Metabolic Engineering 27 (2015) 46–56

Contents lists available at ScienceDirect

Metabolic Engineering journal homepage: www.elsevier.com/locate/ymben

Engineering Propionibacterium freudenreichii subsp. shermanii for enhanced propionic acid fermentation: Effects of overexpressing propionyl-CoA:Succinate CoA transferase Zhongqiang Wang a, Ehab M. Ammar a,1, An Zhang a, Liqun Wang a,b, Meng Lin a, Shang-Tian Yang a,n a b

William G. Lowrie Department of Chemical and Biomolecular Engineering, The Ohio State University, 140 W 19th Avenue, Columbus, OH 43210, USA School of Pharmaceutical Engineering and Life Sciences, Changzhou University, 1 Ge Hu Road, Jiangsu 213164, China

art ic l e i nf o

a b s t r a c t

Article history: Received 21 June 2014 Received in revised form 19 September 2014 Accepted 20 October 2014 Available online 29 October 2014

Propionibacterium freudenreichii subsp. shermanii naturally forms propionic acid as the main fermentation product with acetate and succinate as two major by-products. In this study, overexpressing the native propionyl-CoA:succinate CoA transferase (CoAT) in P. shermanii was investigated to evaluate its effects on propionic acid fermentation with glucose, glycerol, and their mixtures as carbon source. In general, the mutant produced more propionic acid, with up to 10% increase in yield (0.62 vs. 0.56 g/g) and 46% increase in productivity (0.41 vs. 0.28 g/L h), depending on the fermentation conditions. The mutant also produced less acetate and succinate, with the ratios of propionate to acetate (P/A) and succinate (P/S) in the final product increased 50% and 23%, respectively, in the co-fermentation of glucose/glycerol. Metabolic flux analysis elucidated that CoAT overexpression diverted more carbon fluxes toward propionic acid, resulting in higher propionic acid purity and a preference for glycerol over glucose as carbon source. & 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Keywords: Metabolic engineering Propionic acid fermentation Propionyl-CoA:succinate CoA transferase Metabolic flux analysis Propionibacterium shermanii

1. Introduction Propionic acid is an important carboxylic acid with wide applications. Approximately 70% of propionic acid is used as human food or animal feed preservatives. Propionic acid can also be used in the manufacture of cellulose plastics, perfumes, herbicides and pharmaceuticals. Recently, propionic acid as the substrate for the microbial production of biodegradable and biocompatible polyesters has also been investigated (Fu et al., 2014). Currently, propionic acid is produced exclusively via Reppe process and Larson process, which rely on non-renewable petrochemical feedstocks and cause environmental pollution. With the high crude oil prices and demand for environment friendly chemical products, propionic acid production from renewable biomass using propionibacteria has attracted increasing interests (Wang and Yang, 2013). Propionibacterium freudenreichii subsp. shermanii is a Gram-positive, facultative anaerobic, non-spore forming bacterium widely used as a ripening culture for Swiss-type cheese and in the production of propionic acid and

n

Corresponding author. Fax: þ1 614 292 3769. E-mail address: [email protected] (S.-T. Yang). 1 Current address: Department of Industrial Biotechnology, Genetic Engineering and Biotechnology Research Institute, University of Sadat City, Sadat City, Egypt.

vitamin B12 (Thierry et al., 2011). However, propionic acid fermentation usually suffers from low productivity, yield, and purity due to product inhibition and the co-production of acetic and succinic acids (Suwannakham et al., 2006). To date, extensive research efforts have focused on improving the fermentation process by, such as, cell immobilization (Liang et al., 2012; Suwannakham and Yang, 2005; Zhang and Yang, 2009; Zhu et al., 2012) and in-situ product removal (Jin and Yang, 1998; Wang et al., 2012), but very little has been done on metabolic engineering of propionibacteria (Ammar et al., 2013, 2014; Suwannakham et al., 2006; Zhuge et al., 2013). Recently, several propionibacteria species have been fully sequenced for their genomes with their metabolic pathways also elucidated (Falentin et al., 2010; Thierry et al., 2011; Parizzi et al., 2012), paving the way for metabolic engineering of propionibacteria. For propionibacteria such as P. acidipropionici and P. freudenreichii, propionic acid is produced in the dicarboxylic acid pathway with succinic acid and acetic acid as two main by-products (Himmi et al., 2000; Ruhal and Choudhury, 2012). The last step in the propionic acid biosynthesis pathway is the transfer of co-enzyme A (CoA) from propionyl-CoA to succinic acid, which is catalyzed by propionyl-CoA: succinate CoA transferase (CoAT) and has been suggested to be the rate-limiting step in the pathway (Suwannakham and Yang, 2005). Thus, it would be of great interest to overexpress CoAT to improve

http://dx.doi.org/10.1016/j.ymben.2014.10.005 1096-7176/& 2014 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

propionic acid production by increasing the reaction rate of the ratelimiting step. Our hypothesis is that increasing the turnover rate of succinic acid should decrease succinate accumulation and increase the flux from pyruvate toward propionic acid biosynthesis against acetic acid biosynthesis, thus increasing propionate and reducing acetate and succinate production in the fermentation. In this study, P. freudenreichii subsp. shermanii DSM4902 was engineered to overexpress the native CoAT gene (Accession no.: YP_003687287), which is 1524 bp in length encoding a protein with a molecular mass of 55.7 kDa. Unlike most characterized CoA transferases, which are grouped as family I CoA transferase and have two dissimilar subunits (Heider, 2001), the CoATs in propionibacteria are monomers. CoAT overexpression in P. shermanii was carried out by using the shuttle vector pKHEM01 (Kiatpapan et al., 2000; Kiatpapan and Murooka, 2001) containing the strong promoter element P138 isolated from P. shermanii IFO12424 (Piao et al., 2004). The effects of CoAT overexpression on batch fermentation kinetics with glucose, glycerol and glucose/glycerol mixtures as carbon source were studied in serum bottles with pH buffered at 5.0 and in bioreactors with pH controlled at 6.5. Metabolic flux analysis was performed to elucidate the flux changes caused by CoAT overexpression, confirming that CoAT overexpression diverted more carbon fluxes toward propionic acid biosynthesis and resulted in higher propionic acid production and the strain's preference for glycerol over glucose as carbon source. This was the first study about metabolic engineering of propionibacteria for enhanced propionic acid production by overexpressing CoAT.

