed. (F) The removed tibial defect. (G) Collagen sponge which was treated with or without proteins was inserted into the defect. (H) External fixator was fixed in the medial aspect of the tibia.
with 0.5 g of cefazolin right before and after the operation and for additional 2 days. After the operation, animals were raised without intervention and euthanized by intravenously injecting KCl at either 2, 4 or 8 weeks.
acrylic slide attachment and hematoxylin and eosin (H&E) staining. Light microscopy was used to monitor newly formed bone in the defect. Statistical analysis
Radiographic evaluation Plain radiography was performed at 2, 4 and 8 weeks after the operation depending on the week groups. Samples were harvested for high-resolution radiography with Skyscan 1173 micro-CT (Bruker, Aartselaar, Belgium) under the condition of 130 kV and 60 mA. The taken images were reconstructed in sagittal, coronal and axial planes and bone healing of the tibial defect site in the sagittal and coronal planes was compared. The length ratio of the bone bridge connecting upper and lower parts of the defect was analyzed by comparing the sagittal images of micro-CT. Also, bone quality and bone quantity of the tibial defect center was analyzed by measuring parameters of micro-CT. Histology The area including the defect and surrounding tissues was harvested and fixed with formalin for 5 days. The fixed tissues were gross-sectioned, washed in a cassette for 6 h and dehydrated in 100% alcohol. The dehydrated tissues were stirred in methacrylate-based chemical curing resin for 2 days, stirred and embedded with dissolved benzoyl peroxide. After trimming, the block was cut in a longitudinal axis of the tibia with EXAKT (BS-3000N) and 4 mm thickness sections were generated in sagittal plane. The sections were subjected to
ALP activity and new bone formation by micro-CT were analyzed with one-way analysis of variance (ANOVA) after normality test. Student–Newman–Keuls test was used for post hoc analysis. Calcium level was analyzed by ANOVA test if the data are normally distributed or by Kruskal–Wallis test if not 2 square test was used for post hoc analysis. Values of p50.05 were considered statistically significant.
Results In vitro results ALP staining and ALP activity assay At 3 days after the differentiation, the BMP2 group and the BMP2+EGF group showed strong ALP staining results (Figure 2A). The BMP2+EGF group showed maximum ALP staining at Day 7, but the BMP2+FGF group showed similar staining as the induce group. The ALP staining was noticeably decreased in all test groups at Day 14. ALP activity was gradually increased as time passes (Figure 2B). There was no clear difference in the activity among the groups at Day 3. The combination treatment with either EGF or FGF showed relatively high ALP activity at Day 7. At Day 14, the BMP2 group represented high ALP
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
34
J. H. Lee et al.
Growth Factors, 2015; 33(1): 31–39
Figure 2. ALP staining and ALP activity of BMSCs. (A) ALP staining, magnification: 10. The BMP2+EGF group showed maximum ALP staining at Day 7. (B) ALP activity assay. At Day 14, the BMP2+EGF group showed higher ALP activity than all the other groups (p50.001 for all).
activity and the BMP2+EGF group showed even higher ALP activity than all the other groups (p50.001 for all). While the BMP2+EGF group showed very clear ALP activity increase range, the activity was not increased further at Day 14 compared to Day 7 in the BMP2+FGF group.
induce group represented significantly higher level (p ¼ 0.029). At Day 21, the control group showed significantly lower calcium level than the other groups (p50.001 for the BMP2 group and p ¼ 0.001 for the other groups) and there was no significant difference among all the other groups.
Calcium accumulation during osteogenic differentiation The BMP2 group and the BMP2+EGF group showed relatively high accumulation of calcium mineralization at Day 7 (Figure 3A). At Day 14, the BMP2 +EGF group and the BMP2+FGF group showed higher mineralization than the BMP-2 group. At Day 21, the AR-S staining was increased in all groups except the control group. The BMP2 group showed relatively high increase in calcium accumulation at Day 7, but statistical significance was not found (Figure 3B). At Day 14, the BMP2+EGF group showed significantly higher calcium level than the other groups (p50.0001, p ¼ 0.047, p50.0001 and p50.0001 for the control, induce, BMP2 and BMP2+FGF group, respectively). Compared to the BMP2+FGF group, the
Changes of gene expression in the hMSC Compared to the levels in the control and the induce groups, the ALP expression was increased overall in the BMP2, the BMP2+EGF and the BMP2+FGF groups (Figure 4). The ALP expression was increased in the BMP2 group, the BMP2+EGF group and the BMP2+FGF group at Day 7, 14 and 21. In the BMP2 group, the BSP gene expression was increased up to 14 days after the treatments, but the level was decreased at Day 21. On the other hand, the combination treatment groups with either EGF or FGF showed gradually increasing expression of BSP gene in a time-dependent manner. The expression of type I collagen was not different among the groups.
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
DOI: 10.3109/08977194.2014.957759
EGF with rhBMP-2 enhances osteoinductivity
35
Figure 3. Alizarin red-S staining and calcium assay. (A) Alizarin red-S staining, magnification: 10. At Day 14, the BMP2+EGF group and the BMP2+FGF group showed higher mineralization than the BMP-2 group. (B) Calcium assay. At Day 14, the BMP-2 + EGF group showed significantly higher calcium level than the other groups.
In vivo results Radiographic results In plain radiographic results, the collagen group showed almost none of new bone formation in the defect up to 4 weeks (Figure 5). At 8 weeks, little amount of bone formation was found, but not enough for bridging. In the BMP-2 group and the FGF group, new bone formation in the defect became clear at 4 weeks and bone bridging was found at 8 weeks. The EGF group showed marked bone bridging and increased bone density. In micro-CT results, the collagen group did not show bone bridging even at 8 weeks, whereas in the BMP-2 group, bridging was formed at 4 weeks and cortical bone completely covered the defect and new bone formation was found in marrow cavity at 8 weeks (Figure 6). The EGF group showed higher bone formation than the BMP-2 group at 4 weeks and cortical bone bridging and new bone formation in the entire area of the defect were observed at 8 weeks. In the FGF group, the level of bone formation was lower than the one in the BMP-2 group at 4 weeks. At 8 weeks, new bone formation as well as cortical bone bridging in the entire defect
area was found even though the bone bridging was not complete. The sagittal reconstruction of micro-CT images at 8 weeks represented that the ratio of bone bridge formation in the defect was the highest in the EGF group (48.5 ± 33.6%) compared to the BMP-2 group (15.8 ± 15.3%), the FGF group (22.9 ± 36.6%) and the collagen group (5.3 ± 7.7%). The EGF group and the FGF group showed significantly higher ratio of bone bridge formation than the collagen group and BMP-2 group (p50.001, both). Percent bone volume of the EGF group was significantly higher than those of the others (p50.01, all) (Table 2). The FGF group showed significantly higher percent bone volume than the collagen group and the BMP-2 group (p ¼ 0.0002 and p ¼ 0.011, respectively). Trabecular thickness of the EGF group was significantly higher than the level of the FGF group and the collagen group (p ¼ 0.0006 and p ¼ 0.0193, respectively). Trabecular number of the EGF group was significantly higher than those of the others (p50.05, all). Trabecular pattern factor of the EGF group was significantly lower than the level of the collagen group and the BMP-2 group (p50.0001 and p ¼ 0.0122,
36
J. H. Lee et al.
Growth Factors, 2015; 33(1): 31–39
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
Figure 4. Effect of BMP-2 and growth factors on ALP, BSP and type I collagen mRNA expression in BMSCs. The ALP expression was increased overall in the BMP2, the BMP2+EGF and the BMP2+FGF groups. The combination treatment groups with either EGF or FGF showed gradually increasing expression of BSP gene in a time-dependent manner.
