Endoproteolytic processing of the mammalian prion glycoprotein family Charles E. Mays1, Janaky Coomaraswamy2, Joel C. Watts3, Jing Yang1, Kerry W.S. Ko1, Bob Strome3, Robert C.C. Mercer1, Serene L. Wohlgemuth1, Gerold Schmitt-Ulms3 and David Westaway1,4 1 2 3 4

Centre for Prions and Protein Folding Diseases, University of Alberta, Edmonton, Canada Biogen Idec International Neuroscience, Schlieren, Switzerland Department of Biochemistry and Tanz Centre for Research in Neurodegenerative Diseases, University of Toronto, ON, Canada Division of Neurology, Department of Biochemistry, University of Alberta, Edmonton, Canada

Keywords ADAM; Doppel; endoproteolysis; prion protein; Shadoo Correspondence D. Westaway, Centre for Prions and Protein Folding Diseases, University of Alberta, 204 Brain and Aging Research Building, Edmonton, AB T6G 2M8, Canada Fax: +1 780 492 9352 Tel: +1 780 492 9024 E-mail: [email protected] (Received 4 July 2013, revised 25 October 2013, accepted 19 November 2013) doi:10.1111/febs.12654

Cellular prion protein (PrPC) misfolds to form infectivity-associated scrapie prion protein and generates C-terminal fragments C1 and C2 in healthy and prion-infected animals. C1 cleavage occurs N-terminally of PrPC’s hydrophobic domain, whereas the larger C2 fragment is generated by cleavage at the end of the octarepeat region. As the PrP-like proteins Doppel and Shadoo (Sho) have been reported to inhabit similar membrane environments as PrPC, we investigated endoproteolysis by using a panel of mutant alleles. Doppel undergoes efficient in vivo cleavage at a C1 site mapped to the start of the globular domain, which is a structurally similar cleavage site to that in PrPC. Sho is processed to C1 and C2 fragments, and proved refractory to mutagenesis to inactivate C1 cleavage. As a reciprocal product of C1 cleavage, Sho also engenders a metabolically stable N1 fragment with a C-terminus after its hydrophobic domain, an observation that may account for N1’s association with membrane and/or cellular fractions in vitro and in vivo. Our data indicate that glycosylation status and yet to be identified proteases modulate internal C1 and C2 proteolysis events within the mammalian prion protein family.

Introduction A b-sheet-rich form of the cellular prion protein (PrPC) called scrapie prion protein (PrPSc) replicates during prion diseases such as Creutzfeldt–Jakob disease in humans by the template-assisted conformational conversion of the a-helical PrPC [1]. Endoproteolysis of prion protein (PrP) probably plays a fundamental role in PrPSc propagation, because the predominant C-terminal fragment switches during disease progression [2,3]. Under healthy conditions, a-cleavage of PrPC is abundant, and generates a 17kDa C-terminal fragment, named ‘C1’, by proteolysis at a somewhat variable site immediately preceding the

hydrophobic domain [2,4,5]. During disease, a-cleavage occurs less frequently than b-cleavage after the octarepeat region, thus making the ‘C2’ fragment dominant. C2 has a slightly larger molecular mass than C1, and is equivalent in size to the PrP 27–30 protease-resistant core [2,4]. As determinants between the hydrophobic domain and the octarepeat regions may be necessary to maintain a productive prion infection [6], prior processing of PrPC at the a-site to produce C1 may pre-empt the production of infectious and/or toxic forms of PrP. In addition to these internal cleavage sites, all PrP species are shed by endoproteolysis

Abbreviations CID, collision-induced dissociation; DEA, diethylamine; Dpl, Doppel; GFP, green fluorescent protein; GPI, glycosylphosphatidylinositol; PrP, prion protein; PrPC, cellular prion protein; PrPSc, scrapie prion protein; Sho, Shadoo; YFP, yellow fluorescent protein.

862

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

C. E. Mays et al.

adjacent to the glycosylphosphatidylinositol (GPI) anchor via a protease that may or may not be responsible for a-cleavage or b-cleavage [7–12]. The other two members of the PrP superfamily are Doppel (Dpl) and Shadoo (Sho), but neither contributes to prion infection [13–16]. Both Dpl and Sho transit the secretory pathway and are GPI-anchored to the cell surface, like PrPC [17,18]. Unlike Sho and PrPC, Dpl primarily resides in the testis rather than the central nervous system [18]. However, Dpl remains of particular interest, because it shares a three-dimensional resemblance to the C-terminus of PrPC [19,20], and, when artificially expressed in the brain, causes an ataxia that can be reversed with an abundance of PrPC [13]. In contrast to Dpl, Sho resembles the natively unstructured N-terminus of PrPC, with a hydrophobic domain and Arg-rich repeats that align with or are partly analogous to the hydrophobic domain and positively charged octarepeats of PrPC [21,22]. Both PrPC and Sho have the ability to bind to nucleic acids [23– 26], and an intriguing aspect of Sho biology is its prion disease-specific downregulation [15–17,27]. Discerning the physiological role and relevance of the PrPC holoprotein has been an ongoing controversial topic [28–30], and has generated a similar debate concerning the possibility of a functional role for its cleavage products [31,32]. Specifically, PrP C1 enhances the apoptotic effect of staurosporine through a p53-dependent mechanism in cultured cells [33], but it is nontoxic and protective against prion infection when expressed in transgenic mice [34]. Moreover, the N-terminus of PrP was recently described in a review as a molecular sensor that can also be neuroprotective and neurotoxic, depending on the interacting ligand [35], and in vitro evidence has shown that releasing PrP N1 is protective against p53-dependent cell death [36], as well as toxicity associated with Ab [37]. In addition to discrepancies in the function of PrPC and its fragments, the cellular location in which a-cleavage occurs is under scrutiny, with evidence in favor of the cell surface [38], an acidic endocytic compartment such as a lysosome [39], and/or a late compartment of the secretory pathway [40]. Incomplete descriptions of uncharacterized cleavage products for Dpl and Sho have been reported [14– 17,41–43]. As all three members of the PrP superfamily may share a similar membrane environment [44], and because descendants of their putative evolutionary ancestor, ZIP proteins, also undergo endoproteolysis [45], we believe that characterizing the metabolic events for Dpl and Sho could provide insights into potentially analogous events for PrP and the larger issue of mapping function to proteolytic products. At FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

Endoproteolysis of Shadoo and Doppel

this stage, functions for Dpl and Sho cleavage products are hypothetical, but appear to be promising for advancing our knowledge of the biological significance of PrPC. In fact, Sakthivelu et al. [46] have indicated that the N-terminal domain of PrPC can be replaced by that of Sho and maintain its ability to protect cells from stress-induced toxicity, thus indicating that Sho and PrPC are involved in similar signaling pathways. Whether cleavage of Sho generates fragments that possess overlapping functions with those of PrP or contribute to its downregulation during disease is of interest. As both PrP-null [47] and Sho-null mice [14] have normal lifespans, with (at most) subtle defects, Dpl is the only member of the PrP superfamily to have an undisputable function in spermatogenesis that results in male Dpl-knockout mice being sterile [48–50]; this makes exploration of specific functions for its cleavage products the most straightforward and may expand the possibility of there being tissue-specific PrPases, as was recently suggested [51]. For these reasons, we analyzed fragmentation in animal-derived tissues and cultured cells by using antibody mapping of wild-type and mutant constructs to localize the signal peptide and internal cleavage sites, as well as the impact of glycosylation on endoproteolysis for Dpl and Sho.