2. Materials and methods 2.1. Bacterial strains, plasmids and culture media All bacterial strains and plasmids used or constructed are listed in Table 1 with their characteristics and sources. P. freudenreichii subsp. shermanii DSM 4902, designated as the wild type, was cultivated anaerobically at 32 1C in sodium lactate broth (NLB) medium containing (per liter): 10 g yeast extract, 10 g trypticase soy broth and 10 g sodium lactate. The transformants were cultivated anaerobically in the same medium at 32 1C supplemented with 250 mg/ml hygromycin B. For all fermentation kinetics studies, the medium containing (per liter): 30 g carbon source (glucose or glycerol), 10 g yeast extract, 5 g trypticase soy broth, 0.25 g K2HPO4 and 0.05 g MnSO4 was used. Unless otherwise noted, 250 mg/ml hygromycin B was also added in the medium as the selective pressure for the mutant. All media for propionibacteria were sparged with nitrogen gas, sealed in tubes or serum bottles, and autoclaved for 30 min at 121 1C. The stock culture of propionibacteria was kept anaerobically in a serum tube at 4 1C. Escherichia coli was cultivated aerobically at 37 1C in LB medium supplemented with 100 mg/ml ampicillin, on a rotary shaker.

47

2.2. Genomic DNA and plasmid extraction The genomic DNAs of P. shermanii were extracted using Promega Wizard Genomic DNA Purification Kit (Madison, MI). Plasmids were extracted from P. shermanii and E. coli using Qiagen QIAprep MiniPrep plasmid purification kit (Valencia, CA). For extracting plasmids from propionibacteria, 5 ml overnight culture was centrifuged and resuspended in 250 ml buffer P1 containing 100 mg/ml RNase and 10 mg/ml lysozyme. The suspension was incubated at 37 1C for at least 30 min and the remaining steps followed the plasmid purification kit protocol. 2.3. Plasmid construction The native CoAT gene was amplified from P. shermanii DSM4902 genomic DNA using the primers 4902CoAfor and 4902CoArev (see Table 1). Plasmid pKHEM01 was digested with restriction enzymes NcoI and NdeI and purified by gel extraction. PCR fragment of native CoAT gene was ligated with digested pKHEM01 to yield pKCOA1 (see Fig. S1 in Supplemental Materials). Ligation products were used to transform E. coli DH5α. All recombinant plasmids were confirmed by DNA sequencing. 2.4. Electroporation Electroporation of P. shermanii was carried out according to the procedures described by Brede et al. (2005) with some modifications. An overnight culture of P. shermanii (25 ml, OD600 E0.8) was incubated on ice for 20 min. Cells were collected by centrifugation at 5000 rpm for 4 min at 4 1C and then washed three times with 25 ml of chilled distilled water followed by one time with 25 ml 10% glycerol (chilled). After centrifugation at 5000 rpm for 4 min at 4 1C, cells were resuspended in 0.25 ml chilled 10% glycerol and 70 μl aliquots of cells were transferred to 1.5-ml centrifuge tubes. 1 μg of plasmid was mixed with cells and incubated on ice for 15 min before the mixture was transferred to a chilled ( 4 1C) 0.1 cm electroporation cuvette (Bio-Rad, Hercules, CA). An electric pulse (20 kV/cm, 25 μF capacitance and 200 Ω resistance) was applied on the cuvette. After electroporation, cells were suspended in 1.5 ml NLB and incubated in an anaerobic tube at 32 1C for 5 h before the cells were plated on NLB agar plates containing 250 μg/ml hygromycin B. The plates were incubated in an anaerobic jar at 32 1C for approximately 7 days until visible colonies were formed on the plates. 2.5. Mutant confirmation 2.5.1. Cell extract preparation Cells were cultured in the synthetic medium containing 250 mg/ml hygromycin B until OD600 had reached  2.0. Five milliliters of the culture were centrifuged, washed and resuspended in 1.5 ml 25 mM Tris/HCl (pH 7.4). The suspension was mixed with 1 ml silica beads

Table 1 Strains, plasmids and primers used in this study. Strain/plasmid

Relevant characteristics/uses

Reference/description

Strains P. freudenreichii subsp. shermanii Ps(pKCOA1) E. coli (HST08)

DSM 4902 DSM 4902 with pKCOA1 Competent cells in the cloning

DSMZ This study Clontech

Plasmids pKHEM01 pKCOA1

ColE1 ori; AmpR; HygR; pRGO1 ori; P138::hemA From pKHEM01; P138::CoA T (DSM 4902)

Kiatpapan and Murooka (2001) This study

Primer 4902CoAfor 4902CoArev

Sequence (50 -30 ) AGGAGAAATTCCATGAACGAACGCATCTCC TGAGAGTGCACCATAATCACCCGGAAAACCATTG

Forward primer for CoA T (DSM 4902) Reverse primer for CoA T (DSM 4902)

48

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

and injected into a 2 ml capped centrifuge tube. Cells were disrupted by loading the tube in a Mini-beadbeater-16 (Biospec, Bartlesville, OK) and vibrating vigorously for 10 cycles, 30 s each, or until cell suspension was clear. The suspension was then centrifuged at 13,200 rpm, 4 1C for 30 min to remove cell debris and the supernatant was removed and kept on ice until it was used for the enzyme activity assay. The protein concentration was quantified in triplicate by Bradford protein assay. 2.5.2. CoA transferase assay Propionyl-CoA:succinate CoA transferase activity was assayed by the method described in Suwannakham et al. (2006) with some modifications. The assay was conducted in 96-well plate at 25 1C and each well contained 125 ml reaction mixture: 50 ml Mixture I (250 mM pH 8.0 Tris/HCl buffer; 1 mM sodium malate; 2.5 mM NAD), 5 ml Mixture II (944 unit/mg of malic dehydrogenase, 14 μl; 355 unit/mg of citrate synthase, 11 μl; and 0.1 M, pH 6.8 phosphate buffer, 975 μl), 5 ml 1.5 M sodium acetate, 5 ml 0.15 mM succinylCoA, 25 ml cell extract and 35 ml H2O. The absorbance at 340 nm was measured, which increased linearly within 5 min. One unit of CoA transferase was defined as the amount of enzyme causing an absorbance increase of 1.0 min  1. A reaction with bovine serum albumin (BSA) was used as blank control. 2.5.3. SDS-PAGE SDS-PAGE of cell extracts of P. shermanii wild type and mutants were performed following user's protocol of Bio-Rad. Approximately 20 mg crude protein contained in cell extract were loaded in each well. The gel was stained with Coomassie brilliant blue. 2.6. Fermentation kinetics 2.6.1. Serum bottle fermentation The stock culture of propionibacteria was sub-cultured in 5 ml NLB medium in an anaerobic tube at 2% inoculum as seed culture.

