878

3. Gilks CF, Brindle RJ, Otieno LS, et al. Life threatening bacteraemia in HIV-1 seropositive adults admitted to hospital in Nairobi, Kenya. Lancet 1990, 336: 545-49. 4. Blaser MJ, Cohn DL. Opportunistic infections in patients with AIDS: clues to the epidemiology of AIDS and the relative virulence of pathogens. Rev Infect Dis 1986; 8: 21-30. 5. Celum CL, Chaisson RE, Rutherford GW, Barnhart JL, Echenberg DF. Incidence of salmonellosis in patients with AIDS. Rev Infect Dis 1987; 156: 998-1002. 6. Jacobs JL, Gold JW, Murray HW, Roberts RB, Armstrong D. Salmonella infections in patients with the acquired immunodeficiency syndrome. Ann Intern Med 1985; 102: 186-88. 7. Sperber SJ, Schleupner CJ. Salmonellosis during infection with human immunodeficiency virus. Rev Infect Dis 1987; 9: 925-32.

Resurgent gonorrhoea in homosexual

men

SIR,-Dr van den Hoek and colleagues (July 21, p 179) record a resurgence of gonorrhoea among male homosexuals in Amsterdam. We have evidence of the same trend in the State of Victoria, Australia. A major public awareness campaign for AIDS was conducted in Australia in April and May, 1987. Coincidentally, the proportion of cases of gonorrhoea that were in homosexual males in Victoria fell from a median of 13.2% (quarterly range 6-1-27 -2%) in the previous 4 years to a record low of 4-6% by June, 1987. There followed a sharp rebound to 29-3% by the third quarter. This was sustained throughout 1988. In 1989 the proportion had risen to 58-9% by the second quarter, remaining as high as 37-0% twelve months later. This extraordinary trend has been observed against a steadily declining incidence of gonorrhoea in women and heterosexual men.12 Consistent with this observation, the male/female ratio has increased from 3-0 in 1987 to 5-5 in 1989. Although many of the isolates from homosexual men were from the urethra, a proportional increase in rectal isolates has been observed over the same

without

with

urea

urea

ELISA anti-HCV assay results, without and with

step.

Results for the 2 controls and for all 3 patients with anti-HCV positive post-transfusion hepatitis remained basically unaltered by addition of the urea wash. 12 sera of patients with RA became negative, however; in the other RA patient optical density readings were much reduced but still above the cut-off (figure). This suggests that most patients with RA have no antibodies binding with high affinity to the antigen, despite significantly raised optical density readings in the original ELISA. The urea wash seems to increase specificity while not altering sensitivity. We conclude that modification of the commercial ELISA might help to exclude false-positive results in patients without liver disease, until a confirmatory test for anti-HCV becomes available.

period.

These trends have clear implications for the spread of HIV and we support the need for continuous monitoring of sexually transmitted diseases as a rapid method for indicating changes in sexual behaviour.

urea

Department of Internal Medicine, University of Heidelberg, D-6900 Heidelberg, Germany

Microbiological Diagnostic Unit, University of Melbourne,

J. R. L. FORSYTH J. SHERRARD

1 Theilmann

Parkville, Victoria 3052, Australia

P. TRAYNOR

2.

T. GOESER M. BLAZEK K. GMELIN B. KOMMERELL L. THEILMANN

L, Blazek M, Goeser T, Gmelin K, Kommerell B, Fiehn W.

False-positive anti-HCV tests m rheumatoid arthritis Lancet 1990; 335: 1346. Gray JJ, Wreghitt TG, Friend PJ, Wight DGD, Sundaresan V, Calne RY Differentiation between specific and non-specific hepatitis C antibodies in chronic liver disease. Lancet 1990; 335: 609-610.

N, Carlin J, Guest C, Norris M, Traynor P Surveillance of sexually transmissible diseases in Victona, 1989. Melbourne Health Department, Victoria,

1. Crofts

1990. 2. Monheit B, Noms M, Forsyth J Notificaton of sexually transmissible diseases Victoria: annual report 1988 Melbourne Health Department, Victoria 1989

in

Washing with 8 mol/l urea to correct false-positive anti-HCV results SIR,-We have found that 61% of sera from 41 patients with rheumatoid arthritis (RA) recorded positive for hepatitis C virus (HCV) antibody in the commercial ELISA (Ortho Diagnostics). None of the patients had evidence of liver disease or a history of transfusion of blood products or drug abuse. We concluded that in patients with autoimmune disease, anti-HCV testing might give false-positive results.1 Gray et al2 showed that a wash with 8 mol/1I urea might help to differentiate between specific and non-specific HCV antibodies in chronic liver disease. Since this additional wash should dissociate low-affinity antibodies from the antigen or remove non-specific binding to the plastic well, we re-evaluated some of these patients with RA. 13 anti-HCV positive and 3 anti-HCV negative patients with RA (13 females and 3 males, mean age 48 [SD16]) were selected from the group mentioned above. Besides a positive and negative control provided by the manufacturer, sera of 3 patients with anti-HCV

positive post-transfusional non-A, non-B hepatitis were tested. Anti-HCV testing was done once following manufacturer’s instructions. A second assay was done in the same way except that after incubation of the diluted samples in the microtitre plates, the wells were washed twice with the phosphate buffered saline (PBS) provided twice with 8 mol/1 urea, and again twice with PBS. The procedure was then completed as usual.