Results and Discussion In vivo endoproteolytic processing of Dpl Dpl is highly expressed in the testis of wild-type mice, as well as in the brains and testis of TgDpl10329 transgenic mice, in which the Dpl coding region is under the control of the Prnp promoter [13,18,52]. To determine whether truncated but unmapped protein species following PNGase F deglycosylation were analogous to processed species for PrP [2,41], we analyzed homogenized brains and testis of TgDpl10329 mice with an antibody (E6977) raised against full-length mature Dpl 27–155 (but recognizing a C-terminal epitope) and an antibody (03A2) raised against an Nterminal Dpl 27–38 peptide (Fig. 1A). Both brains and testis examined with E6977 showed a profile with two prominent species of ~ 20–22 kDa and ~ 14 kDa, with only the 20–22-kDa signal being recognized with 03A2. This indicates that the larger ~ 20–22-kDa band is full-length Dpl, and the smaller ~ 14-kDa species is a C-terminal fragment derived from endoproteolytic processing in which at least residues 27–38 (i.e. the epitope for the 03A2 monospecific antiserum) have been removed. Interestingly, the larger immunoreactive species inferred to be derived from full-length Dpl can be 863

C. E. Mays et al.

Endoproteolysis of Shadoo and Doppel

TgDpl10329

A

03A2

E6977

Brain PNGase F

+

+

Testis +

+

+

Brain +

+

+

Testis +

+

+

+

36 22 16 6

Percentage of total signal (Densitometric units)

B

100 90 80 70 60 50 40 30 20 10 0

FL C1

Brain

Testis

FVB/N Testis

C

03A2

E6977

PNGase F

S

P

S

P

S

P

–

–

+

+

+

+

male reproductive tract, and/or that degradation of the C-terminal fragment is impaired in this tissue. Next, these Dpl species were further examined with membrane extraction in alkaline diethylamine (DEA) buffer, a technique that has previously proven useful in discriminating nonintegral forms of the amyloid precursor protein and localizing Sho to the cellular membrane in vivo [16]. As shown in Fig. 1C, the majority of full-length Dpl and the majority of its Cterminal fragment were found in the pellet fraction, implying that both forms are associated with cellular membranes. To obtain insights into shared metabolic processes, we decided to locate the endoproteolytic site responsible for the generation of this newly confirmed C-terminal Dpl fragment, as well as a potentially analogous but unmapped C-terminal fragment that we recently described for Sho [14,17]. For this purpose, we chose to use neuronal and non-neuronal cell lines: N2a neuroblastoma and RK13 rabbit kidney cells, respectively. Both of these are widely utilized as models for prion disease [53]. Endoproteolysis for Dpl

64 50 36 22 16

FL Dpl

6

Dpl C1

Fig. 1. Dpl cleaved in vivo. (A) Dpl cleavage in the brains and testis from three different TgDpl10329 mice was determined by antibody mapping with E6977 (recognizing an epitope in the globular domain) and 03A2 (epitope 27–38). Arrows indicate full-length (FL) Dpl (black arrow with a gray center) and its C1 fragment (solid black arrow). (B) Densitometric analysis was conducted to compare the ratio of FL Dpl to C1 (n = 3). To compare the brain with the testis, only the top 22-kDa species found in the testis was measured by densitometry. (C) DEA extraction was employed to separate secreted Dpl, as seen in the supernatants (S), from the membrane-associated form that remains in the pellet fraction (P). FL and C1 Dpl are indicated by arrows as described above.

resolved into a doublet in which the lower portion is more pronounced in the protein expressed in the testis (albeit for reasons yet unknown). Overall, densitometric analysis of these blotting data demonstrated that the amount of the Dpl ~ 14-kDa fragment is 31.4  1.4% of that of full-length Dpl in brain samples versus 68.2  0.3% in the testis (Fig. 1B). This finding may indicate a functional requirement for production of the ~ 14-kDa fragment in the testis, perhaps by an endoprotease that is more abundant in the 864

The NMR structure of Dpl was ascertained from a Dpl 26–157 construct made in Escherichia coli, and showed a three-helix bundle globular domain commencing at Arg51 [19]. The data in Fig. 1 led us to infer that a Dpl ‘N1’ fragment would be considerably smaller than the N1 fragments of Sho and PrP. With this in mind, and also with an interest in positioning the cleavage sites for the signal peptide, we created a panel of Dpl mutants by inserting the FLAG sequence DYKDDDDK (this FLAG sequence can be recognized by mAbs against determinants including a free amine group on the N-terminal Asp, or against a linear epitope as embodied by the ‘M1’ and ‘M2’ antibodies, respectively). Here, FLAG-tags were inserted at different positions in a region of interest between the mature N-terminus and the first a-helix starting at residue 73: the insertions were between codons 25 and 26, 26 and 27, 39 and 40, 49 and 50, 57 and 58, and 68 and 69 (Fig. 2A). After PNGase F deglycosylation of lysates from N2a and RK13 cells, a banding profile ranging from 14 to 20 kDa was observed for wild-type Dpl that was reminiscent of the in vivo samples, and showed similar reactivity to E6977 and 03A2 (Fig. 2). Following G418 selection for transfected N2a cells, Dpl containing the FLAG epitope between codons 26 and 27 showed robust expression similar to that of protein lacking the tag, whereas positioning the FLAG epitope between codons 25 and 26 resulted in a much FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

C. E. Mays et al.

Endoproteolysis of Shadoo and Doppel

weaker signal (Fig. S1). This implies that wild-type mature mouse Dpl commences at residue 27, and provides insights into the discrepancies between bioinformatic predictions and the varying start sites of expression constructs deployed in different laboratories [18,52,54,55].

A

E6977 27

40

50

58

69

155

Dpl

03A2

M2 M2

B

N2a

RK13

36 22 16

α-FLAG M2 ** **

36 22 16

03A2 ** **

36 22 16

E6977 @

Dpl C2 Dpl C1 Dpl C1 + FLAG

Fig. 2. FLAG-tags to map Dpl endoproteolytic cleavage sites. (A) Positioning of FLAG-tags (gray boxes) within the panel of Dpl mutants utilized, and approximate positions of epitopes available for polyclonal antibodies against Dpl (E6977 and 03A2), and mAb against FLAG (M2). Arrows indicate the Dpl C1 fragments recognized (black arrow with a tail) and not recognized (solid black arrow) by M2. A notional N-terminal Dpl fragment generated as a reciprocal product of this cleavage is represented by a dotted box. (B) For biochemical characterization of the cleavage site, N2a cells (left panels) and RK13 (right panels) were transiently transfected with constructs encoding wild-type (WT) Dpl or Dpl with FLAG-tag insertions between codons 26 and 27, 39 and 40, 49 and 50, 57 and 58, and 68 and 69. As a negative control, transfection was also conducted with an empty vector (EV). Membranes were probed with M2 (top panel), 03A2 (middle panel), or E6977 (composite pictures in bottom panel). Arrows indicate differences in molecular mass for Dpl C1 fragments owing to the presence (black arrow with a tail) or absence (solid black arrow) of the FLAGtag and Dpl C2 fragments (solid gray arrow). The double asterisk (**) and @ sign indicate larger and smaller than normal species recognized for FLAG 58 and/or FLAG 69 constructs in RK13 cells, respectively.