When OD600 reached  2–3, 2.5 ml of this seed culture was used to inoculate each serum bottle containing 50 ml medium to start the fermentation. CaCO3 was added to the medium at 2% (w/v) concentration to buffer the pH at 5.0. Glucose, glycerol or glycerol/glucose mixtures were used as carbon source. Unless otherwise noted, the initial total carbon source was 30 g/L. Samples were withdrawn regularly from serum bottles using 1-ml syringes. After centrifugation, the fermentation broth was frozen at 20 1C for future analysis. Each condition was studied in triplicate bottles and average values with standard errors are reported. 2.6.2. Fermentation in bioreactor Batch fermentations with the wild type and the mutant were performed in 5-L stirred-tank bioreactors. The medium and glucose solution or glycerol/glucose mixture (for co-fermentation) were autoclaved at 121 1C for 30 min separately, and then mixed aseptically in the bioreactor. The total carbon source concentration was 30 g/L. The medium was then sparged with N2 for 45 min to establish anaerobiosis and then inoculated with 50 ml of a seed culture, which was prepared by inoculating 50 ml NLB medium in a serum bottle with 2.5 ml of an actively growing culture and allowing cells to grow overnight to OD600  2.0. Unless otherwise noted, the bioreactor containing 1 L of the synthetic medium was operated at 32 1C, agitated at 50 rpm, with pH controlled at 6.5 by adding ammonium hydroxide solution. Samples were withdrawn at regular time intervals and frozen for future analysis. 2.6.3. Sample analysis The optical density (OD) was measured with a spectrophotometer (Shimadzu, UV-1601). Glucose, glycerol, and organic acids present in the fermentation broth samples were analyzed with a high-performance liquid chromatograph (Shimadzu) equipped with an organic acid analysis column (HPX-87H, Bio-Rad) operated at 45 1C with 5 mM H2SO4 as the mobile phase at 0.6 ml/min (Suwannakham and Yang, 2005).

Enzyme activity (U/mg)

150

120

90

60

30

0

WT

Ps(pKCOA1)

Fig. 1. Comparison of propionyl-CoA:succinate CoA transferase expression levels in P. shermanii wild type (WT) and mutant Ps(pKCOA1) overexpressing CoAT. A. Enzyme activities. Data are mean 7s.d. (n¼ 3). B. SDS-PAGE of crude protein extracts. Arrows indicate the protein bands corresponding to CoAT.

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

2.7. Segregational stability

3. Results

Segregational stability of the plasmid in the mutant was tested using the method of Yu et al. (2012) with some modifications. One colony of the mutant was picked up from NLB plate and used to inoculate 5 ml NLB medium containing 250 mg/ml hygromycin B. After incubation at 32 1C for 36 h, 50 ml of this culture was used to inoculate 5 ml NLB medium containing 250 mg/ml hygromycin B. After 36 h incubation, cells were washed with sterile PBS buffer and 1% inoculum was used to inoculate 5 ml NLB medium without antibiotics to start segregational stability test. Cells were sub-cultured into fresh 5 ml NLB medium without antibiotics at 1% inoculum every 36 h to allow cell growth for 100-fold. After 72 (  13 generations) and 144 h (  26 generations), cells were collected and appropriate amounts (after diluted 104-fold with NLB medium) of cells were plated on NLB agar plates with and without hygromycin B to determine total colony forming units (CFU) and antibioticpresistant CFU, ffiffiffi respectively. The segregational stability: P (%) ¼ n R, where R is the fraction of cells containing plasmids in the total population after n generations.

3.1. Mutant construction and confirmation

2.8. Statistical analysis All experiments were carried out in duplicate or triplicate, and the mean and standard error are reported. To assess the significance of different kinetic parameters, data was subject to Student's t-test analysis with po 0.05 being significantly different.

49

After electroporation, putative mutants showing resistance to 250 mg/ml hygromycin B were isolated and examined by extracting the plasmids from the cells and digested with proper restriction enzymes. The restriction patterns proved that all the extracted plasmids from the isolated transformants were correct (data not shown). Cell extracts of the wild type and mutant were then assayed for their CoAT activity. As shown in Fig. 1, the mutant Ps (pKCOA1) had a significantly higher CoAT activity and more intense protein band of  56 KDa on the SDS-PAGE as compared to the wild type. These results confirmed that CoAT was successfully overexpressed in P. shermanii. 3.2. Segregational stability The segregational stability of pKCOA1 was found to be 99.4 70.6%, indicating that the plasmid had a high stability in the mutant Ps(pKCOA1). It is noted that similar fermentation kinetics was obtained with the mutant in bioreactor fermentations with or without hygromycin B (data not shown), confirming that pKCOA1 was stably maintained within the cells. 3.3. Batch fermentation kinetics The fermentation performance of the mutant Ps(pKCOA1) overexpressing CoAT was evaluated in serum bottles and bioreactors

Fig. 2. Fermentation kinetics of P. shermanii wild type and Ps(pKCOA1) in bioreactors with glucose or glycerol as carbon source. pH was maintained at pH 6.5 with ammonium hydroxide. A. wild type with glucose; B. Ps(pKCOA1) with glucose; C. wild type with glycerol; D. Ps(pKCOA1) with glycerol. Each fermentation condition was repeated at least twice and typical fermentation kinetics is shown here.

50

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

with glucose, glycerol, and the mixture of glucose and glycerol at various ratios as substrate, and the results are compared to those of the wild type under the same conditions. The fermentation time course data in bioreactor studies are shown in Figs. 2 and 3. Figs. 4, 5 and 6 compare the propionic acid yield, productivity, P/A and P/S ratios, ratio of glycerol consumption rate and glucose consumption rate, and specific growth rate from the wild type and the mutant in serum bottle and bioreactor fermentations, respectively. Details are discussed below. 3.4. Glucose and glycerol fermentations in serum bottles Batch fermentation kinetics was first studied in serum bottles with glucose as the carbon source. Compared to the wild type, overexpressing CoAT resulted in  10.5% increase in propionic acid productivity, and 7.5% increase in P/A and 16% in P/S ratios for the mutant. Clearly, CoAT overexpression significantly increased

propionic acid production and reduced succinic and acetic acids production. However, the propionic acid yield from glucose increased only 2.8% (see Fig. 4). Compared to glucose, glycerol as carbon source gave a higher propionic acid yield and P/A ratio, but the fermentation with glycerol suffered from a relatively low propionic acid productivity (Fig. 4). The glycerol fermentation gave a much higher P/A because glycerol has a higher reductive level, which favors the more reduced metabolite, propionic acid, instead of the more oxidized metabolite, acetate. However, P/S ratios in glycerol fermentation were much lower than those in glucose fermentation, indicating that more succinic acid was accumulated in the fermentation broth. Nevertheless, the P/S ratio for the fermentation with Ps(pKCOA1) was 50% higher than that with the wild type because overexpressing CoAT would convert succinic acid to propionic acid at a faster rate and reduce the accumulation of succinic acid. Consequently, the propionic acid yield from glycerol was  6.1% higher for Ps(pKCOA1) compared to

Fig. 3. Fermentation kinetics of P. shermanii wild type (WT) and Ps(pKCOA1) in bioreactors with glycerol/glucose as carbon sources. A, B. Glycerol/Glucose ¼2 at pH 6.5; C, D. Glycerol/Glucose ¼4 at pH 6.5; E, F. Glycerol/Glucose¼ 2 at pH 5.0 with CaCO3. Each fermentation condition was repeated at least twice and typical fermentation kinetics is shown here.