Figure 5. Plain radiograph results. In the BMP-2 group and the FGF group, new bone formation in the defect became clear at 4 weeks and bone bridging was found at 8 weeks. The EGF group showed marked bone bridging and new bone density.
respectively). The FGF group showed significantly lower trabecular pattern factor than the BMP-2 group and the collagen group (p ¼ 0.0004 and p ¼ 0.0001, respectively). Histological results In undecalcified histology of the collagen group, new born formation was not observed up to 4 weeks (Figure 7). The BMP-2 group formed bone bridging in the defect at 2 and 4 weeks. At 8 weeks, cortical bone bridging was complete but new bone formation in the marrow space was scanty. The EGF group formed bone bridging in the defect and part of the marrow space at 2 and 4 weeks. At 8 weeks, the entire marrow space and the cortical bone area were covered with newly formed bone in the EGF group, indicating much clearer bone remodeling than the BMP-2 group. The FGF group showed relatively less amount of new bone formation in the marrow space at 4 weeks than the EGF group. At 8 weeks, cortical bone bridging was complete.
Discussion BMPs are important proteins for bone formation, differentiation and regeneration and have been widely used for bone fusion in clinic. EGF and FGF are mitogens secreted from various cell types and play roles in cell proliferation and bone formation. FGF is known to mediate cellular responses by binding and activating receptor tyrosine kinases named FGF receptors 1–4 (Bottcher & Niehrs, 2005; Kim et al., 2007). FGF has been reported to promote proliferation of osteoblastic cells and stimulate bone formation in in vivo models (Nakamura et al., 1995; Rodan et al., 1989). EGF functions as a potent mitogen of bone marrow multipotential stromal cells and osteoblastic progenitor cells and is involved in osteoclastogenesis and bone resorption (Tamama et al., 2006; Zhang et al., 2011). In the current study, the rhBMP-2 treatment on hMSCs induced higher ALP activity and calcium mineralization compared to the control and the levels were further increased when treated in combination with EGF. Recently, the
EGF with rhBMP-2 enhances osteoinductivity
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
DOI: 10.3109/08977194.2014.957759
37
Figure 6. Micro-CT results. The Collagen group did not show bone bridging even at 8 weeks, whereas in the BMP-2 group, bridging was formed at 4 weeks and cortical bone completely covered the defect and new bone formation was found in marrow cavity at 8 weeks. The EGF and FGF group showed marked bone bridging and new bone formation in marrow space.
Table 2. Micro-CT results of the 8-week groups. Mean (standard deviation) Group (n) Collagen (8) rhBMP-2 (8) EGF (8) FGF (8) p Value
BV/TV
BS/BV
Tb.Pf
Tb.Th
Tb.N
Tb.Sp
4.6 (2.2) 10.6 (2.4) 32.4 (8.9) 19.3 (8.0) 50.001
38.0 (3.5) 32.9 (11.3) 22.3 (5.5) 29.2 (7.6) 0.003
3.1 (4.6) 4.4 (4.7) 6.52 (4.0) 4.5 (3.7) 50.001
0.16 (0.02) 0.18 (0.04) 0.21 (0.03) 0.19 (0.03) 0.021
0.3 (0.15) 0.75 (0.42) 1.54 (0.35) 1.05 (0.48) 50.001
2.53 (0.6) 1.19 (0.33) 0.75 (0.28) 1.2 (0.54) 50.001
The EGF group showed significantly higher percent bone volume, trabecular number and trabecular thickness than the other groups. Tabecular pattern factor of the EGF group was significantly lower than the level of the collagen group and the BMP-2 group. Values are expressed as mean (standard deviation).
combined treatment with EGF (10 ng/ml) and rhBMP-2 (10 ng/ml) was reported to increase osteoblast proliferation but lower bone nodule formation (Laflamme et al., 2010). Whereas, the combination of high dose rhBMP-2 (250 ng/ml) and EGF (10 ng/ml) induced remarkably increased ALP activity and calcium accumulation as shown in our study. These results suggest that differential combinations of the protein dose induce different effects regarding bone formation. In our in vitro model, BSP gene expression was increased up to 14 days in the treatment with rhBMP-2 only, while the expression was increased in a time-dependent manner in the BMP-2+EGF group. Activation of EGFR signaling by EGF-like ligand was reported to suppress the expression of early and late bone marker genes and block osteogenesis (Zhu et al., 2011). However, osteoblastic EGFR activity is known to lower osteoclast activation and bone resorption
(Nakamura et al., 1995). EGF itself can stimulate osteoblast growth but the combination with rhBMP-2 is known to further enhance the cell growth compared to either rhBMP-2 or EGF only (Laflamme et al., 2010). To sum up, EGFR signaling is considered to play anabolic roles in bone metabolism and the in vitro result of the synergistic effect on bone formation by EGF and rhBMP-2 may come from the anabolic effect of EGF signaling (Zhang et al., 2011). In a rabbit tibial defect model, the EGF group represented significantly higher percent bone volume and trabecular number of newly formed bone, indicating enhanced bone formation by osteoblast activation. Moreover, trabecular pattern factor, an index of bone quality, was significantly lower in the EGF group than in the BMP-2 group, suggesting increased trabeculation by bone remodeling. The improved bone quality by trabeculation requires proper bone resorption by osteoclast as well as bone formation by osteoblast.
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
38
J. H. Lee et al.
Growth Factors, 2015; 33(1): 31–39
Figure 7. Histology results. H&E (12.5, 40 and 100). (A) Collagen group. There was no new bone formation. (B) BMP-2 group. Bone bridging was found in the defect at 2, 4 and 8 weeks. (C) EGF group. Bone bridging was found in the defect and part of the marrow space at 2 and 4 weeks. At 8 weeks, the entire marrow space was covered with new bone. (D) FGF group. New bone formation was evident at 2 and 4 weeks. At 8 weeks, cortical bone bridging was complete. Arrow head denotes defect margin, arrow denotes collagen and star denotes new bone.