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

Deglycosylated samples for Dpl–FLAG 27, 40 and 50 constructs (Fig. 2A) showed reduced electrophoretic mobility for the full-length species, which was calculated to be ~ 3 kDa larger than the 20-kDa full-length wild-type Dpl (Fig. 2B; predicted mass increase of ~ 1013 Da). This effect led to a greater ability to resolve C-terminal fragments detected by E6977. For Dpl–FLAG 27, two C-terminal species were visible: C1-like and C2-like. Movement of the FLAG-tag between residues 39 and 40 resulted in the C-terminal fragment of Dpl–FLAG 40 being reduced to a single band with a molecular mass equivalent to that of the lower C1 band for Dpl–FLAG 27. In contrast to all other FLAG-tagged constructs, a C-terminal fragment was absent for Dpl–FLAG 50, which appeared to be compensated for by a more intense signal for the fulllength protein. Finally, Dpl–FLAG 58 and Dpl– FLAG 69 often behaved in a similar manner. Both generated an ~ 16-kDa fragment with M2 that was seen in addition to the full-length species seen with this and other contructs. This was also seen with E6977, but not with 03A2, indicating that the FLAG moiety was now positioned on the C-terminal side of the C1 cleavage site. Notably, the expression of Dpl– FLAG 58 and Dpl–FLAG 69 showed a further phenomenon, whereby ‘larger’ full-length species (i.e. with lower electrophoretic mobility) were detected with M2 and 03A2 (Fig. 2B). These data imply inefficient signal peptidase cleavage of the nascent Dpl protein, but probing with a Dpl anti-signal peptide serum would be required to verify this interpretation. Overall, from epitope mapping of Dpl processing, we infer that the predominant endoproteolysis events for mature Dpl in transfected cells occur after residue 40, a finding that is consistent with the behavior of Dpl–green fluorescent protein (GFP) and Dpl–yellow fluorescent protein (YFP) fusion proteins with insertion of the fluorescent protein moiety between residues 40 and 41 (Fig. S2). Cleavage events for Dpl are blocked by a FLAG-tag inserted at residue 50 but are not blocked by FLAG-tags at positions 58 and 69, which produce C-terminal fragments that can be detected with M2. This major cleavage site lies in the vicinity of the start of the globular domain defined by solution NMR at Arg51. This inference was tested by MS analysis of immunoprecipitated Dpl–FLAG 27 expressed in N2a cells [44]. In apparent concordance with the genetic mapping data, the analysis of tryptic digests of Dpl–FLAG 27 by electrospray tandem MS identified nontryptic cleavages after the peptide bond at Ala50 [one collision-induced dissociation (CID) spectrum, 80% confidence] and after Phe60 (three separate CID spectra assigned with 99%, 93% and 85% 865

C. E. Mays et al.

Endoproteolysis of Shadoo and Doppel

confidence). Secondary ‘C2-like’ cleavage for Dpl was also less apparent when we mapped endoproteolysis sites by deletion, and was less pronounced than C2 cleavage of Sho (Fig. 3B). In part, this observation may reflect a difficulty in assigning the Dpl C2 fragment, because the increase in size deriving from the FLAG-tag made this fragment similar in mobility to the full-length Dpl construct FLAG-tagged at residue 27. Nonetheless, taken together, the available data are consistent with a model whereby Dpl C2 and C1 cleavages occur after residues 50 and 60, respectively. The distance between these cleavage sites and the

beginning of the structured domain (23 and 13 residues, respectively, to the beginning of helix 1) is foreshortened with respect to the prototype of PrP (54 and 33 residues, respectively) [2]. Finally and parenthetically, whereas examination of our panel of insertional mutations revealed that the predominant Dpl species bands seen in N2a and RK13 cells were generally similar (Fig. 2B), Dpl–FLAG 40 and, to a lesser extent, Dpl–FLAG 27 produced species larger than full-length in RK13 cells, an observation that we provisionally attribute to incomplete removal of the signal peptide in this cell line.

A

B

N2a

C

PNGase F 16 6

866

RK13 FLAG 26

FLAG 26

+

+

+

+

+

+ α-Myc

Sho C2 (also **) Sho C1 (also *)

Fig. 3. Deletion mutants used to determine the position of endoproteolysis of Sho. (A) The panel of Sho contructs utilized. A FLAG-tag was inserted between residues 25 and 26 (FLAG 26) in its undisrupted form (full-length, FL) as well in a variety of mutants: replacement of residues 86–100 with the Myc sequence (Myc R86–100); and deletions spanning residues 30–61 (Δ30–61), 62–77 (Δ62–77), 78–86 (Δ78–86), 78–100 (Δ78–100), or 101–120 (Δ100–120). The hydrophobic domain (HD), signal peptides (SP) and repeat regions are shown for each. (B, C) N2a (left panels) and RK13 (right panels) cells were transiently transfected with Sho constructs. Western blots were probed with antibody against FLAG (M2) (composite pictures in top panels), and antibodies against Sho (06Sh3a, composite pictures in middle panels; and 12Sh3, bottom panels) (B), or antibody against Myc (C). Lysate from nontransfected cells (NT) was used as a negative control. Arrows indicate differences in molecular mass for Sho C1 (solid black arrow) and C2 (solid gray arrow), and the single asterisk (*) and double asterisk (**) indicate C1 and C2 fragments affected by the mutations, respectively. CHO, glycosylation site.

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

C. E. Mays et al.

C1 endoproteolysis of Sho and Sho/PrP chimeric proteins We next set out to identify the position of the endoproteolytic site responsible for the generation of metabolically stable N-terminal and C-terminal fragments that can be detected for Sho in the adult central nervous system [14,17]. Recombinant Sho protein has a random coil signature in vitro [17,43,56]. As there were no predictions for secondary and tertiary structures that might guide endoproteolysis in vivo, we did not preselect a defined interval, but instead pursued an ‘end-to-end’ genetic mapping strategy to map the origin of Sho C-terminal fragments [14,17]. As indicated by predictive algorithms (Fig. S3) [57], transient expression levels for Sho–FLAG 26 [with AK|DYKDDDDKGGR introduced between residues 25 and 26 (K/G)] in N2a and RK13 cells proved superior to those of a parallel Sho–FLAG 25 construct [with A| DYKDDDDKKGGR introduced between residues 24 and 25 (A/K)] (Fig. S4). Because of its higher expression level, Sho–FLAG 26 was used as the foundation for studying a series of internal deletions (Fig. 3A). Residues 26–29 were excluded from the deletion series, because analogous studies for PrP have indicated that this initial charged region is required for accurate biogenesis [58]. Probing the deletion series of constructs with C-terminal Sho antisera (or antibodies against c-Myc, as applicable) revealed interesting and complex relationships between the domain structure of the Sho holoprotein molecules, the yield of at least two types of alternative proteolytic products, and the likely position(s) of the proteolysis sites within Sho. Our initial focus was on determinants for formation of the abundant C-terminal fragment denoted here as Sho C1. Deletion interval 1 (D30–61) (Fig. 3B) resulted in an increase in mobility for the putative fulllength protein, whereas C1 was unaltered in this regard. This situation was predicted, as the N-terminal deletion was not expected to invade the boundaries anticipated for the C-terminal C1 fragment. Neither deletion 2 (D62–77) nor deletion 3 (D78–86) caused a change in the gel mobility of the lowest C-terminal fragment C1 (apparent molecular mass of 8.6 kDa) or a perceptible alteration in the size of the full-length protein. A greater than full-length fragment was seen for the D78–86 construct expressed in RK13 cells. As the fourth deletion interval removes the 06Sh3a epitope, we assembled a sixth construct, Myc R86, wherein Sho residues 86–100 (RRTSGPGELGLEDDE) were replaced with the c-Myc epitope-tag sequence EQKLISEEDL. Myc R86 yielded increased mobility for both the full-length protein and its C1