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

0.16

0.8

Yield (g/g)

0.6

0.4

Mutant

*

*

*

*

0.14

* Productivity (g/L/h)

WT

0.7

0.5

0.3 0.2

0.12

*

Glucose

1

2

3

0.06 0.04

Glucose

Mutant

12

10

*

6

10

*

8

*

P/S (g/g)

P/A (g/g)

1

2

3

Glycerol

Glycerol/Glucose 14

WT

0

Mutant

0.08

0.00

Glycerol

12

2

WT

0.10

Glycerol/Glucose

4

*

0.02

0.1 0

51

*

*

*

WT

*

8 6

*

4

*

Mutant

2 Glucose

1

2

3

Glycerol

Glycerol/Glucose

0

Glucose

1

2

3

Glycerol

Glycerol/Glucose

Fig. 4. Comparison of propionic acid yield, productivity, and P/A and P/S ratios in serum bottles by P. shermanii wild type (WT) and Ps(pKCOA1) (Mutant) grown on glucose, glycerol, and the mixture of glycerol and glucose at various ratios of 1, 2, and 3. Data are mean 7 s.d. (n¼ 3). * indicate statistically significant with p o0.05.

the wild-type, due to the reduced succinic acid formation. However, there was no significant difference in the propionic acid productivity between the mutant and wild type. 3.5. Co-fermentation in serum bottles Co-fermentation with glycerol and glucose as carbon sources could combine the beneficial effects of both glucose fermentation and glycerol fermentation. Compared to the glucose fermentation, the co-fermentation process had similar or higher propionic acid productivity, a higher propionic acid yield and much less acetate formation (Wang and Yang, 2013). Fermentations with different mass ratios of glycerol and glucose (1:1, 2:1 and 3:1) were thus tested and the results are also summarized in Fig. 4. In general, the propionic acid yield increased with increasing the glycerol/glucose mass ratio for both strains. The P/A ratios in these co-fermentations were more than double of those in glucose fermentation, but lower than those in glycerol fermentation. Compared to the wild type, the mutant Ps(pKCOA1) gave  10% higher P/A ratio, 26.5–69.5% higher P/S ratio, and 2.5–4.2% higher propionic acid yield. The mutant also had 4.6% higher productivity when glycerol/glucose ratio was 2; however, no significant difference in propionic acid productivity was observed when the glycerol/glucose ratios were 1 and 3. 3.6. Fermentation in bioreactors Comparative fermentation studies with P. shermanii wild type and Ps(pKCOA1) were performed in bioreactors with pH controlled at 6.5. First glucose or glycerol was used as sole carbon source, and the fermentation kinetics is shown in Fig. 2. In general, similar fermentation kinetics was observed for both the mutant and the wild type in glucose fermentation, except for slightly higher P/A and P/S ratios

(see Fig. 5). When glycerol was used as substrate, propionic acid productivity and purity (P/A and P/S ratios) of the mutant were significantly higher than those of the wild type, although the propionic acid yield was generally the same (Fig. 5). Cofermentations with glycerol and glucose were also studied in 5-L bioreactors with pH controlled at 6.5 (Fig. 3). Although no obvious difference was observed between the mutant Ps(pKCOA1) and the wild type for glycerol/glucose¼2 (Fig. 3A and B), the mutant consumed more glycerol, grew to a higher final OD, and produced more propionic acid when glycerol/glucose¼4 (Fig. 3C and D), with propionic acid yield increased  10% (0.6270.01 vs. 0.5670.01 g/g) and productivity increased  46% (0.4170.03 vs. 0.2870.02 g/L h) compared to the wild type. Clearly, the effects of overexpressing CoAT were more prominent at the higher glycerol/glucose ratio of 4. In order to compare with the results from serum bottles, the co-fermentation with glycerol/glucose ¼ 2 was further studied in bioreactor with agitation and 50 g/L CaCO3 to buffer the pH at  5.0 (Fig. 3E and F). In general, the mutant also showed better propionic acid production with a higher propionic acid yield, productivity, P/A and P/S ratios, and ΔGly/ΔGlu ratio compared to the wild type (Figs. 5 and 6). These results are consistent with the findings in serum bottles under similar conditions. Although succinic acid was the major byproduct at pH 6.5 while acetic acid was the main byproduct at pH 5.0, the mutant overexpressing CoAT generally gave a higher propionic acid yield, productivity, P/A and P/S ratios, and ΔGly/ΔGlu ratio at both pH 6.5 and 5.0 (see Figs. 5 and 6). However, the effects were prominent only when glycerol was the main carbon source, probably because CoAT overexpression significantly enhanced glycerol catabolism and thus propionic acid production from glycerol, but not glucose catabolism, which could be attributed to the limitation in redox balance in glucose fermentation. It should be noted that CoA

52

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

0.50

0.8

*

*

*

0.6

Yield (g/g)

Mutant

0.40

0.5 0.4 0.3 0.2

0.35 0.30 0.25 0.20 0.15 0.10

0.1 0

*

0.45

Productivity (g/L/h)

0.7

WT

*

0.05 Glucose

2

2*

4

0.00

Glycerol

Glucose

Glycerol/Glucose 40 35

WT

18

*

Mutant

12

*

20

P/S (g/g)

P/A (g/g)

WT

Glycerol

Mutant

14

25

*

15

10

*

*

*

8

*

6

10

0

*

16

30

5

2 2* 4 Glycerol/Glucose

* Glucose

4

* 2

2*

2 4

Glycerol

Glycerol/Glucose

0

Glucose

2

2*

4

Glycerol

Glycerol/Glucose

Fig. 5. Comparison of propionic acid yield, productivity, and P/A and P/S ratios in bioreactors by P. shermanii wild type (WT) and Ps(pKCOA1) (Mutant) grown on glucose, glycerol, and the mixture of glycerol and glucose at a ratio of 2 and 4 at pH 6.5 and  pH 5.0 with CaCO3 (Glycerol/Glucose ratio¼2*). Data are mean 7 s.d. (n¼ 2). * indicate statistically significant with p o 0.05.

overexpression did not show any significant impact on cell growth rate as similar specific growth rates were found for both the wild type and the mutant under all fermentation conditions studied (Fig. 6A).

pathway. The stoichiometric equations for EMP and HMP pathways are as follows:

3.7. Metabolic flux analysis (MFA)

5 11 5 5 11 HMP : Glucose þ ADP þ NAD þ - Pyruvate þ ATP þ NADH þ CO2 3 3 3 3 3

The reactions in glycolysis and the dicarboxylic acid pathway (Chen et al., 2012) are shown in Fig. 7, with the equations used in the MFA shown in Table 2. The biomass synthesis reaction (r23) was proposed by Papoutsakis and Meyer (1985). A pseudo-steadystate hypothesis was applied on the intracellular metabolic intermediates to set their net accumulation rates to zero. The net accumulation or consumption rates of succinic acid, acetic acid, propionic acid, glucose and glycerol can be calculated from the experimental data, which were used to estimate the unknown reaction fluxes. The average substrate consumption and product formation rates during the exponential phase were determined from the slopes of linear plots of concentration versus time. The fluxes of all reactions were normalized with respect to carbon source uptake rates by scaling the total carbon (glucose or glucose/ glycerol mixture) flux into the cell to 100%. Carbon flux distributions at several key metabolic nodes, which are intermediates in metabolic pathways where multiple reactions are divergent from, were compared for the wild type and mutant to illustrate the effects of CoAT overexpression. In this case, glucose-6-phosphate (r2, r7), pyruvate (r13, r15), propionyl-CoA (r18, r19) and succinic acid (r20) were studied (see Fig. 7). Glucose-6-phosphate is the branch point for Embden–Meyerhof–Parnas (EMP) pathway and hexose monophosphate (HMP)

More NADH is produced in HMP than EMP when an equal amount of glucose is oxidized. For propionic acid biosynthesis, one mole pyruvate is converted to propionic acid with the oxidation of two mole NADH. As a result, if glucose is oxidized via EMP, NADH produced in this pathway is not enough to reduce pyruvate to propionic acid and extra NADH has to be produced in the phosphotransacetylase (pta)–acetate kinase (ack) pathway (r14) with acetate formed as a byproduct. If glucose is oxidized via HMP, adequate reducing power is generated for propionic acid biosynthesis. In glucose fermentation, more than 80% glucose was oxidized via EMP and CoAT overexpression did not have notable effect on carbon flux distribution between EMP and HMP pathways (see Table 3). For the pyruvate node, carbon partition between acetyl-CoA and oxaloacetate was not significantly different for the wild type and the mutant. Meanwhile, a strong correlation between flux r7 (HMP) and flux r13 (pyruvate-acetyl-CoA) was found: flux r13 decreased with an increase in flux r7. As expected, the flux r18 catalyzed by CoAT was enhanced in the mutant. CoAT overexpression also decreased the flux r19 for the reaction which carboxylates propionyl-CoA to methylmalonyl-CoA. The stoichiometric equation for glycerol is as follow:

EMP : Glucose þ 2 ADP þ 2 NAD þ - 2 Pyruvate þ 2 ATP þ 2 NADH

Glycerol þ ADP þ 2 NAD þ -Pyruvate þATP þ 2 NADH

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

GLC

3.0

WT

*

∆Gly/∆Glu

2.5

Mutant

r1

r7

G6P

*

XU5P

E4P r11

r3

0.5

r21 2

2*

4

GLY

S7P r10

GAP r4

Glycerol/Glucose

G3P

r22

CO2

r5 0.12

Specific growth rate (h-1)

R5P

r12

1.0

PEP

0.1

r23

r6

0.08

ACCoA

0.06

r13

0.04

PYR PPCoA

r14

0.02 0

r9

F6P

1.5

0.0

RU5P

r8

r2

*

2.0

53

Glucose

2

4

r19

OAA MMCoA r17

r16

SUCCoA

Glycerol

r18

Glycerol/Glucose Fig. 6. Comparison of the ratio of glycerol consumption rate and glucose consumption rate (ΔGly/ΔGlu) and specific growth rate in bioreactors by P. shermanii wild-type (WT) and Ps(pKCOA1) (Mutant) grown on different carbon sources. Data are mean 7 s.d. (n¼ 2). * indicates statistically significant with p o 0.05.

r15

biomass

AC

PA

SUC

r20

SUC

Fig. 7. Metabolic pathway in Propionibacterium freudenreichii subsp. shermanii. All reactions used in the stoichiometric analysis are listed in Table 2.

4. Discussion Glycerol could provide more reducing power than the EMP pathway for glucose on the same molar basis. Hence, the presence of glycerol completely diminished the need for using the HMP pathway (r7 ¼0) to generate additional NADH for propionic acid biosynthesis (Liu et al., 2011; Wang and Yang 2013; Zhang and Yang 2009). As observed in the co-fermentation, CoAT overexpression accelerated glycerol consumption, resulting in a lower flux toward EMP (r2) for the mutant. At the pyruvate node and the propionyl-CoA node, the mutant had a higher flux toward the propionic acid synthesis pathway (r15 and r18). In addition, the mutant also lowered the flux r19, which was less than half of that of the wild type. When glycerol was used as sole carbon source, the loss of propionyl-CoA (r19) as the precursor for propionic acid was significantly reduced, leading to an increased flux toward propionic acid (r18). Similar results were observed for fermentations in the bioreactor. In general, CoAT overexpression resulted in the following changes in the metabolic flux distributions: flux toward HMP (r7) increased with a decrease in flux r2; fluxes toward propionic acid (r15 and r18) increased while fluxes toward acetate (r13), succinate (r20), and MMCoA (r19) decreased. It is noted that the influence of the CoAT overexpression on the flux shift from EMP to HMP in glycolysis was more obvious when there was more glycerol in the co-fermentation. Also, most significant changes were observed at the lower pH of  5.0 with glycerol/ glucose mass ratio of 2, with fluxes r2 and r19 decreased 34% and 76%, respectively, and flux r18 increased 18%, as compared to the wild type.

Propionibacteria are difficult to manipulate genetically because of their high genomic GC content, thick cell wall, and the presence of restriction-modification systems (Jore et al., 2001; van Luijk et al., 2002). Moreover, there are only a few shuttle vectors available for genetic engineering of propionibacteria. Although propionibacteria have been widely used in the dairy industry and propionic acid fermentation has been extensively studied, to date only a few reports are available on the metabolic engineering of propionibacteria for improving the fermentative production of propionic acid (Ammar et al. 2013, 2014; Suwannakham and Yang, 2005; Zhuge et al., 2013). The beneficial effects of CoAT overexpression are more prominent with glycerol than with glucose. The glucose fermentation data demonstrated the metabolic rigidity of propionibacteria. Although propionic acid yield was increased to some extent for the mutant in serum bottles, the flux distribution between EMP and HMP pathways was not altered significantly compared with the wild type. In both strains, the EMP pathway accounted for more than 80% carbon flux. The predominance of EMP pathway suggested that accelerating one reaction step in the downstream propionic acid biosynthesis pathway could not impact the upstream glucose oxidation pathways. The metabolic flux toward HMP seems to be strictly controlled in glucose fermentation. In contrast, manipulating the redox potential via substrates was able to affect flux distribution in the downstream pathways and hence the fermentation product profiles. Compared to glucose, glycerol has a higher reduction degree and its use as substrate promotes the production of more reduced metabolites (Choi et al., 2012;