Thus, the effect comes from increased osteoblastic differentiation and osteoclastogenesis by the EGF combination treatment. These results are consistent with previous reports showing that EGFR signaling regulates osteoclast formation and play roles in osteoclast differentiation and survival by cross-talking with RANK signaling pathways (Wang et al., 2004; Yi et al., 2008). However, excessive osteoclastogenesis can disrupt bone formation and trabeculation remodeling, which are processes requiring properly controlled osteoblast differentiation and osteoclastogenesis. Even though our rabbit tibial defect model proved the superior efficacy of the combination treatment with rhBMP-2 10 mg and EGF 10 mg in bone formation over the single treatment, additional studies are required for determining proper dose combination of both factors for application to human. In the combination treatment with FGF, ALP activity was slightly reduced without statistical significance and calcium level was similar compared to the levels in the BMP2 group. FGF was reported to facilitate BMP-2-mediated ectopic bone formation by inducing expression of BMP receptor-1B,
phosphorylated Smad1, Noggin and osteocalcin in low dose, while it inhibited the ectopic bone formation in high dose (Nakamura et al. 2005). Even though our in vitro study used relatively low dose (10 ng/ml) of FGF, the synergistic effect with rhBMP-2 was not found, suggesting that the effect of FGF on rhBMP-2-mediated osteogenesis is insignificant. Our study is limited to test only one dose of each growth factor in combination with rhBMP-2. It is likely that a dose of growth factor and environment for cell proliferation affect bone fusion outcomes. Therefore, there should be an optimal condition of growth factors for osteoblastic differentiation of hMSC and bone formation in in vivo study, and thus further detailed study needs to be followed. There are not many reports about the combination treatment of rhBMP-2 and a growth factor, even though its importance has been recognized. Our study provides both in vitro and in vivo evidences showing the effect of the combination treatment using a rabbit tibial defect model offering intractable bone formation condition.
EGF with rhBMP-2 enhances osteoinductivity
DOI: 10.3109/08977194.2014.957759
Table 3. Student–Newman–Keuls test for all pairwise comparisons.
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
Factor 1. Percent bone volume (1) BMP (2) COL (3) EGF (4) FGF 2. Specific surface (1) BMP (2) COL (3) EGF (4) FGF 3. Trabecular pattern factor (1) BMP (2) COL (3) EGF (4) FGF 4. Trabecular thickness (1) BMP (2) COL (3) EGF (4) FGF 5. Trabecular number (1) BMP (2) COL (3) EGF (4) FGF 6. Trabecular separation (1) BMP (2) COL (3) EGF (4) FGF
n
Mean
Different (p50.05) from factor nr
8 8 8 8
10.5491 4.6039 832.3801 819.2708
(3) (4) (3) (4) (1) (2) (4) (1) (2) (3)
8 8 8 8
32.9170 38.0306 822.3279 829.2385
(3) (3) (1) (2)
8 8 8 8
4.3456 3.1048 86.5221 84.4947
(3) (3) (1) (1)
8 8 8 8
0.1775 0.1562 80.2084 80.1869
(3) (2)
8 8 8 8
0.7505 0.3014 81.5383 81.0530
(2) (3) (1) (3) (4) (1) (2) (4) (2) (3)
8 8 8 8
1.1900 2.5316 80.7487 81.1990
(2) (1) (3) (4) (2) (2)
(4) (4) (2) (2)
Conclusion Collectively, the combination treatment with low dose EGF and rhBMP-2 enhanced osteoblastic differentiation of hMSCs as evidenced by increased ALP activity and mineralization compared to the rhBMP-2 treatment. Also, the rabbit tibial defect model showed increased bone formation and bone quality when rhBMP-2 was treated in combination with EGF. Therefore, the combined treatment of rhBMP-2 and EGF can be useful treatment for bone regeneration.
Declaration of interest This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2013R1A1A2061858). No benefits in any form have been or will be received from a professional and financial affiliations related directly or indirectly to the subject of this article.
References Benglis D, Wang MY, Levi AD. 2008. A comprehensive review of the safety profile of bone morphogenetic protein in spine surgery. Neurosurgery 62:423–431. Bottcher RT, Niehrs C. 2005. Fibroblast growth factor signaling during early vertebrate development. Endocr Rev 26:63–77.
39
Carragee EJ, Hurwitz EL, Weiner BK. 2011. A critical review of recombinant human bone morphogenetic protein-2 trials in spinal surgery: Emerging safety concerns and lessons learned. Spine J 11: 471–491. Choi IH, Cho TJ, Moon HJ. 2011. Ilizarov treatment of congenital pseudarthrosis of the tibia: A multi-targeted approach using the Ilizarov technique. Clin Orthop Surg 3:1–8. Corenman DS, Gillard DM, Dornan G, Strauch E. 2013. Recombinant human BMP-2-augmented transforaminal lumbar interbody fusion for the treatment of chronic low back pain secondary to the homogeneous diagnosis of discogenic pain syndrome: Two-year outcomes. Spine 38: E1269–E1277. Helgeson MD, Lehman Jr RA, Patzkowski JC, Dmitriev AE, Rosner MK, Mack AW. 2011. Adjacent vertebral body osteolysis with bone morphogenetic protein use in transforaminal lumbar interbody fusion. Spine J 11:507–510. Kim SJ, Kim SY, Kwon CH, Kim YK. 2007. Differential effect of FGF and PDGF on cell proliferation and migration in osteoblastic cells. Growth Factors 25:77–86. Laflamme C, Curt S, Rouabhia M. 2010. Epidermal growth factor and bone morphogenetic proteins upregulate osteoblast proliferation and osteoblastic markers and inhibit bone nodule formation. Arch Oral Biol 55:689–701. Lee JH. Jang SJ, Baek HR, Lee KM, Chang BS, Lee CK. 2014. Synergistic induction of early stage of bone formation by combination of recombinant human bone morphogenetic protein-2 and epidermal growth factor. J Tissue Eng Reg Med [Epub ahead of print]. Lee MJ, Sohn SK, Kim KT, Kim CH, Ahn HB, Rho MS, Jeong MH, Sun SK. 2010. Effect of hydroxyapatite on bone integration in a rabbit tibial defect model. Clin Orthop Surg 2:90–97. Lieberman JR, Daluiski A, Einhorn TA. 2002. The role of growth factors in the repair of bone. Biology and clinical applications. J Bone Joint Surg Am 84:1032–1044. Moghaddam-Alvandi A, Zimmermann G, Buchler A, Elleser C, Biglari B, Grutzner PA, Wolfl CG. 2012. Results of nonunion treatment with bone morphogenetic protein 7 (BMP-7). Der Unfallchirurg 115:518–526. Nakamura T, Hanada K, Tamura M, Shibanushi T, Nigi H, Tagawa M, Fukumoto S, Matsumoto T. 1995. Stimulation of endosteal bone formation by systemic injections of recombinant basic fibroblast growth factor in rats. Endocrinology 136:1276–1284. Nakamura Y, Tensho K, Nakaya H, Nawata M, Okabe T, Wakitani S. 2005. Low dose fibroblast growth factor-2 (FGF-2) enhances bone morphogenetic protein-2 (BMP-2)-induced ectopic bone formation in mice. Bone 36:399–407. Rodan SB, Wesolowski G, Thomas KA, Yoon K, Rodan GA. 1989. Effects of acidic and basic fibroblast growth factors on osteoblastic cells. Connect Tissue Res 20:283–288. Smoljanovic T, Rakovac M, Bojanic I. 2011. Could chronic host inflammatory response be responsible for delayed onset of retrograde ejaculation after the labeled use of recombinant human bone morphogenetic protein-2? Spine J 11:167–168. Tamama K, Fan VH, Griffith LG, Blair HC, Wells A. 2006. Epidermal growth factor as a candidate for ex vivo expansion of bone marrowderived mesenchymal stem cells. Stem cells 24:686–695. Wang K, Yamamoto H, Chin JR, Werb Z, Vu TH. 2004. Epidermal growth factor receptor-deficient mice have delayed primary endochondral ossification because of defective osteoclast recruitment. J Biol Chem 279:53848–53856. Yi T, Lee HL, Cha JH, Ko SI, Kim HJ, Shin HI, Woo KM, et al. 2008. Epidermal growth factor receptor regulates osteoclast differentiation and survival through cross-talking with RANK signaling. J Cell Physiol 217:409–422. Zhang X, Tamasi J, Lu X, Zhu J, Chen H, Tian X, Lee TC, et al. 2011. Epidermal growth factor receptor plays an anabolic role in bone metabolism in vivo. J Bone Miner Res 26:1022–1034. Zhu J, Shimizu E, Zhang X, Partridge NC, Qin L. 2011. EGFR signaling suppresses osteoblast differentiation and inhibits expression of master osteoblastic transcription factors Runx2 and Osterix. J Cell Biochem 112:1749–1760.