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

Endoproteolysis of Shadoo and Doppel

fragment (~ 5.5 kDa), which was detected with an antibody against Myc in N2a cells but not RK13 cells (Fig. 3C). The construct with the fifth deletion interval, D101–120, was expressed at a lower level than the other constructs, perhaps because of removal of the Nlinked glycosylation site at residue 107 (Fig. 3B) [21,22]. Here, both the full-length protein and C1 were reduced in size by ~ 1.5 kDa relative to the parental construct. Central region cleavage of PrP results in the corresponding N-terminal fragments denoted N1 and N2, so we sought analogous products for Sho. Although these fragments were not sufficiently abundant for detection in acetone-precipitated conditioned medium, we investigated western-blotted cell lysates by extended exposure, based on the finding that an abundant Sho N-terminal fragment derived from central nervous system expression is membrane-associated [14]. Analyses with an antibody against FLAG revealed that four constructs engendered an ~ 5–6-kDa species (Fig. S4C). Whereas the absence of this fragment in the D30–61 construct can be attributed to the N-terminal deletion interval (i.e. by reducing the net size to a mass not resolved by this gel system), it is noteworthy that we were unable to detect an N1 species in cells expressing Sho D78–100. From the overall genetic mapping data, we conclude that Sho does not have a single site-specific determinant for C1 cleavage that applies when expression is considered in both N2a and RK13 cells. This conclusion is also compatible with the behavior of natural hydrophobic domain polymorphisms in the ovine gene [59]. In an orthogonal approach, we analyzed tryptic peptides from full-length Sho labeled with a FLAGtag at residue 26 [44]. Here, we obtained weak evidence (based on two separate CID spectra) for cleavage of Sho after the Leu at position 80 (i.e. at the end of sequence GVAAGL, which contains the last GxxxG repeat of the hydrophobic domain). In summary, Sho shows some resilience against the blockade of a-cleavage, which is analogous to the small effect that many different deletions and point mutations within PrPC have on the production of its C1 fragment [5,60]. However, unlike in PrP, the predominant C1 cleavage occurs after – not before – the hydrophobic domain, and, at least in RK13 cells, this cleavage event is modulated by adjacent C-terminal sequences. Given the aforementioned observation that the acleavage site for PrP is tolerant to sequence variations [5], we inserted mouse PrP residues 95–110 (encompassing this site) N-terminal to the hydrophobic domain in Sho, which is structurally analogous to its location in PrP (Fig. 4A). The chimeric molecule was

867

C. E. Mays et al.

Endoproteolysis of Shadoo and Doppel

α-Sho 06Sh1

A

RGx repeats

α-Sho 12Sh3

CHO

Gxxx repeats

R, P, S-rich

SP

25

120 PrP HNQWNKPSKPKTNLKH 95 110

B

PNGase F

–

+

–

+

–

+

36

α-Sho 06Sh1

22 16 6

*

*

*

FL Glycosylated protein

*

36

FL Deglycosylated Chimera

α-Sho 12Sh3

FL Deglycosylated Sho N1 Sho Site (also *)

22 16 6

N1 PrP Site C1 PrP Site C1 Sho Site

Fig. 4. Endoproteolysis of a mosaic Sho protein. (A) Diagram of the Sho chimeric protein showing the insertion site for PrP residues 95–110 and the epitopes for the antibodies against Sho utilized. CHO, glycosylation site; SP, signal peptides. (B) RK13 cells transiently transfected with an empty vector (EV), pBud.GFP encoding wild-type (WT) Sho, or pBud.GFP encoding chimeric Sho (Sho + PrP 95–110) were lysed and compared with (+) or without (–) PNGase F treatment by western blotting with antibodies against Sho (Sh1, top panel; or 12Sh3, bottom panel). Markings: white arrow, full-length (FL) glycosylated Sho; gray arrow with a black center, FL deglycosylated chimera; black arrow with a gray center, FL deglycosylated Sho; gray arrow with a tail/single asterisks, N-terminal fragment generated from a-cleavage at the Sho site; black stick arrow with a tail, N-terminal fragment resulting from a-cleavage at the PrP site; checkered arrow, C-terminal fragment generated from a-cleavage at the PrP site; solid black arrow, C-terminal fragment resulting from a-cleavage at the Sho site.

successfully expressed in RK13 cells, and could be detected by both anti-Sho 06Sh1 (epitope 30–60) and anti-Sho 12Sh3 (epitope 86–100) (Fig. 4B). In addition to a small molecular mass difference between the deglycosylated full-length wild-type and chimeric proteins, there was a second N-terminal fragment present for the Sho chimeric protein with a size difference of ~ 2 kDa. We infer here that the larger of the two N-terminal fragments results from processing at the native Sho a-cleavage site located C-terminal to the hydrophobic domain, whereas the smaller N-terminal fragment is the product generated from a-cleavage between PrP residues 109 and 110. The inclusion of PrP residues 95–109 along with Sho residues 25–62 gives the ‘smaller’ fragment an equivalent molecular mass to the N-terminal fragment generated from wildtype Sho. Concomitantly, the molecular mass of Sho C1 generated from native a-cleavage remained unchanged between the wild-type and the chimeric 868

proteins, whereas an additional C-terminal fragment of higher molecular mass was observed for the Sho chimeric protein, owing to a-cleavage within PrP sequences, and perhaps between PrP residues 109 and 110, as in their native context. Therefore, the behavior of the Sho chimeric protein supports the idea that the main a-cleavage site for wild-type Sho is located C-terminal to the hydrophobic domain. C2 proteolyis of Sho Some expression constructs derived from wild-type Sho or deletion derivatives engendered a more slowly migrating 9.6-kDa C-terminal species denoted C2 (Fig. 3B) in addition to C1. This raises questions regarding the coordinates of this fragment and possible relationships with the genesis of C1. However, for technical reasons, C2 was not amenable for the study of all Sho deletion interval plasmids; thus, the closely FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

C. E. Mays et al.

adjacent full-length fragment complicated the detection of C2 in cells transfected with the D30–61 construct. In the case of the D78–100 deletion interval, the C-terminal epitopes detected by 06Sh3a and 12Sh3 are removed. The c-Myc-tagged construct yielded only a single C-terminal fragment in N2a cells and no fragment in RK13 cells, but signals from this construct– antibody permutation were weaker than for other cases (Fig. 3C). The remaining three deletions were informative. For deletion intervals 2 and 3 (D62–77 and D78–86), C2 was neither altered in abundance or altered in mobility, as in the case of C1. When residues 101–120 were deleted, the second C-terminal fragment was detected with 12Sh3 and was reduced in size along with C1 (Fig. 3B). These data indicate that patterns in the genesis of Sho C1 and C2 track together, and it is conceivable that they are formed by a common mechanism (for example, a hypothetical C1 protease may cut inefficiently at the adjacent C2 site).