54

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

Malaviya et al., 2012; Wang and Yang, 2013). When glycerol was used as a co-substrate with glucose in the co-fermentation, acetic acid formation was significantly reduced and more propionic acid was produced. The NADH-generating acetic acid formation pathway and NADH-consuming propionic acid formation pathway render propionibacteria great flexibility to cope with various carbon sources with different reducing states. Although the mutant generally produced more propionic acid with a higher yield and productivity compared with the wild type, the effects of CoA transferase overexpression varied with the fermentation conditions (substrate, pH, etc.). For example, with glucose and glycerol as co-substrates the mutant Ps(pKCOA1) produced up to 10% more propionic acid (yield: 0.6270.01 vs. 0.5670.01 g/g) in bioreactor but only 2.5–4.2% more in serum bottles. It should be noted that a 5% to 10% increase in product yield would be very significant for the Table 2 Equations for reactions involved in the metabolic flux analysis (MFA) of P. freudenreichii subsp. shermanii. r1: GLC þ ATP¼ G6P þADP r2: G6P ¼ F6P r3: F6P þ ATP¼ 2 GAP þ ADP r4: GAP þ ADP þNAD þ ¼G3P þ ATPþ NADH r5: G3P ¼ PEPþ H2O r6: PEP þ ADP¼ PYR þATP r7: G6P þ2 NADP þ H2O ¼RU5P þ 2 NADPH þ CO2 r8: RU5P¼XU5P r9: RU5P¼R5P r10: XU5P þ R5P ¼GAP þ S7P r11: GAP þ S7P ¼F6P þ E4P r12: XU5Pþ E4P ¼ F6Pþ GAP r13: PYR þ NAD þ ¼ ACCoA þNADHþ CO2 r14: AACoAþ ADP ¼ACþ ATP r15: PYR þ MMCoA ¼PPCoA þ OAA r16: OAA þ 2 NADHþ ADP¼ SUCþ 2 NAD þ þATP r17: SUCCoA ¼MMCoA r18: PPCoA þSUC ¼SUCCoA þPA r19: PPCoA þ CO2 þ ATP ¼MMCoA (reverse reaction of r19 catalyzed by MMD:MMCoA ¼PPCoA þ CO2) r20: SUC accumulation r21: GLYþ ATP þNAD þ ¼GAP þ ADP þNADH r22: CO2 release r23: 4 Pyruvateþ 5.75 NADHþ 33.7 ATP¼ 3C4H4xO4yN4z þ5.75 NAD þ þ 33.7 ADP Abbreviations: GLC: glucose; GLY: glycerol; G6P: glucose-6-phosphate; F6P: fructose-6-phosphate; GAP: glyceraldehyde-3-phosphate; G3P: 3-phosphoglycerate; RU5P: ribulose-5-phosphate; CO2: carbon dioxide; XU5P: xylulose-5-phosphate; R5P: ribose-5-phosphate; S7P: sedoheptulose-7-phosphate; E4P: erythrose-4phosphate; PEP: phosphoenolpyruvate; PYR: pyruvate; AACoA: acetyl-CoA; OAA: oxaloacetate; MMCoA: methylmalonyl-CoA; PPCoA: propionyl-CoA; SUCCoA: succinyl-CoA; PA: propionic acid; AC: acetic acid; SUC: succinic acid.

economics of propionic acid as a commodity chemical (Stowers et al., 2014). The raw material cost in propionic acid fermentation could account for more than 50% of the final product cost (Dishisha et al., 2013), and the profit margin for commodity chemicals is usually less than  5%. Thus, a 5% to 10% increase in product yield could translate into an additional 5% to 10% profit (doubling to tripling the profit margin), which can make the industrial production of biobased propionic acid more competitive with petroleum-based products. Furthermore, in the co-fermentation with glycerol/glucose ratio of four by the mutant, propionic acid productivity increased 46% (0.4170.03 vs. 0.2870.02 g/L h for the wild type), which can significantly reduce capital investment. In addition, the higher product purity (50% higher in the P/A ratio and 23% higher in the P/S ratio) obtained in the co-fermentation by the mutant would significantly reduce separation and purification costs, which could account for 30% to 50% of the production cost. The improved fermentation performance with the mutant Ps(pKCOA1) makes it a promising strain for industrial propionic acid fermentation process (Wang and Yang, 2013). In propionic acid fermentation, acetic and succinic acids are produced as two byproducts, which not only would lower the propionic acid yield but also make the downstream product purification more difficult. In this study, we demonstrated that overexpressing the native CoAT in P. shermanii could increase the conversion of succinate to propionate, thus reducing succinate production. Succinic acid accumulation was once considered as the consequence of phosphoenolpyruvate carboxylase (PEPC) activity, which condenses phosphoenolpyruvate and CO2 to form oxaloacetate, which is then converted to succinic acid through malate dehydrogenase, fumarase and fumarate reductase, thus diverting carbon toward succinic acid biosynthesis (Ammar et al. 2014). However, PEPC gene was not present in P. acidipropionici nor P. shermanii according to the published genomic sequences. On the other hand, a biotin-dependent enzyme, propionyl-CoA carboxylase (PCC), was identified in both genomes. As a consequence, some propionyl-CoA could be lost due to the activity of PCC (flux r19), leading to the accumulation of succinic acid. Therefore, PCC gene disruption might be necessary in order to prevent succinic acid accumulation and preserve propionyl-CoA for propionic acid biosynthesis. Similarly, overexpressing methylmalonyl-CoA decarboxylase (MMD), which converts MMCoA to propionyl-CoA and has been recently annotated in the genome of P. acidipropionici ATCC 4875 (Dimroth and Schink, 1998) but not in P. shermanii, might also prevent succinic acid accumulation and increase propionyl-CoA pool for propionic acid production. In addition, a novel pathway converting succinyl-CoA to propionyl-CoA present in Thermobifida fusca (Deng and Fong, 2011) might be cloned and expressed in P. shermanii to reduce the accumulation of succinate. Furthermore, over-expressing methylmalonyl-CoA carboxyltransferase (MMC) and pyruvate

Table 3 Metabolic flux analysis of P. shermanii wild type (WT) and Ps (pKCOA1) (Mutant) for several key metabolic reactions. Reaction

Serum bottle Glucose

WT r2: G6P-F6P r7: G6P-RU5P r21: glycerol uptake r13: PYR-ACCoA r15: PYR-OAA r18: PPCoA-PA r19: PPCoA-MMCoA r20: SUC accumulation r22: CO2 r23: Biomass