RESEARCH PAPER
Enhanced osteoinductivity of recombinant human bone morphogenetic protein-2 in combination with epidermal growth factor in a rabbit tibial defect model Jae Hyup Lee1,2, Hae-Ri Baek1, Kyung Mee Lee1, Dong-Yeon Lee3, and A-Young Lee4 1
Department of Orthopedic Surgery, College of Medicine, SMG-SNU Boramae Medical Center, Seoul National University, Seoul, Korea, Institute of Medical and Biological Engineering, Seoul National University Medical Research Center, Seoul, Korea, 3Department of Orthopedic Surgery, College of Medicine, Seoul National University Hospital, Seoul National University, Seoul, Korea, and 4Bio-Division, DaeWoong Pharmaceuticals, Seoul, Korea
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
2
Abstract
Keywords
This study aims to explore the effect of recombinant human bone morphogenetic protein-2 (rhBMP-2) on bone formation when treated with epidermal growth factor (EGF) using human mesenchymal stem cells (hMSCs) and a rabbit tibial defect model. The rhBMP-2 (250 ng/ ml)+EGF (10 ng/ml) group showed higher alkaline phosphatase (ALP) activity, ALP expression, increased calcium amount than rhBMP-2 group. In micro-CT and histology results of animal experiments, the rhBMP-2+EGF group showed more amount of bone bridging compared to the rhBMP-2 group. Among the 8-week groups, the rhBMP-2+EGF group showed significantly higher percent bone volume and trabecular number compared to the rhBMP-2 group. The combined treatment with EGF and rhBMP-2 induced significantly higher bone formation compared to that of rhBMP-2 only in both hMSCs and a rabbit tibial defect model. Therefore, EGF is expected to facilitate bone formation effect of rhBMP-2 when both factors are treated in combination.
Bone morphogenetic protein-2, epidermal growth factor, osteogenesis, synergy
Introduction Recombinant human bone morphogenetic protein-2 (rhBMP2) and rhBMP-7 are known to play essential roles in bone formation, remodeling and engineering (Benglis et al., 2008). The proteins have been reported as good replacements of autologous bone graft in non-union, spine fusion and bone defect (Corenman et al., 2013; Moghaddam-Alvandi et al., 2012). However, rhBMP-2 is also known to cause soft tissue swelling, osteolysis and retrograde ejaculation by inducing ectopic bone formation, seroma formation and inflammation (Carragee et al., 2011; Helgeson et al., 2011; Smoljanovic et al., 2011). The occurrence of the side effect is known to be dependent on the rhBMP-2 dosage (Carragee et al., 2011). The lumbar spine fusion generally requires several milligrams of rhBMP-2, representing very high dose. Reduced amount of rhBMP-2 can lower possibility of the side effects, but at the same time, it can also decrease fusion rate or union rate and thereby reducing success rate of the surgery.
Correspondence: Dr. Jae Hyup Lee, Associate Professor of Department of Orthopaedic Surgery, College of Medicine, Institute of Medical and Biological Engineering, Seoul National University Medical Research Center, SMG-SNU Boramae Medical Center, Seoul National University, Boramae-gil, 5-ro, Dongjak-gu, Seoul 156-707, Korea. Tel: +82-2-8702314. Fax: +82-2-870-3863. E-mail: [email protected]
History Received 19 July 2014 Revised 19 August 2014 Accepted 20 August 2014 Published online 26 September 2014
Upon fracture, bone remodeling, formation and repair processes are induced by released growth factors including TGF-b family, fibroblast growth factor (FGF), epidermal growth factor (EGF), insulin-like growth factor (IGF) and platelet-derived growth factor (PDGF). These factors are also known to promote cell migration, proliferation and differentiation in human bone marrow stem cells (Lieberman et al., 2002). Therefore, combined use of the growth factors with rhBMP-2 can lower rhBMP-2 dose or enhance osteogenic effect. Recently, our group showed that EGF induces synergistic effect on early stage of rhBMP-2-mediated bone formation but the effect is gradually decreased as time passes in a rat calvarial defect model (Lee et al., 2014). However, in a calvarial defect model, the defect area is surrounded by remnant host bone and thus, spontaneous defect healing may occur due to bone formation activity of mesenchymal stem cells (MSCs) in the host bone. On the contrary, tibia consists of cortical bone. Especially, mid-shaft area has almost no cancellous bone and is hard to achieve bone union because the fracture area moves under weightbearing condition (Choi et al., 2011; Lee et al., 2010). Thus, the defect in tibial shaft is hard to expect spontaneous healing or bone union even after bone graft. Since a tibial critical bone defect is harder to treat than a calvarial defect, our study design with the tibial defect model is considered to provide more clinically relevant information for the effect of EGF on
32
J. H. Lee et al.
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
rhBMP-2-mediate bone formation. Thus, this research aims to evaluate if the rhBMP-2 treatment in combination with EGF or FGF shows synergistic effect on osteoinduction in osteoblastically differentiated human MSCs and a rabbit tibial bone defect model.
Growth Factors, 2015; 33(1): 31–39
Table 1. Primer sequences used for the RT-PCR.