Endoproteolysis of Shadoo and Doppel

A

WT

PNGase F

–

N99Q –

–

+

+

–

N111Q

WT –

–

–

–

–

WT –

–

N99Q N111Q –

–

50 36 22 16 6

B PNGase F 50 36

C

+

22 16

Dpl C2

6

Dpl C1

100 90

FL C1 + C2

Involvement of glycosylation in endoproteolysis N-glycosylation has been confirmed to occur at residues 181 and 197 for PrPC, and has been predicted, but not verified, to occur at residues 99 and 111 for Dpl and at residue 107 for Sho [17,18,21,22]. Although we are unaware of any reports linking glycosylation to altered production of PrP C1 and C2, prior studies have discussed the diversity in the banding pattern in Dpl (which we discovered here to be C-terminal fragments) in terms of complex glycosylation [41,42,61]. To validate these carbohydrate attachment sites and evaluate their potential influence on both Dpl and Sho endoproteolysis, we created constructs to disrupt the addition of glycans by introducing Asn to Gln missense mutations. Glycosylation and endoproteolysis of Dpl Samples from N2a cells stably expressing each singlemutation (N99Q or N111Q) Dpl construct resulted in the reduction of the 34-kDa band for the fully glycosylated Dpl to an enriched 20-kDa band that corresponded to the calculated and previously observed mass for the monoglycosylated intermediate (Fig. 5A) [18]. Furthermore, enzymatic deglycosylation by PNGase F treatment showed that the unglycosylated form of the single Asn mutants exhibited a similar profile to that of wild-type Dpl (Fig. 5B). Stable expression of the double mutant severely reduced the mass to a single ~ 14-kDa species consistent with the calculated size of the unglycosylated form (Fig. 5A). Indeed, disruption of glycosylation with these mutations was associated with a > 50% reduction in the amounts of the CFEBS Journal 281 (2014) 862–876 ª 2013 FEBS

Percentage of total signal (Densitometric units)

80 70 60 50 40 30 20 10 0 WT

N99Q

N111Q

Fig. 5. Glycosylation profile for Dpl in N2a cells. (A) Glycosylation of Dpl was examined with antibody against Dpl (E6977) in N2a cells stably transfected with wild-type (WT) Dpl, N99Q Dpl, N111Q Dpl, and N99Q/N111Q Dpl. (B) Comparison of PNGase F deglycosylation profiles (C1 fragment, solid black arrow; C2 fragment, solid gray arrow) for wild-type Dpl, N99Q Dpl, and N111Q Dpl. (C) The ratio of full-length (FL) Dpl and its processed fragments (C1 + C2) were determined by densitometry of western blots (WT, n = 3; N99Q, n = 4; N111Q, n = 4).

terminal fragments (percentages of processed Dpl: wild type, 70.8  2.2%; N99Q, 11.3  1.3%; N111Q, 17.7  1.7%) (Fig. 5C). Glycosylation and endoproteolysis of Sho Expression of the N107Q Sho mutant in N2a cells was found to be insensitive to digestion with PNGase F, and it also migrated with the same ~ 16-kDa molecular mass as deglycosylated wild-type Sho (Fig. 6A). Analysis with 06Sh3a showed that generation of the processed 8.6-kDa (C1) and 9.6-kDa (C2) C-terminal fragments was attenuated in the absence of glycosylation. The percentages of the total amount of 869

C. E. Mays et al.

Endoproteolysis of Shadoo and Doppel

06Sh1

A

PNGase F 36

–

06Sh3a

–

–

+

–

+

22 16

factor for PrPSc propagation that influences both prion strain characteristics and targeting [62–64], with glycoform-selective prion formation in human prion diseases being the most recent example [65]. This indirectly suggests the possibility that defective glycosylation occurs in response to the accumulation of reactive oxygen species, which have, in turn, been suggested to underlie the formation of PrP C2 during prion disease [66].

6 FL Glycosylated Sho FL Deglycosylated Sho Sho C2 Sho C1

B

100 90

FL C1 + C2

Percentage of total signal (Densitometric units)

80 70 60 50 40 30 20 10 0 WT

N107Q

Fig. 6. Relationship between glycosylation of Sho and endoproteolysis. (A) PNGase F-treated and untreated lysates from N2a cells expressing wild-type Sho and N107Q Sho were analyzed with antibodies against the Sho N-terminus or C-terminus (06Sh1 and 06Sh3a, respectively). Arrows indicate full-length (FL) glycosylated Sho (white arrow), FL unglycosylated Sho (black arrow with a gray center), and the C-terminal fragments (C1, solid black arrow; C2, solid gray arrow). (B) Densitometric analysis was utilized to determine the ratio of FL Sho and its processed forms (C1 + C2; WT, n = 8; N107Q, n = 2).

processed Sho (i.e. C1 + C2) were 72.3  2.4% for wild-type Sho and 23.6  2.3% for N107Q Sho (Fig. 6B), and in this regard the behavior was similar to that noted for glycosylation-deficient variants of Dpl above (Fig. 5B). Collectively, our results extend previous work [18,21,22] by confirming that N-glycosylation occurs at residue 107 for Sho and at residues 99 and 111 for Dpl. More interestingly, lack of glycosylation at these sites has a negative effect on endoproteolysis for both Sho and Dpl. We note that N-glycosylation of PrP has been considered by some research groups as a modulating 870

Conclusions PrP undergoes C1 cleavage before the hydrophobic domain preceding its globular domain, and C2 cleavage near or within the last octarepeat. Prompted by proteomic data suggesting similar membrane environments [44], we assessed cleavage events for the PrP-like Dpl and Sho proteins, and defined two new C-terminal fragments present in both in vitro and in vivo analyses (Fig. 7). For Dpl, C1-like cleavage occured near the start of the globular domain defined by NMR analysis of recombinant protein at pH 5.2 [19]. This site was mapped genetically (by scanning with FLAG-tag insertions and using GFP and YFP fusion proteins) to an interval between residues 40 and 58, and biochemically (by MS) to tryptic peptides ending at residue 60. C-terminal Dpl fragments were found at higher levels in the testis than in the brain, suggesting a physiological role for the processed C1 fragment. In the case of Sho, C1 cleavage occurred at the C-terminal end of the hydrophobic domain, and the N1 cleavage product was associated with membrane fractions in cells (Fig. S4C) and in the brain [14]. This may indicate that Sho N1 has the ability to act as a cellular raft-targeting determinant, as previously shown for PrP [67]. Moreover, as Sho N1 includes the hydrophobic domain (unlike PrP), the hydrophobicity intrinsic to the (GAAA)n repeats within this fragment may accentuate or account for this property. Returning to the cleavage events themselves, processing of PrP at mouse residues 109 and 110 is partially analogous to the nonamyloid pathway for the a-cleavage of the amyloid precursor protein, in that it can preclude the formation of PrPSc [8,68,69], a pathogenesisassociated molecule that, in turn, is characterized by a protease-resistant core starting in the vicinity of residue 90. Interestingly, as with PrP [5], extensive mutagenesis of Sho revealed resilience to blocking of this event (Fig. 3). Unlike that of C1, C2 cleavage of PrP Nterminal to residue 90 is ‘permissive’ for PrPSc formation, and interest in this event is heightened by the finding that a protease-sensitive form of PrP accumulates in prion-infected brains and might be ‘on pathway’ for PrPSc formation [70]. Hence, the identitity of neuronal C1 PrPase and the relationship/balance with C2 PrPase FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

C. E. Mays et al.

Endoproteolysis of Shadoo and Doppel

PrP

CHO N181 ++ ++

HD

α1

β1

β2

α2

OR

23

CHO N197

GPI α3 231

S–S

Doppel

CHO N99 ++ ++

β1

α1

β2

27

CHO N111

GPI

α2

α3 S–S

157

S–S

Shadoo

CHO N107

GPI

HD 25 R/G

C2 Cleavage C1 Cleavage

122

Fig. 7. Comparison of endoproteolytic events for PrP, Dpl, and Sho. Endoproteolytic events for the PrP superfamily according to data generated from our mutant alleles and MS for Dpl and Sho are represented by black-filled and gray-filled lightning bolts for C1 and C2 cleavage, respectively (also known as a-cleavage and b-cleavage, respectively). MS identified nontryptic cleavages for Dpl after the peptide bond at Ala50 (possibly corresponding to C2 cleavage) and after Phe60 (C1 cleavage), as well as after Leu80 (C1 cleavage) for Sho. The estimated position for Sho C2 cleavage is tentative and based on the electrophoretic mobility alone. +, charged N-terminal region; OR, octapeptide repeat; R/G, tetrarepeats rich in Arg and Gly; HD, hydrophobic domain; S–S, disulfide bridge; CHO, glycosylation site; a1, a2 and a3 are a-helices numbered as they appear from the N-terminus; b1 and b2 are the two short b-strands numbered as they appear from the N-terminus.