82.15 18.49 – 23.80 56.02 53.06 2.98 4.44 10.02 21.4

Bioreactor Glycerol

Mutant WT 80.14 20.43 – 22.91 56.31 53.90 2.43 3.66 10.23 21.28

– – 100 6.78 83.98 78.28 6.11 19.27 0.25 24.42

Glycerol/ glucose ¼2

Mutant WT – – 100 7.79 84.27 84.52 0.27 15.23 2.51 25.73

48.15 0 60.02 15.71 72.48 70.28 2.24 4.21 0.46 24.25

Glycerol/glucose¼2 (pH 6.5) Glycerol/glucose¼ 4 (pH 6.5) Glycerol/glucose¼2 (CaCO3)

Mutant

WT

Mutant

WT

Mutant

WT

Mutant

36.4 0 70.74 13.86 79.47 78.55 0.99 3.37 3.56 26.32

33.14 3.97 62.17 5.58 69.69 64.33 5.34 6.60 0.74 19.22

29.48 5.63 64.36 4.64 71.28 66.57 4.70 5.88 0.92 19.56

30.09 8.48 62.20 7.25 74.76 70.03 4.76 6.91 2.24 21.82

21.10 11.94 68.29 5.16 79.08 75.31 3.80 6.04 2.44 22.81

47.97 0.00 56.00 16.86 74.34 72.29 2.11 4.58 4.65 25.42

31.70 4.37 68.48 15.34 85.62 85.24 0.50 4.02 5.67 29.28

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

carboxylase (PYC) (Okino et al., 2008) could increase the carboxylation of pyruvate to oxaloacetate, thus leading to increased or faster propionate production. These genes would be the targets in metabolic engineering of propionibacteria in future studies. It should be noted that inactivating or down-regulating ack (acetate kinase) and/or pta (phosphotransacetylase) in the acetate formation pathway could also reduce acetate and increase propionate production (Suwannakham et al., 2006). We have attempted to knock out these two genes in P. shermanii by using integration knockout plasmids and linear gene fragments for homologous recombination, but without success. On the other hand, acetate and succinate production can be reduced in extractive fermentation preferentially or selectively removing propionic acid (over acetic and succinic acids) from the fermentation broth as demonstrated by Jin and Yang (1998). Extractive fermentation can enhance fermentation productivity by removing the inhibiting metabolite such as propionic acid. Finally, genes associated with stress responses and propionate tolerance could also be the targets for metabolic engineering although the underlying mechanisms for these cellular processes are complicated and poorly understood (Nicolaou et al., 2010). Unlike rational metabolic engineering, which is limited by available knowledge and genetic engineering tools, evolutionary engineering, such as adapting cells in a fibrous-bed bioreactor under propionate stress has been successfully applied to P. acidipropionici to generate mutants with significantly increased propionate and decreased acetate and succinate production compared to the wild type (Liang et al., 2012; Suwannakham and Yang, 2005; Zhu et al., 2012). Strain development by evolutionary engineering and conventional mutagenesis can be facilitated by applying high-throughput screening systems (Scheel and Lütke-Eversloh, 2013). For economic production of biobased propionic acid, it may be necessary to apply both rational metabolic engineering and evolutionary engineering to generate a robust strain that can be used in an integrated fermentation process with in situ product removal by extraction.

5. Conclusions Overexpressing CoAT in P. shermanii increased propionic acid yield and productivity with much reduced succinate and acetate production from glucose and glycerol. CoAT overexpression also significantly increased glycerol consumption and elevated propionic acid purity, which can facilitate downstream product separation and reduce the overall production cost. The CoAT overexpression mutant is promising for use in industrial fermentation to produce propionic acid from glycerol and glucose, although further metabolic and process engineering may be necessary for economical production of biobased propionic acid.

Acknowledgments This work was supported in part by the Dow Chemical Company. We would like to thank Prof. Y. Murooka, Department of Biotechnology, University of Osaka, Japan, for providing plasmid pKHEM01.

Appendix A. Supplemental Materials Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ymben.2014.10. 005.