Primer ALP
Methods
BSP
Cell culture
Collagen I
Human mesenchymal stem cells (hMSCs) (Lonza, Walkersville, MD) were cultured up to five passages in low glucose-Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum and 1% antibiotic–antimycotics (Gibco, Carlsbad, CA). The cells were cultured in a humidified incubator setting at 37 C with 5% CO2 and the medium supplemented with 108 M dexamethasone, 100 mM ascorbic acid-2-phosphate and 10 mM b-glycerophosphate (Sigma, St. Louis, MO) up to 21 days and was changed every 2–3 days. The differentiated or non-differentiated cells were further divided into five groups as follows: (i) control group: control medium, (ii) induce group: medium for osteogenic differentiation, (iii) BMP2 group: 250 ng/ml rhBMP-2 (Novosis; Daewoong Pharmaceuticals Co., Ltd, Seoul, Korea) in osteogenic medium, (iv) BMP2+EGF group: 250 ng/ml rhBMP-2 and 10 ng/ml EGF (Daewoong Pharmaceuticals Co., Ltd, Seoul, Korea) in osteogenic medium and (v) BMP2+FGF group: 250 ng/ml rhBMP-2 and 10 ng/ml FGF (Fiblast; Kaken Pharmaceutical Co., Ltd, Tokyo, Japan) in osteogenic medium. Alkaline phosphatase staining and alkaline phosphatase activity assay Alkaline phosphatase (ALP) staining was performed at 3, 7 and 14 days after the treatments. The treated cells were washed with phosphate-buffered saline solution (Gibco, Carlsbad, CA), fixed with 10% formalin for 30 s, and rinsed with distilled water for 45 s. And then, the cells were stained with fast blue RR salt (Sigma-Aldrich Denmark A/S, Brondby, Denmark) and 0.25% naphthol AS-MX phosphate alkaline solution buffer (Sigma, Munich, Germany) for 20 min at room temperature. ALP hydrolyzes p-nitrophenyl phosphate and produces p-nitrophenol, a yellow product measured for estimating the enzyme activity. The absorbance was compared with a standard curve prepared with nitrophenol standard solution and the enzyme activity was normalized to total protein concentration of the lysate. Alizarin red-S staining and calcium assay hMSCs were cultured in 24-well plates and left untreated or treated with rhBMP-2 alone or in combination with EGF or FGF for 7, 14 and 21 days. During the entire course of the experiments, medium was changed and the factors (rhBMP-2, EGF and FGF) were freshly added every 3 days. The treated cells were fixed in 70% ethanol at 4 C for 1 h, rinsed with distilled water and stained with 40 mM alizarin red-S (Sigma, St. Louis, MO) at pH 4.2 at room temperature for 10 min. For quantitation of calcium concentration, hMSCs were treated for 7, 14 and 21 days in 96-well plates. The level of
GAPDH
Sequence (50 !30 ) F: TGGAGCTTCAGAAGCTCAACACCA R: ATCTCGTTGTCTGAGTACCAGTCC F: CGAAGACAACAACCTCTCCAAATG R: ACCATCATAGCCATCGTAGCCTTG F: CATGAGAGCCCTCACA R: AGAGCGACACCCTAGAC F: GGGCTGCTTTTAACTCTGGT R: TGGCAGGTTTTTCTAGACGG
Anneal temperature ( C)
Product (bp)
65
454
53
257
44
300
54
702
calcium was measured using the QuantiChrom calcium assay kit (BioAssay Systems, Hayward, CA) according to the manufacturer’s instruction. All measurements were done in triplicate. The calcium level was normalized to total protein concentration of the cell lysates. Reverse-transcription polymerase chain reaction ALP, BSP and type I collagen was measured and normalized to the level of GAPDH. Total RNA was isolated from each group of hMSCs using Trizol reagent (Invitrogen Canada Inc., Burlington, Canada) according to the manufacturer’s instruction. The sequences of primers used for osteogenic markers are listed in Table 1. The PCR buffer composition was 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 25 mM MgCl2, 10 mM dNTPs (2.5 mM each) and 0.5 units of i-TaqÔ was used as a DNA polymerase. PCR conditions were as follows: 30 s at 95 C, 30 s at annealing temperature (28–32 cycles) and 60 s at 72 C. The PCR products were separated in 1.5% agarose gels and analyzed by densitometry using the Leica imaging software (Leica Microsystems, Wetzlar, Germany). Animal model and surgical procedure A total of 48 New Zealand white male rabbits (3–3.5 kg) were allocated into the following groups; eight rabbits for 2-week group, eight for 4-week group and 32 for 8-week group. This study was permitted by the Standing Committee on Ethics at the Institutional Animal Care and Use Protocol Approval at the Clinical Research Institute (IACUC No. 10-0034) of Seoul National University Hospital Biomedical Research Institute. Zoletil and rumpun were intramuscularly injected for general anesthesia and one side of tibial area was shaved and sterilized with betadine. The hind limb was covered with sterilized drapes and skin incision was made at the medial border along longitudinal axis. The tibia was exposed by dissecting fascia and periosteum. Using a vertical saw, 1 cm length of a defect was generated in the middle of tibia diaphysis and 2 K-wires per each part were inserted perpendicularly into upper and lower parts of the defect. The defect was irrigated with saline after fixation with an external fixator (Figure 1). Type II collagen was used as a carrier for rhBMP-2, EGF and FGF. Each week group of rabbits was further divided into four groups based on graft material as follows: (i) collagen group: collagen only, (ii) BMP-2 group: rhBMP-2 10 mg group, (iii) EGF group: rhBMP-2 10 mg and EGF 10 mg group and (iv) FGF group: rhBMP-2 10 mg and FGF 10 mg group. The animals were intramuscularly injected
EGF with rhBMP-2 enhances osteoinductivity
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
DOI: 10.3109/08977194.2014.957759
33
Figure 1. Surgical procedures. (A) A K-wire was inserted in the proximal portion of the tibia. (B) Another K-wire was inserted in the distal portion of the tibia and an external fixator was installed. (C) A defect with 1 cm length was generated. (D) The exposed tibial defect. (E) The defect was removed. (F) The removed tibial defect. (G) Collagen sponge which was treated with or without proteins was inserted into the defect. (H) External fixator was fixed in the medial aspect of the tibia.
with 0.5 g of cefazolin right before and after the operation and for additional 2 days. After the operation, animals were raised without intervention and euthanized by intravenously injecting KCl at either 2, 4 or 8 weeks.
acrylic slide attachment and hematoxylin and eosin (H&E) staining. Light microscopy was used to monitor newly formed bone in the defect. Statistical analysis
Radiographic evaluation Plain radiography was performed at 2, 4 and 8 weeks after the operation depending on the week groups. Samples were harvested for high-resolution radiography with Skyscan 1173 micro-CT (Bruker, Aartselaar, Belgium) under the condition of 130 kV and 60 mA. The taken images were reconstructed in sagittal, coronal and axial planes and bone healing of the tibial defect site in the sagittal and coronal planes was compared. The length ratio of the bone bridge connecting upper and lower parts of the defect was analyzed by comparing the sagittal images of micro-CT. Also, bone quality and bone quantity of the tibial defect center was analyzed by measuring parameters of micro-CT. Histology The area including the defect and surrounding tissues was harvested and fixed with formalin for 5 days. The fixed tissues were gross-sectioned, washed in a cassette for 6 h and dehydrated in 100% alcohol. The dehydrated tissues were stirred in methacrylate-based chemical curing resin for 2 days, stirred and embedded with dissolved benzoyl peroxide. After trimming, the block was cut in a longitudinal axis of the tibia with EXAKT (BS-3000N) and 4 mm thickness sections were generated in sagittal plane. The sections were subjected to
ALP activity and new bone formation by micro-CT were analyzed with one-way analysis of variance (ANOVA) after normality test. Student–Newman–Keuls test was used for post hoc analysis. Calcium level was analyzed by ANOVA test if the data are normally distributed or by Kruskal–Wallis test if not 2 square test was used for post hoc analysis. Values of p50.05 were considered statistically significant.