could be of great importance. Although C1 and C2 cleavage events were originally attributed to ADAM proteases [3,71,72] – and although ADAM8 may certainly be a relevant PrPase in muscle cells [51] – other groups have challenged this concept [9,11,12,73,74], and our own studies applying short hairpin RNA and overexpression to the Dpl-expressing, Sho-expressing and PrPC-expressing cell lines have failed to implicate ADAM9 or ADAM10 in these cleavage events (not shown). Although our data show that N-glycosylation events can aid endoproteolysis, the identities of the C1 and C2 protease(s) remain open. The ability to ‘triangulate’ from the behavior of Dpl and Sho substrates may provide an answer to this important problem.

Experimental procedures Plasmid generation To create constructs for Dpl fusion proteins, GFP and YFP cDNA was obtained by digesting pEGFP–N1 and pEYFP–N1 (Clontech Laboratories, Mountain View, CA, USA) with the AgeI and BsrGI restriction enzymes (New England Biolabs, Whitby, ON, Canada). The Rapid DNA Ligation Kit (Roche, Laval, QC, Canada) was used to insert the GFP or YFP cDNA between wild-type Dpl codons 40 and 41 within the pcDNA3.Dpl construct that had been linearized via digestion with the PpuMI restric-

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

tion enzyme (New England Biolabs). All other mutations, insertions and deletions for pcDNA3.0 plasmids containing wild-type Dpl, wild-type Sho and Sho containing a FLAGtag (5′-GATTACAAGGATGACGACGATAAG-3′) after residue 25 were constructed with the QuickChange sitedirected mutagenesis kit (Agilent Technologies, Mississauga), as directed in the manual. Oligonucleotide primers (omitted for the sake of brevity) were designed with the QuickChange primer design tool to generate Dpl point mutants (N99Q, N111Q, C95A, and C148A), Dpl FLAGtag insertional mutants (following residues 25, 26, 39, 49, 57, and 68), Sho FLAG-tag insertional mutants (following residues 24 and 25), and deletions or insertions in Sho– FLAG 26 [deletion of residues 30–61, 62–77, 78–86, 78–100, and 101–120; replacement of residues 98–104 with FLQPSKL; and replacement of residues 86–100 with a Myc-tag (5′-GAGCAGAAACTCATCTCTGAAGAGGAT CTG-3′)]. To create the Sho chimera, a cDNA encoding wild-type Sho with the an insertion between codons 62 and 63 (5′CATAATCAGTGGAACAAGCCCAGCAAACCAAAAA CCAACCTCAAGCAT-3′) was synthesized commercially (Genscript, Piscataway, NJ, USA). This corresponds to mouse PrP residues 95–110. This cDNA was transferred from the pUC57 vector into the pBud.GFP vector by digestion with HindIII and XbaI (New England Biolabs), agarose gel extraction and purification (Qiagen, Mississauga, ON, Canada), and overnight ligation with T4 DNA ligase (New England Biolabs).

871

C. E. Mays et al.

Endoproteolysis of Shadoo and Doppel

Cell culture and transfection N2a neuroblastoma and RK13 rabbit kidney cells were cultured at 37 °C in a humidified incubator under 5% CO2 in DMEM containing 10% fetal bovine serum and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA). At ~ 60– 90% confluence, cells were transfected with 1–5 lg of the desired expression plasmid vector by the use of Lipofectamine Plus reagent (Invitrogen), according to the manufacturer’s specifications. For the creation of stable Dpl-expressing or Sho-expressing cells, N2a cells were transfected with pcDNA3.0 containing wild-type Dpl or Sho sequences and selected for ~ 1 week in medium containing 800 lg
mL 1 geneticin (G418; Life Technologies, Burlington, ON, Canada). After 24–48 h, transiently transfected cells were harvested in RIPA buffer or cell lysis buffer [either 50 mM Tris, pH 7.5, 0.5% Triton X-100, and 0.5% sodium deoxycholate; or 1 9 NaCl/Pi, 1% Nonidet P-40 (Amresco, Solon, OH, USA), 0.5% sodium deoxycholate, and 0.1% SDS] containing Complete Protease Inhibitor (Roche Diagnostics). Samples were briefly centrifuged at 18 000 g, and the resulting supernatant was stored at or below – 30 °C. Analysis of shed protein in the medium was performed as previously described, with minor modifications [43]. Briefly, all of the medium was collected and immediately precleared by centrifugation (5000 g, 20 min, 10 °C) to avoid contributions from membrane-associated protein. A fourfold volume of acetone was added to the medium supernatants, and they were stored at 30 °C overnight. Precipitated medium was centrifuged (20 800 g, 60 min, 4 °C), and pellets were resuspended in cell lysis buffer containing complete protease inhibitor so that they could be normalized with bicinchoninic acid (Pierce, Rockford, IL, USA) for western blot analysis as described below.

samples were separated by reversed-phase chromatography. Column eluates were transferred through an online capillary to a quadrupole time-of-flight mass spectrometer, and ionized by electrospray in a micro-ion spray source. Information-dependent acquisitions of CID spectra (4 s of accumulation time, m/z 55–1400) targeted the 10 most intense peaks detected within parent mass spectra (1 s of accumulation time, m/z 300–1800). Postacquisition detection of nontryptic cleavage sites and assignment of confidence values were performed with the software package PROTEINPILOT (Version 4.0; AB Sciex, Concord, ON, Canada). In searches, up to one missed cleavage and charge states ranging from + 2 to + 4 were considered.

Transgenic mouse lines All animal protocols were in accordance with the Canadian Council on Animal Care, and were approved by the Institutional Animal Care and Use Committees at the University of Alberta. Transgenic mice and their nontransgenic littermates have been previously described for the Tg(Dpl)10329 [13] and TgSprn24551 [16] lines. Testis samples were obtained from wild-type FVB/NJ mice that were aged ~ 100 days. For the collection of the brain or testis, mice were killed by cervical dislocation. Tissue was immediately frozen, and later homogenized 10% w/v in NaCl/Pi or DEA buffer (50 mM NaCl and 0.2% DEA) by serial passage through needles. As previously described [16], homogenate intended for DEA extraction was subsequently ultracentrifuged at 100 000 g for 1 h at 4 °C (Optima MAX; Beckman, Fullerton, CA, USA). Supernatants were neutralized with 0.5 M Tris/HCl (pH 6.8), and pellets were resuspended in buffer containing 50 mM Tris (pH 7.5), 0.5% sodium deoxycholate, and 0.5% Triton X-100.