55

References Ammar, E.M., Wang, Z., Yang, S.T., 2013. Metabolic engineering of Propionibacterium freudenreichii for n-propanol production. Appl. Microbiol. Biotechnol. 97, 4677–4690. Ammar, E.M., Jin, Y., Wang, Z., Yang, S.T., 2014. Metabolic engineering of Propionibacterium freudenreichii: effect of expressing phosphoenolpyruvate carboxylase on propionic acid production. Appl. Microbiol. Biotechnol. 98, 7761–7772. Chen, F., Feng, X., Xu, H., Zhang, D., Ouyang, P., 2012. Propionic acid production in a plant fibrous-bed bioreactor with immobilized Propionibacterium freudenreichii CCTCC M207015. J. Biotechnol. 164, 202–210. Choi, Y.J., Park, J.H., Kim, T.Y., Lee, S.Y., 2012. Metabolic engineering of Escherichia coli for the production of 1-propanol. Metab. Eng. 14, 477–486. Brede, D.A., Faye, T., Stierli, M.P., Dasen, G., Theiler, A., Nes, I.F., Meile, L., Holo, H., 2005. Heterologous production of antimicrobial peptides in Propionibacterium freudenreichii. Appl. Environ. Microbiol. 71, 8077–8084. Deng, Y., Fong, S.S., 2011. Metabolic engineering of Thermobifida fusca for direct aerobic bioconversion of untreated lignocellulosic biomass to 1-propanol. Metab. Eng. 13, 570–577. Dimroth, P., Schink, B., 1998. Energy conservation in the decarboxylation of dicarboxylic acids by fermenting bacteria. Arch. Microbiol. 170, 69–77. Dishisha, T., Ståhl, A., Lundmark, S., Hatti-Kaul, R., 2013. An economical biorefinery process for propionic acid production from glycerol and potato juice using high cell density fermentation. Bioresour. Technol. 135, 504–512. Falentin, H., Deutsch, S.M., Jan, G., Loux, V., Thierry, A., Parayre, S., Maillard, M.B., Dherbecourt, J., Cousin, F.J., Jardin, J., Siguier, P., Couloux, A., Barbe, V., Vacherie, B., Wincker, P., Gibrat, J.F., Gaillardin, C., Lortal, S., 2010. The complete genome of Propionibacterium freudenreichii CIRM-BIA1, a hardy actinobacterium with food and probiotic applications. PloS One 5 (7), e11748. Fu, X.Z., Tan, D., Aibaidula, G., Wu, Q., Chen, J.C., Chen, G.Q., 2014. Development of Halomonas TD01 as a host for open production of chemicals. Metab. Eng. 23, 78–91. Heider, J., 2001. A new family of CoA-transferases. FEBS Lett. 509, 345–349. Himmi, E.H., Bories, A., Boussaid, A., Hassani, L., 2000. Propionic acid fermentation of glycerol and glucose by Propionibacterium acidipropionici and Propionibacterium freudenreichii ssp. shermanii. Appl. Microbiol. Biotechnol. 53, 435–440. Jin, Z., Yang, S.T., 1998. Extractive fermentation for enhanced propionic acid production from lactose by Propionibacterium acidipropionici. Biotechnol. Prog. 14, 457–465. Jore, J.P.M., van Luijk, N., Luiten, R.G., van der Werf, M.J., Pouwels, P.H., 2001. Efficient transformation system for Propionibacterium freudenreichii based on a novel vector. Appl. Environ. Microbiol. 67, 499–503. Kiatpapan, P., Hashimoto, Y., Nakamura, H., Piao, Y.Z., Ono, H., Yamashita, M., Murooka, Y., 2000. Characterization of pRDO1, a plasmid from Propionibacterium acidipropionici, and its use for development of a host-vector system in propionibacteria. Appl. Environ. Microbiol. 66, 4688–4695. Kiatpapan, P., Murooka, Y., 2001. Construction of an expression vector for propionibacteria and its use in production of 5-aminolevulinic acid by Propionibacterium freudenreichii. Appl. Microbiol. Biotechnol. 56, 144–149. Liang, Z., Li, L., Li, S., Cai, Y., Yang, S.T., Wang, J., 2012. Enhanced propionic acid production from Jerusalem artichoke hydrolysate by immobilized Propionibacterium acidipropionici in a fibrous-bed bioreactor. Bioprocess Biosyst. Eng. 35, 915–921. Liu, Y., Zhang, Y.G., Zhang, R.B., Zhang, F., Zhu, J., 2011. Glycerol/glucose cofermentation: one more proficient process to produce propionic acid by Propionibacterium acidipropionici. Curr. Microbiol. 62, 152–158. Malaviya, A., Jang, Y.S., Lee, S.Y., 2012. Continuous butanol production with reduced byproducts formation from glycerol by a hyper producing mutant of Clostridium pasteurianum. Appl. Microbiol. Biotechnol. 93, 1485–1494. Nicolaou, S.A., Gaida, S.M., Papoutsakis, E.T., 2010. A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: from biofuels and chemicals, to biocatalysis and bioremediation. Metab. Eng. 12, 307–331. Okino, S., Noburyu, R., Suda, M., Jojima, T., Inui, M., Yukawa, H., 2008. An efficient succinic acid production process in a metabolically engineered Corynebacterium glutamicum strain. Appl. Microbiol. Biotechnol. 81, 459–464. Papoutsakis, E.T., Meyer, C.L., 1985. Fermentation equations for propionic acid bacteria and production of assorted oxychemicals from various sugars. Biotechnol. Bioeng. 27, 67–80. Parizzi, L.P., Grassi, M.C., Llerena, L.A., Carazzolle, M.F., Queiroz, V.L., Lunardi, I., Zeidler, A.F., Teixeira, P.J., Mieczkowski, P., Rincones, J., Pereira, G.A., 2012. The genome sequence of Propionibacterium acidipropionici provides insights into its biotechnological and industrial potential. BMC Genomics 13, 562. Piao, Y.Z., Kawaraichi, N., Asegawa, R., Kiatpapan, P., Ono, H., Yamashita, M., Murooka, Y., 2004. Molecular analysis of promoter elements from Propionibacterium freudenreichii. J. Biosci. Bioeng. 97, 310–316. Ruhal, R., Choudhury, B., 2012. Use of an osmotically sensitive mutant of Propionibacterium freudenreichii subspp. shermanii for the simultaneous productions of organic acids and trehalose from biodiesel waste based crude glycerol. Bioresour. Technol. 109, 131–139. Scheel, M., Lütke-Eversloh, T., 2013. New options to engineer biofuel microbes: development and application of a high-throughput screening system. Metab. Eng. 17, 51–58. Stowers, C.C., Cox, B.M., Rodriguez, B.A., 2014. Development of an industrializable fermentation process for propionic acid production. J. Ind. Microbiol. Biotechnol. 41, 837–852.

56

Z. Wang et al. / Metabolic Engineering 27 (2015) 46–56

Suwannakham, S., Yang, S.T., 2005. Enhanced propionic acid fermentation by Propionibacterium acidipropionici mutant obtained by adaptation in a fibrousbed bioreactor. Biotechnol. Bioeng. 91, 325–337. Suwannakham, S., Huang, Y., Yang, S.T., 2006. Construction and characterization of ack knock-out mutants of Propionibacterium acidipropionici for enhanced propionic acid fermentation. Biotechnol. Bioeng. 94, 383–395. Thierry, A., Deutsch, S.M., Falentin, H., Dalmasso, M., Cousin, F.J., Jan, G., 2011. New insights into physiology and metabolism of Propionibacterium freudenreichii. Int. J. Food Microbiol. 149, 19–27. van Luijk, N., Stierli, M.P., Schwenninger, S.M., Herve, C., Dasen, G., Jore, J.P.M., Pouwels, P.H., van der Werf, M.J., Teuber, M., Meile, L., 2002. Genetics and molecular biology of propionibacteria. Lait 82, 45–57. Wang, P., Wang, Y., Su, Z., 2012. Microbial production of propionic acid with Propionibacterium freudenreichii using an anion exchanger-based in situ product recovery (ISPR) process with direct and indirect contact of cells. Appl. Biochem. Biotechnol. 166, 974–986.

Wang, Z., Yang, S.T., 2013. Propionic acid production in glycerol/glucose cofermentation by Propionibacterium freudenreichii subsp. shermanii. Bioresour. Technol. 137, 116–123. Yu, M., Du, Y., Jiang, W., Chang, W.L., Yang, S.T., Tang, I.C., 2012. Effects of different replicons in conjugative plasmids on transformation efficiency, plasmid stability, gene expression and n-butanol biosynthesis in Clostridium tyrobutyricum. Appl. Microbiol. Biotechnol. 93, 881–889. Zhang, A., Yang, S.T., 2009. Propionic acid production from glycerol by metabolically engineered Propionibacterium acidipropionici. Process Biochem. 44, 1346–1351. Zhu, L., Wei, P., Cai, J., Zhu, X., Wang, Z., Huang, L., Xu, Z., 2012. Improving the productivity of propionic acid with FBB-immobilized cells of an adapted acidtolerant Propionibacterium acidipropionici. Bioresour. Technol. 112, 248–253. Zhuge, X., Liu, L., Shin, H., Chen, R.R., Li, J., Du, G., Chen, J., 2013. Development of a Propionibacterium-Escherichia coli shuttle vector for metabolic engineering of Propionibacterium jensenii, an efficient producer of propionic acid. Appl. Environ. Microbiol. 79, 4595–4602.