Results In vitro results ALP staining and ALP activity assay At 3 days after the differentiation, the BMP2 group and the BMP2+EGF group showed strong ALP staining results (Figure 2A). The BMP2+EGF group showed maximum ALP staining at Day 7, but the BMP2+FGF group showed similar staining as the induce group. The ALP staining was noticeably decreased in all test groups at Day 14. ALP activity was gradually increased as time passes (Figure 2B). There was no clear difference in the activity among the groups at Day 3. The combination treatment with either EGF or FGF showed relatively high ALP activity at Day 7. At Day 14, the BMP2 group represented high ALP
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
34
J. H. Lee et al.
Growth Factors, 2015; 33(1): 31–39
Figure 2. ALP staining and ALP activity of BMSCs. (A) ALP staining, magnification: 10. The BMP2+EGF group showed maximum ALP staining at Day 7. (B) ALP activity assay. At Day 14, the BMP2+EGF group showed higher ALP activity than all the other groups (p50.001 for all).
activity and the BMP2+EGF group showed even higher ALP activity than all the other groups (p50.001 for all). While the BMP2+EGF group showed very clear ALP activity increase range, the activity was not increased further at Day 14 compared to Day 7 in the BMP2+FGF group.
induce group represented significantly higher level (p ¼ 0.029). At Day 21, the control group showed significantly lower calcium level than the other groups (p50.001 for the BMP2 group and p ¼ 0.001 for the other groups) and there was no significant difference among all the other groups.
Calcium accumulation during osteogenic differentiation The BMP2 group and the BMP2+EGF group showed relatively high accumulation of calcium mineralization at Day 7 (Figure 3A). At Day 14, the BMP2 +EGF group and the BMP2+FGF group showed higher mineralization than the BMP-2 group. At Day 21, the AR-S staining was increased in all groups except the control group. The BMP2 group showed relatively high increase in calcium accumulation at Day 7, but statistical significance was not found (Figure 3B). At Day 14, the BMP2+EGF group showed significantly higher calcium level than the other groups (p50.0001, p ¼ 0.047, p50.0001 and p50.0001 for the control, induce, BMP2 and BMP2+FGF group, respectively). Compared to the BMP2+FGF group, the
Changes of gene expression in the hMSC Compared to the levels in the control and the induce groups, the ALP expression was increased overall in the BMP2, the BMP2+EGF and the BMP2+FGF groups (Figure 4). The ALP expression was increased in the BMP2 group, the BMP2+EGF group and the BMP2+FGF group at Day 7, 14 and 21. In the BMP2 group, the BSP gene expression was increased up to 14 days after the treatments, but the level was decreased at Day 21. On the other hand, the combination treatment groups with either EGF or FGF showed gradually increasing expression of BSP gene in a time-dependent manner. The expression of type I collagen was not different among the groups.
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
DOI: 10.3109/08977194.2014.957759
EGF with rhBMP-2 enhances osteoinductivity
35
Figure 3. Alizarin red-S staining and calcium assay. (A) Alizarin red-S staining, magnification: 10. At Day 14, the BMP2+EGF group and the BMP2+FGF group showed higher mineralization than the BMP-2 group. (B) Calcium assay. At Day 14, the BMP-2 + EGF group showed significantly higher calcium level than the other groups.
In vivo results Radiographic results In plain radiographic results, the collagen group showed almost none of new bone formation in the defect up to 4 weeks (Figure 5). At 8 weeks, little amount of bone formation was found, but not enough for bridging. In the BMP-2 group and the FGF group, new bone formation in the defect became clear at 4 weeks and bone bridging was found at 8 weeks. The EGF group showed marked bone bridging and increased bone density. In micro-CT results, the collagen group did not show bone bridging even at 8 weeks, whereas in the BMP-2 group, bridging was formed at 4 weeks and cortical bone completely covered the defect and new bone formation was found in marrow cavity at 8 weeks (Figure 6). The EGF group showed higher bone formation than the BMP-2 group at 4 weeks and cortical bone bridging and new bone formation in the entire area of the defect were observed at 8 weeks. In the FGF group, the level of bone formation was lower than the one in the BMP-2 group at 4 weeks. At 8 weeks, new bone formation as well as cortical bone bridging in the entire defect
area was found even though the bone bridging was not complete. The sagittal reconstruction of micro-CT images at 8 weeks represented that the ratio of bone bridge formation in the defect was the highest in the EGF group (48.5 ± 33.6%) compared to the BMP-2 group (15.8 ± 15.3%), the FGF group (22.9 ± 36.6%) and the collagen group (5.3 ± 7.7%). The EGF group and the FGF group showed significantly higher ratio of bone bridge formation than the collagen group and BMP-2 group (p50.001, both). Percent bone volume of the EGF group was significantly higher than those of the others (p50.01, all) (Table 2). The FGF group showed significantly higher percent bone volume than the collagen group and the BMP-2 group (p ¼ 0.0002 and p ¼ 0.011, respectively). Trabecular thickness of the EGF group was significantly higher than the level of the FGF group and the collagen group (p ¼ 0.0006 and p ¼ 0.0193, respectively). Trabecular number of the EGF group was significantly higher than those of the others (p50.05, all). Trabecular pattern factor of the EGF group was significantly lower than the level of the collagen group and the BMP-2 group (p50.0001 and p ¼ 0.0122,
36
J. H. Lee et al.
Growth Factors, 2015; 33(1): 31–39
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
Figure 4. Effect of BMP-2 and growth factors on ALP, BSP and type I collagen mRNA expression in BMSCs. The ALP expression was increased overall in the BMP2, the BMP2+EGF and the BMP2+FGF groups. The combination treatment groups with either EGF or FGF showed gradually increasing expression of BSP gene in a time-dependent manner.
Figure 5. Plain radiograph results. In the BMP-2 group and the FGF group, new bone formation in the defect became clear at 4 weeks and bone bridging was found at 8 weeks. The EGF group showed marked bone bridging and new bone density.
respectively). The FGF group showed significantly lower trabecular pattern factor than the BMP-2 group and the collagen group (p ¼ 0.0004 and p ¼ 0.0001, respectively). Histological results In undecalcified histology of the collagen group, new born formation was not observed up to 4 weeks (Figure 7). The BMP-2 group formed bone bridging in the defect at 2 and 4 weeks. At 8 weeks, cortical bone bridging was complete but new bone formation in the marrow space was scanty. The EGF group formed bone bridging in the defect and part of the marrow space at 2 and 4 weeks. At 8 weeks, the entire marrow space and the cortical bone area were covered with newly formed bone in the EGF group, indicating much clearer bone remodeling than the BMP-2 group. The FGF group showed relatively less amount of new bone formation in the marrow space at 4 weeks than the EGF group. At 8 weeks, cortical bone bridging was complete.