Enhanced detection by PCR of virus RNA

hepatitis C

SIR,-We have described a "nested" polymerase chain reaction (PCR) for the detection of hepatitis C virus (HCV) RNA in serum and factor VIII concentrates (June 16, p 1419, p 1473). The oligonucleotide primers (D94, D95, N1, N2) were derived from a region of the HCV genome that encodes a non-structural protein (NS5). It is now apparent that there are HCV sequence variants which may not be recognised by these primers. Similar difficulties with HCV-PCR primers due to sequence variation are described by others (Jan 6, p 1 ; April 21, p 976; Aug 4, p 309). To overcome this problem we designed and synthesised nested primers (NCR1, NCR2, NCR3, NCR4) based on the highly conserved (>99%) 5’ noncoding region (July 28, p 245). The sequences of the outer primers and are NCR1 NCR2 (anti-sense) (sense) 5’GTATCTCGAGGCGACACTCCACCATAGAT3’ (base 10 of primer nucleotide position 1 according to the revised of numbering system Okamoto’) and 5’ATACTCGAGGTGCACGGTCTACGAGACCT3’ (base 9 = nucleotide position 323), respectively. The inner primers NCR3 and NCR4 are (sense) (antisense) 5’CCACCATAGATCTCTCCCCTGT3’ (base 1=nudeotide position 10) and 5’CACTCTCGAGCACCCTATCAGGCAGT3’ (base 1 =nucleotide position 296). Restriction sites introduced to facilitate subsequent cloning of PCR products are italicised. An annealing temperature of 50°C was used in the first round (35 cycles) and 46°C in the second round (30 cycles). RNA was =

879

the PEG/SDS method and cDNA synthesised as described,3 but with random primers in place of D95. Serum samples from 20 haemophiliacs treated repeatedly with

Interatrial shunts and decompression sickness

prepared by

unheated commercial factor V I II concentrate were tested with both

SIR,--Our criticisms of Dr Wilmshurst and colleagues’ paper1 have

primers (D94, D95, N 1, N2) and the new set. The the original original set detected HCV RNA in 7 serum samples (35%), whereas the new set detected HCV RNA in 17 (85%). Serum from 30 healthy blood donors gave no signals with either set of primers. We conclude that the NCR series primers will, to a significant degree, circumvent the problem of false-negative PCR results arising from

not

set of

sequence variation. We thank Dr P. Jones, Dr G. clinical materials.

Savidge, and Dr J. Barbara for kindly providing

J. A. GARSON

Virology Division,

Department of Medical Microbiology, University College and Middlesex School of Medicine, London W1P 7PN, UK

C. RING P. TUKE R. S. TEDDER

1 Okamoto H, Okada S, Sugiyama Y, et al. The 5’-terminal sequence of the hepatitis C virus genome. Jpn J Exp Med 1990; 60: 167-77. 2 Okamoto H, Okada S, Sugiyama Y, et al. Detection of hepatitis C virus RNA by a two-stage polymerase chain reaction with two pairs of primers deduced from the 5’-noncoding region. Jpn J Exp Med 1990; 60: 215-22. 3 Garson JA, Tuke PW, Makris M, et al. Demonstration of multiple viraemia patterns in haemophiliacs treated with hepatitis C virus contaminated factor VIII concentrates Lancet (in press).

Renal artery stenosis and peripheral vascular disease S)R,—Dr Salmon and Dr Brown (Aug 4, p 321) report that in a group of 374 patients referred for angiographic assessment of lower-limb peripheral vascular disease (PVD), but not selected for the presence of hypertension, 31% had a renal artery stenosis, which was bilateral in 12%. This high prevalence is interesting but not really surprising since atherosclerosis is a diffuse disease that can affect renal arteries. A very important point for the management of hypertensive patients is the true prevalence of renal artery stenosis when peripheral vascular disease coexists with hypertension.1 From Sept 1, 1987, to Aug 31, 1988, 565 consecutive hypertensive adults were referred to our clinic for evaluation of hypertension either on an ambulatory basis or during admission. 99 patients (mean age 66) had PVD and 466 (mean age 51) did not. For each patient a standardised collection of information was checked and registered with a computerised system (’A-rtemis’).’ The evaluation included the search for a curable cause of hypertension, the investigation of cardiovascular risk factors, and a complete clinical review. Peripheral arterial disease was confirmed at least by clinical observation, including a pedo/brachial systolic blood pressure ratio of less than 0 90 at rest. If suggested by the clinical history, initial diagnostic work-up, or duplex doppler examination3 renal artery stenosis was confirmed by angiography. Renovascular hypertension was finally diagnosed in 14 (14-1%) hypertensive patients with PVD and in only 23 (4-9%) hypertensive patients without PVD (p < 0-05). The reported prevalence of renovascular hypertension varies widely but frequently ranges from 3% to 5 %. Our findings suggest that lower-limb PVD can be used to identify a subpopulation of hypertensive adults with a higher prevalence of renovascular hypertension. Departments of Hypertension, 75014 Paris, France