MS N2a cells stably expressing Dpl–FLAG 27 or Sho–FLAG 26 were lysed in 50 mM Tris (pH 8.0), 1 9 Complete Protease Inhibitor Cocktail (Roche), 0.5% NP-40, and 0.5% sodium deoxycholate. Cellular debris was removed by centrifugation at 5800 g for 1 min, and FLAG-tagged proteins were captured on anti-FLAG agarose (Sigma-Aldrich, St Louis, MO, USA). Following extensive salt washes, proteins were eluted with the pH-drop method in the presence of 0.2% trifluoroacetic acid and 20% acetonitrile. Subsequently, eluate fractions were concentrated by speed vacuum concentration, denatured in the presence of 6 M urea, reduced with 1 mM tris-(2-carboxyethyl)-phosphine, and alkylated with 2.5 mM 4-vinylpyridine. Before digestion with L-1-tosylamido-2-phenylethyl chloromethyl ketone-treated porcine trypsin, samples were diluted in deionized water to reduce the concentration of urea to < 2 M, which is known to be conducive to trypsin digestion. Subsequently, salts and urea were removed from tryptic digests by ZipTip purification, and

872

DEA extraction for animal tissue DEA extraction of Dpl and Sho from mouse brain or testis was performed with a previously described method [16]. Briefly, tissue was homogenized 10% w/v in DEA buffer (50 mM NaCl and 0.2% DEA), and ultracentrifuged at 100 000 g for 1 h at 4 °C (Optima MAX; Beckman). Supernatants were neutralized with 0.5 M Tris/HCl (pH 6.8), and pellets were resuspended in buffer containing 50 mM Tris (pH 7.5), 0.5% sodium deoxycholate, and 0.5% Triton X-100.

Western blotting Protein concentrations of the samples were quantified with the bicinchoninic acid method (Pierce). Then, 20–50 lg of protein was either deglycosylated overnight at 37 °C with 250–500 U of PNGase F (New England Biolabs) and resus-

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

C. E. Mays et al.

pended in gel-loading buffer (0.6 M Tris, pH 6.8, 2% SDS, 7.5% glycerol, 0.005% bromophenol blue, 2.5% b-mercaptoethanol), or directly mixed with gel-loading buffer, boiled for ~ 10 min, and electrophoresed through 12% or 14% Tris/ glycine SDS/PAGE gels. Proteins were transferred onto a nitrocellulose (Schleicher & Schuell, Keene, NH, USA) or poly(vinylidene difluoride) (Immobilon-FL; Millipore, Billerica, MA, USA) membrane. Then, blots were incubated with the following primary antibodies: antibodies against Dpl (E6977, epitope 27–155 [13]; or 03A2, epitope 27–38 [75]), antibodies against Sho (06rSh1, epitope 30–61; or 06Sh3a, epitope 86–100 [17]), antibodies against FLAG [M1 (SigmaAldrich); or M2 (Stratagene, La Jolla, CA, USA)], and antibody against PrP [SHA31 (Medicorp, Montreal, QC, Canada)]. Each blot was subsequently incubated with the appropriate horseradish peroxidase-conjugated secondary antibody. Blots were visualized by applying ECL Plus reagents (Pierce) and exposure to film. If necessary, reprobing was performed with primary antibody against actin (Sigma-Aldrich) and anti-rabbit IgG as secondary antibody, conjugated to horseradish peroxidase. IMAGEJ software was used for densitometry analysis of the images [76]. A new antibody against the Sho C-terminus, named 12Sh3, was also used. 12Sh3 was raised by immunization of Sho knockout mice [14] with recombinant glutathione Stransferase–Sho C-terminus fusion protein encompassing residues 81–122 (versus the previous 06Sh3a antiserum raised against a Sho 86–100 peptide). For this purpose, cDNA encoding GST–Sho 81–122 was inserted into the pGEX-KG expression vector, and expressed in BL21(DE3) pLysS cells, and the recombinant protein generated was purified by affinity chromatography with glutathione Sepharose 4B (GE Healthcare, Mississauga, ON, Canada). Mice received 50-lg primary immunizations intraperitoneally and subcutaneously in complete Freund’s adjuvant (Sigma), and boosters were administered in incomplete adjuvant. The serum was validated by western blotting against wild-type and Sprn knockout mouse brain homogenates.

Acknowledgements This work was supported by Canadian Institutes of Health Research operating grant MOP36377, the Canadian Foundation for Innovation, the Alberta Prion Research Institute, Alberta Innovates – Health Solutions (AI-HS) for C. E. Mays and R. C. C. Mercer, and the Alberta Heritage Foundation for Medical Research and AI-HS for D. Westaway (Scientist Award).

References 1 Prusiner SB (1998) Prions. Proc Natl Acad Sci USA 95, 13363–83.

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

Endoproteolysis of Shadoo and Doppel

2 Chen SG, Teplow D, Parchi P, Gambetti P & AutilioGambetti L (1995) Truncated forms of the human prion protein in normal brain and in prion diseases. J Biol Chem 270, 19173–80. 3 Jimenez-Huete A, Lievens PM, Vidal R, Piccardo P, Ghetti B, Tagliavini F, Frangione B & Prelli F (1998) Endogenous proteolytic cleavage of normal and diseaseassociated isoforms of the human prion protein in neural and non-neural tissues. Am J Pathol 153, 1561–72. 4 Mang
e A, B
eranger F, Peoc’h K, Onodera T, Frobert Y & Lehmann S (2004) Alpha- and beta-cleavages of the amino-terminus of the cellular prion protein. Biol Cell 96, 125–132. 5 Oliveira-Martins JB, Yusa S-I, Calella AM, Bridel C, Baumann F, Dametto P & Aguzzi A (2010) Unexpected tolerance of a-cleavage of the prion protein to sequence variations. PLoS ONE 5, e9107. 6 Flechsig E, Hegyi I, Leimeroth R, Zuniga A, Rossi D, Cozzio A, Schwarz P, Rulicke T, Gotz J, Aguzzi A et al. (2003) Expression of truncated PrP targeted to Purkinje cells of PrP knockout mice causes Purkinje cell death and ataxia. EMBO J 22, 3095–101. 7 Borchelt DR, Rogers M, Stahl N, Telling G & Prusiner SB (1993) Release of the cellular prion protein from cultured cells after loss of its glycoinositol phospholipid anchor. Glycobiology 3, 319–29. 8 Harris DA, Huber MT, van Dijken P, Shyng S-L, Chait BT & Wang R (1993) Processing of a cellular prion protein: identification of N- and C-terminal cleavage sites. Biochemistry 32, 1009–16. 9 Taylor DR, Parkin ET, Cocklin SL, Ault JR, Ashcroft AE, Turner AJ & Hooper NM (2009) Role of ADAMs in the ectodomain shedding and conformational conversion of the prion protein. J Biol Chem 284, 22590–600. 10 Tagliavini F, Prelli F, Porro M, Salmona M, Bugiani O & Frangione B (1992) A soluble form of prion protein in human cerebrospinal fluid: implications for prionrelated encephalopathies. Biochem Biophys Res Commun 184, 1398–404. 11 Endres K, Mitteregger G, Kojro E, Kretzschmar H & Fahrenholz F (2009) Influence of ADAM10 on prion protein processing and scrapie infectiosity in vivo. Neurobiol Dis 36, 233–41. 12 Altmeppen H, Prox J, Puig B, Kluth M, Bernreuther C, Thurm D, Jorissen E, Petrowitz B, Bartsch U, De Strooper B et al. (2011) Lack of a-disintegrin-andmetalloproteinase ADAM10 leads to intracellular accumulation and loss of shedding of the cellular prion protein in vivo. Mol Neurodegener 6, 36. 13 Moore R, Mastrangelo P, Bouzamondo E, Heinrich C, Legname G, Prusiner SB, Hood L, Westaway D, DeArmond S & Tremblay P (2001) Doppel-induced cerebellar degeneration in transgenic mice. Proc Natl Acad Sci USA 98, 15288–93.