Discussion BMPs are important proteins for bone formation, differentiation and regeneration and have been widely used for bone fusion in clinic. EGF and FGF are mitogens secreted from various cell types and play roles in cell proliferation and bone formation. FGF is known to mediate cellular responses by binding and activating receptor tyrosine kinases named FGF receptors 1–4 (Bottcher & Niehrs, 2005; Kim et al., 2007). FGF has been reported to promote proliferation of osteoblastic cells and stimulate bone formation in in vivo models (Nakamura et al., 1995; Rodan et al., 1989). EGF functions as a potent mitogen of bone marrow multipotential stromal cells and osteoblastic progenitor cells and is involved in osteoclastogenesis and bone resorption (Tamama et al., 2006; Zhang et al., 2011). In the current study, the rhBMP-2 treatment on hMSCs induced higher ALP activity and calcium mineralization compared to the control and the levels were further increased when treated in combination with EGF. Recently, the
EGF with rhBMP-2 enhances osteoinductivity
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
DOI: 10.3109/08977194.2014.957759
37
Figure 6. Micro-CT results. The Collagen group did not show bone bridging even at 8 weeks, whereas in the BMP-2 group, bridging was formed at 4 weeks and cortical bone completely covered the defect and new bone formation was found in marrow cavity at 8 weeks. The EGF and FGF group showed marked bone bridging and new bone formation in marrow space.
Table 2. Micro-CT results of the 8-week groups. Mean (standard deviation) Group (n) Collagen (8) rhBMP-2 (8) EGF (8) FGF (8) p Value
BV/TV
BS/BV
Tb.Pf
Tb.Th
Tb.N
Tb.Sp
4.6 (2.2) 10.6 (2.4) 32.4 (8.9) 19.3 (8.0) 50.001
38.0 (3.5) 32.9 (11.3) 22.3 (5.5) 29.2 (7.6) 0.003
3.1 (4.6) 4.4 (4.7) 6.52 (4.0) 4.5 (3.7) 50.001
0.16 (0.02) 0.18 (0.04) 0.21 (0.03) 0.19 (0.03) 0.021
0.3 (0.15) 0.75 (0.42) 1.54 (0.35) 1.05 (0.48) 50.001
2.53 (0.6) 1.19 (0.33) 0.75 (0.28) 1.2 (0.54) 50.001
The EGF group showed significantly higher percent bone volume, trabecular number and trabecular thickness than the other groups. Tabecular pattern factor of the EGF group was significantly lower than the level of the collagen group and the BMP-2 group. Values are expressed as mean (standard deviation).
combined treatment with EGF (10 ng/ml) and rhBMP-2 (10 ng/ml) was reported to increase osteoblast proliferation but lower bone nodule formation (Laflamme et al., 2010). Whereas, the combination of high dose rhBMP-2 (250 ng/ml) and EGF (10 ng/ml) induced remarkably increased ALP activity and calcium accumulation as shown in our study. These results suggest that differential combinations of the protein dose induce different effects regarding bone formation. In our in vitro model, BSP gene expression was increased up to 14 days in the treatment with rhBMP-2 only, while the expression was increased in a time-dependent manner in the BMP-2+EGF group. Activation of EGFR signaling by EGF-like ligand was reported to suppress the expression of early and late bone marker genes and block osteogenesis (Zhu et al., 2011). However, osteoblastic EGFR activity is known to lower osteoclast activation and bone resorption
(Nakamura et al., 1995). EGF itself can stimulate osteoblast growth but the combination with rhBMP-2 is known to further enhance the cell growth compared to either rhBMP-2 or EGF only (Laflamme et al., 2010). To sum up, EGFR signaling is considered to play anabolic roles in bone metabolism and the in vitro result of the synergistic effect on bone formation by EGF and rhBMP-2 may come from the anabolic effect of EGF signaling (Zhang et al., 2011). In a rabbit tibial defect model, the EGF group represented significantly higher percent bone volume and trabecular number of newly formed bone, indicating enhanced bone formation by osteoblast activation. Moreover, trabecular pattern factor, an index of bone quality, was significantly lower in the EGF group than in the BMP-2 group, suggesting increased trabeculation by bone remodeling. The improved bone quality by trabeculation requires proper bone resorption by osteoclast as well as bone formation by osteoblast.
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
38
J. H. Lee et al.
Growth Factors, 2015; 33(1): 31–39
Figure 7. Histology results. H&E (12.5, 40 and 100). (A) Collagen group. There was no new bone formation. (B) BMP-2 group. Bone bridging was found in the defect at 2, 4 and 8 weeks. (C) EGF group. Bone bridging was found in the defect and part of the marrow space at 2 and 4 weeks. At 8 weeks, the entire marrow space was covered with new bone. (D) FGF group. New bone formation was evident at 2 and 4 weeks. At 8 weeks, cortical bone bridging was complete. Arrow head denotes defect margin, arrow denotes collagen and star denotes new bone.
Thus, the effect comes from increased osteoblastic differentiation and osteoclastogenesis by the EGF combination treatment. These results are consistent with previous reports showing that EGFR signaling regulates osteoclast formation and play roles in osteoclast differentiation and survival by cross-talking with RANK signaling pathways (Wang et al., 2004; Yi et al., 2008). However, excessive osteoclastogenesis can disrupt bone formation and trabeculation remodeling, which are processes requiring properly controlled osteoblast differentiation and osteoclastogenesis. Even though our rabbit tibial defect model proved the superior efficacy of the combination treatment with rhBMP-2 10 mg and EGF 10 mg in bone formation over the single treatment, additional studies are required for determining proper dose combination of both factors for application to human. In the combination treatment with FGF, ALP activity was slightly reduced without statistical significance and calcium level was similar compared to the levels in the BMP2 group. FGF was reported to facilitate BMP-2-mediated ectopic bone formation by inducing expression of BMP receptor-1B,
phosphorylated Smad1, Noggin and osteocalcin in low dose, while it inhibited the ectopic bone formation in high dose (Nakamura et al. 2005). Even though our in vitro study used relatively low dose (10 ng/ml) of FGF, the synergistic effect with rhBMP-2 was not found, suggesting that the effect of FGF on rhBMP-2-mediated osteogenesis is insignificant. Our study is limited to test only one dose of each growth factor in combination with rhBMP-2. It is likely that a dose of growth factor and environment for cell proliferation affect bone fusion outcomes. Therefore, there should be an optimal condition of growth factors for osteoblastic differentiation of hMSC and bone formation in in vivo study, and thus further detailed study needs to be followed. There are not many reports about the combination treatment of rhBMP-2 and a growth factor, even though its importance has been recognized. Our study provides both in vitro and in vivo evidences showing the effect of the combination treatment using a rabbit tibial defect model offering intractable bone formation condition.
EGF with rhBMP-2 enhances osteoinductivity
DOI: 10.3109/08977194.2014.957759
Table 3. Student–Newman–Keuls test for all pairwise comparisons.