P. PRIOLLET I. LAZARETH D. MANIÈRE-CONSTANTIN

MedicalInformation Department, Broussais Hospital, Paris

F. AIMÉ

Vascular Medicine,and Internal Medicine,

Saint-Joseph Hospital,

1 Manière-ConstantinD,Aimé F, Priollet P. L’artéritedesmembres inférieurs chez

l’hypertendu est-elle un indice d’hypertension réno-vasculair? Presse Med 1990; 19: 176

2 Degeulet P, 3

Menard J, Berger C, Plouin PF, Devnes C, Hirel JC. Hypertension management: the computer as a participant Am J Med 1980; 68: 559-67 Taylor DC, Kettler MD, Moneta GL, et al. Duplex ultrasound scanning in the diagnosis of renal artery stenosis, a prospective evaluation J Vasc Surg1988; 7: 364-69.

been directed at discrediting the value of this work. We wish simply to note deficiencies in the design of the study. In our letter of April 14, we asked if those performing the echocardiograms were blinded to the history of the subjects and if those interpreting the echocardiograms were independent of subject selection and examination. Wilmshurst replied, "Our paper makes it clear that those who did the echocardiograms also interpreted them, and did so blind to the history of the divers". Our specific question is did the investigators interview and examine the subjects, irrespective of subsequent blind reading of the results? The quality and extent of the examination is investigator dependent. If those who performed the echocardiograms knew the history, they may have biased the outcome inadvertently. Our second point is that those entered into the investigation were all cases referred to Wilmshurst; the study group was not randomly selected and may have been subject to a referral bias-eg, including primarily those who wanted to return to diving. Furthermore, we have referred cases to Wilmshurst because we felt that their CNS dysbarism was unusual or unexpected from the dive profile. Such unintentional selection bias could be overcome if the study was designed to comprise all cases of dysbarism treated at one centre or from a given catchment area. Institute of Naval Medicine, Alverstoke, Gosport PO12 2DL, UK

D. J. SMITH

PT, Byme JC, Webb-Peploe MM. Relation between interatrial shunts decompression sickness in divers. Lancet 1989; ii: 1302-05

1. Wilmshurst

and

*** This letter has been shown follows.-ED. L. SiR,—The divers

to

Dr

Wilmshurst, whose reply

we examined did a series of manoeuvres to intracardiac shunting. If shunting was seen, the test was judged positive and no more manoeuvres were done, to minimise the amount of systemic gas embolism. Scans were recorded on videotape and individual injections were reviewed before proceeding to the next manoeuvre, but a decision was always reached before the subject left the couch. Those doing the scans were blind to the history and examination and since they simultaneously interpreted the scans, interpretation was also blinded. I have reviewed all the medical records. Some divers had been treated for decompression sickness at the Institute of Naval Medicine (INM) but they were referred to me by others and none of the referrals came from the INM. The cases treated by INM were, however, typical of the whole series in respect of proportion of individuals in clinical subgroupings used, proportion of subjects who had done provocative dives, and proportion in each subgroup who had shunts. Smith’s misunderstanding about the INM patients may have arisen because he was not seconded from the US Navy until our study had been completed. He suggests studying cases from just one centre or catchment area. However, there are regional differences in diving practices. In our study selection bias was countered by asking the regional medical referees of the British SubAqua Club and sympathetic recompression chamber operators to refer as many individuals who had had decompression sickness as possible. We did not ask for any specific clinical subgroup and many of those we saw did not intend to return to diving. Our aim was to avoid selection bias by recruiting a large sample. In two years, we studied 61 individuals who had dysbaric illness-ie, about onethird of the total UK cases of dysbaric illness during that period. The relative frequency of different clinical manifestations, the distribution of speed of onset of symptoms, and the proportion of divers affected without provocative dives is similar to that described in British SubAqua Club accident statistics.’ We have confirmed our observations in an extended study of over 200 divers.2 Smith and colleagues are aware of previous supervised replication studies at another centre (April 14, p 915). I have told Smith that if

accentuate