Growth Factors Downloaded from informahealthcare.com by Nyu Medical Center on 06/24/15 For personal use only.
Factor 1. Percent bone volume (1) BMP (2) COL (3) EGF (4) FGF 2. Specific surface (1) BMP (2) COL (3) EGF (4) FGF 3. Trabecular pattern factor (1) BMP (2) COL (3) EGF (4) FGF 4. Trabecular thickness (1) BMP (2) COL (3) EGF (4) FGF 5. Trabecular number (1) BMP (2) COL (3) EGF (4) FGF 6. Trabecular separation (1) BMP (2) COL (3) EGF (4) FGF
n
Mean
Different (p50.05) from factor nr
8 8 8 8
10.5491 4.6039 832.3801 819.2708
(3) (4) (3) (4) (1) (2) (4) (1) (2) (3)
8 8 8 8
32.9170 38.0306 822.3279 829.2385
(3) (3) (1) (2)
8 8 8 8
4.3456 3.1048 86.5221 84.4947
(3) (3) (1) (1)
8 8 8 8
0.1775 0.1562 80.2084 80.1869
(3) (2)
8 8 8 8
0.7505 0.3014 81.5383 81.0530
(2) (3) (1) (3) (4) (1) (2) (4) (2) (3)
8 8 8 8
1.1900 2.5316 80.7487 81.1990
(2) (1) (3) (4) (2) (2)
(4) (4) (2) (2)
Conclusion Collectively, the combination treatment with low dose EGF and rhBMP-2 enhanced osteoblastic differentiation of hMSCs as evidenced by increased ALP activity and mineralization compared to the rhBMP-2 treatment. Also, the rabbit tibial defect model showed increased bone formation and bone quality when rhBMP-2 was treated in combination with EGF. Therefore, the combined treatment of rhBMP-2 and EGF can be useful treatment for bone regeneration.
Declaration of interest This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2013R1A1A2061858). No benefits in any form have been or will be received from a professional and financial affiliations related directly or indirectly to the subject of this article.
References Benglis D, Wang MY, Levi AD. 2008. A comprehensive review of the safety profile of bone morphogenetic protein in spine surgery. Neurosurgery 62:423–431. Bottcher RT, Niehrs C. 2005. Fibroblast growth factor signaling during early vertebrate development. Endocr Rev 26:63–77.
39
Carragee EJ, Hurwitz EL, Weiner BK. 2011. A critical review of recombinant human bone morphogenetic protein-2 trials in spinal surgery: Emerging safety concerns and lessons learned. Spine J 11: 471–491. Choi IH, Cho TJ, Moon HJ. 2011. Ilizarov treatment of congenital pseudarthrosis of the tibia: A multi-targeted approach using the Ilizarov technique. Clin Orthop Surg 3:1–8. Corenman DS, Gillard DM, Dornan G, Strauch E. 2013. Recombinant human BMP-2-augmented transforaminal lumbar interbody fusion for the treatment of chronic low back pain secondary to the homogeneous diagnosis of discogenic pain syndrome: Two-year outcomes. Spine 38: E1269–E1277. Helgeson MD, Lehman Jr RA, Patzkowski JC, Dmitriev AE, Rosner MK, Mack AW. 2011. Adjacent vertebral body osteolysis with bone morphogenetic protein use in transforaminal lumbar interbody fusion. Spine J 11:507–510. Kim SJ, Kim SY, Kwon CH, Kim YK. 2007. Differential effect of FGF and PDGF on cell proliferation and migration in osteoblastic cells. Growth Factors 25:77–86. Laflamme C, Curt S, Rouabhia M. 2010. Epidermal growth factor and bone morphogenetic proteins upregulate osteoblast proliferation and osteoblastic markers and inhibit bone nodule formation. Arch Oral Biol 55:689–701. Lee JH. Jang SJ, Baek HR, Lee KM, Chang BS, Lee CK. 2014. Synergistic induction of early stage of bone formation by combination of recombinant human bone morphogenetic protein-2 and epidermal growth factor. J Tissue Eng Reg Med [Epub ahead of print]. Lee MJ, Sohn SK, Kim KT, Kim CH, Ahn HB, Rho MS, Jeong MH, Sun SK. 2010. Effect of hydroxyapatite on bone integration in a rabbit tibial defect model. Clin Orthop Surg 2:90–97. Lieberman JR, Daluiski A, Einhorn TA. 2002. The role of growth factors in the repair of bone. Biology and clinical applications. J Bone Joint Surg Am 84:1032–1044. Moghaddam-Alvandi A, Zimmermann G, Buchler A, Elleser C, Biglari B, Grutzner PA, Wolfl CG. 2012. Results of nonunion treatment with bone morphogenetic protein 7 (BMP-7). Der Unfallchirurg 115:518–526. Nakamura T, Hanada K, Tamura M, Shibanushi T, Nigi H, Tagawa M, Fukumoto S, Matsumoto T. 1995. Stimulation of endosteal bone formation by systemic injections of recombinant basic fibroblast growth factor in rats. Endocrinology 136:1276–1284. Nakamura Y, Tensho K, Nakaya H, Nawata M, Okabe T, Wakitani S. 2005. Low dose fibroblast growth factor-2 (FGF-2) enhances bone morphogenetic protein-2 (BMP-2)-induced ectopic bone formation in mice. Bone 36:399–407. Rodan SB, Wesolowski G, Thomas KA, Yoon K, Rodan GA. 1989. Effects of acidic and basic fibroblast growth factors on osteoblastic cells. Connect Tissue Res 20:283–288. Smoljanovic T, Rakovac M, Bojanic I. 2011. Could chronic host inflammatory response be responsible for delayed onset of retrograde ejaculation after the labeled use of recombinant human bone morphogenetic protein-2? Spine J 11:167–168. Tamama K, Fan VH, Griffith LG, Blair HC, Wells A. 2006. Epidermal growth factor as a candidate for ex vivo expansion of bone marrowderived mesenchymal stem cells. Stem cells 24:686–695. Wang K, Yamamoto H, Chin JR, Werb Z, Vu TH. 2004. Epidermal growth factor receptor-deficient mice have delayed primary endochondral ossification because of defective osteoclast recruitment. J Biol Chem 279:53848–53856. Yi T, Lee HL, Cha JH, Ko SI, Kim HJ, Shin HI, Woo KM, et al. 2008. Epidermal growth factor receptor regulates osteoclast differentiation and survival through cross-talking with RANK signaling. J Cell Physiol 217:409–422. Zhang X, Tamasi J, Lu X, Zhu J, Chen H, Tian X, Lee TC, et al. 2011. Epidermal growth factor receptor plays an anabolic role in bone metabolism in vivo. J Bone Miner Res 26:1022–1034. Zhu J, Shimizu E, Zhang X, Partridge NC, Qin L. 2011. EGFR signaling suppresses osteoblast differentiation and inhibits expression of master osteoblastic transcription factors Runx2 and Osterix. J Cell Biochem 112:1749–1760.