873

C. E. Mays et al.

Endoproteolysis of Shadoo and Doppel

14 Daude N, Wohlgemuth S, Brown R, Pitstick R, Gapeshina H, Yang J, Carlson GA & Westaway D (2012) Knockout of the prion protein (PrP)-like Sprn gene does not produce embryonic lethality in combination with PrPC-deficiency. Proc Natl Acad Sci USA 109, 9035–40. 15 Watts JC, St€ ohr J, Bhardwaj S, Wille H, Oehler A, DeArmond SJ, Giles K & Prusiner SB (2011) Proteaseresistant prions selectively decrease shadoo protein. PLoS Pathog 7, e1002382. 16 Westaway D, Genovesi S, Daude N, Brown R, Lau A, Lee I, Mays CE, Coomaraswamy J, Canine B, Pitstick R et al. (2011) Down-regulation of shadoo in prion infections traces a pre-clinical event inversely related to PrPSc accumulation. PLoS Pathog 7, e1002391. 17 Watts JC, Drisaldi B, Ng V, Yang J, Strome B, Horne P, Sy MS, Yoong L, Young R, Mastrangelo P et al. (2007) The CNS glycoprotein Shadoo has PrP(C)-like protective properties and displays reduced levels in prion infections. EMBO J 26, 4038–50. 18 Silverman GL, Qin K, Moore RC, Yang Y, Mastrangelo P, Tremblay P, Prusiner SB, Cohen FE & Westaway D (2000) Doppel is an N-glycosylated, glycosylphosphatidylinositol-anchored protein. Expression in testis and ectopic production in the brains of Prnp0/0 mice predisposed to Purkinje cell loss. J Biol Chem 275, 26834–41. 19 Mo H, Moore RC, Cohen FE, Westaway D, Prusiner SB, Wright PE & Dyson HJ (2001) Two different neurodegenerative diseases caused by proteins with similar structures. Proc Natl Acad Sci USA 98, 2352–57. 20 Luhrs T, Riek R, Guntert P & Wuthrich K (2003) NMR structure of the human doppel protein. J Mol Biol 326, 1549–57. 21 Premzl M, Sangiorgio L, Strumbo B, Marshall Graves JA, Simonic T & Gready JE (2003) Shadoo, a new protein highly conserved from fish to mammals and with similarity to prion protein. Gene 314, 89–102. 22 Premzl M, Gready JE, Jermiin LS, Simonic T & Marshall Graves JA (2004) Evolution of vertebrate genes related to Prion and Shadoo proteins – clues from comparative genomic analysis. Mol Biol Evol 21, 2210–31. 23 Lau A, Mays CE, Genovesi S & Westaway D (2012) RGG repeats of PrP-like Shadoo protein bind nucleic acids. Biochemistry 51, 9029–31. 24 Gabus C, Derrington E, Leblanc P, Chnaiderman J, Dormont D, Swietnicki W, Morillas M, Surewicz WK, Marc D, Nandi P et al. (2001) The prion protein has RNA binding and chaperoning properties characteristic of nucleocapsid protein NCP7 of HIV-1. J Biol Chem 276, 19301–9. 25 Gabus C, Auxilien S, P
echoux C, Dormont D, Swietnicki W, Morillas M, Surewicz W, Nandi P & Darlix J-L (2001) The prion protein has DNA strand

874

26

27

28 29

30

31 32

33

34

35

36

37

38

39

transfer properties similar to retroviral nucleocapsid protein. J Mol Biol 307, 1011–1021. Macedo B, Millen TA, Braga CACA, Gomes MPB, Ferreira PS, Kraineva J, Winter R, Silva JL & Cordeiro Y (2012) Nonspecific prion protein–nucleic acid interactions lead to different aggregates and cytotoxic species. Biochemistry 51, 5402–13. Miyazawa K & Manuelidis L (2010) Agent-specific Shadoo responses in transmissible encephalopathies. J Neuroimmune Pharmacol 5, 155–63. Aguzzi A, Baumann F & Bremer J (2008) The prion’s elusive reason for being. Annu Rev Neurosci 31, 439–77. Linden R, Martins VR, Prado MAM, Cammarota M, Izquierdo I & Brentani RR (2008) Physiology of the prion protein. Physiol Rev 88, 673–728. Biasini E, Turnbaugh JA, Unterberger U & Harris DA (2012) Prion protein at the crossroads of physiology and disease. Trends Neurosci 35, 92–103. Liang J & Kong Q (2012) a-Cleavage of cellular prion protein. Prion 6, 453–60. Altmeppen HC, Prox J, Puig B, Dohler F, Falker C, Krasemann S & Glatzel M (2013) Roles of endoproteolytic a-cleavage and shedding of the prion protein in neurodegeneration. FEBS J 280, 4338–47. Sunyach C, Cisse MA, da Costa CA, Vincent B & Checler F (2007) The C-terminal products of cellular prion protein processing, C1 and C2, exert distinct influence on p53-dependent staurosporine-induced caspase-3 activation. J Biol Chem 282, 1956–63. Westergard L, Turnbaugh JA & Harris DA (2011) A naturally occurring C-terminal fragment of the prion protein (PrP) delays disease and acts as a dominantnegative inhibitor of PrPSc formation. J Biol Chem 286, 44234–42. B
eland M & Roucou X (2012) The prion protein unstructured N-terminal region is a broad-spectrum molecular sensor with diverse and contrasting potential functions. J Neurochem 120, 853–68. Guillot-Sestier MV, Sunyach C, Druon C, Scarzello S & Checler F (2009) The alpha-secretase-derived Nterminal product of cellular prion, N1, displays neuroprotective function in vitro and in vivo. J Biol Chem 284, 35973–86. Guillot-Sestier M-V, Sunyach C, Ferreira ST, Marzolo M-P, Bauer C, Thevenet A & Checler F (2012) a-Secretase-derived fragment of cellular prion, N1, protects against monomeric and oligomeric amyloid b (Ab)-associated cell death. J Biol Chem 287, 5021–32. Taraboulos A, Scott M, Semenov A, Avrahami D, Laszlo L & Prusiner SB (1995) Cholesterol depletion and targeting to clathrin coated pits inhibit formation of the scrapie prion protein. J Cell Biol 129, 121–32. Shyng SL, Huber MT & Harris DA (1993) A prion protein cycles between the cell surface and an endocytic

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

C. E. Mays et al.

40

41

42

43

44

45

46

47

48

49

50

compartment in cultured neuroblastoma cells. J Biol Chem 268, 15922–28. Walmsley AR, Watt NT, Taylor DR, Perera WSS & Hooper NM (2009) a-Cleavage of the prion protein occurs in a late compartment of the secretory pathway and is independent of lipid rafts. Mol Cell Neurosci 40, 242–48. Sakudo A & Onodera T (2011) Tissue- and cell typespecific modification of prion protein (PrP)-like protein Doppel, which affects PrP endoproteolysis. Biochem Biophys Res Commun 404, 523–27. Massimino ML, Ballarin C, Bertoli A, Casonato S, Genovesi S, Negro A & Sorgato MC (2004) Human Doppel and prion protein share common membrane microdomains and internalization pathways. Int J Biochem Cell Biol 36, 2016–31. Daude N, Ng V, Watts JC, Genovesi S, Glaves JP, Wohlgemuth S, Schmitt-Ulms G, Young H, McLaurin J, Fraser PE et al. (2010) Wild-type Shadoo proteins convert to amyloid-like forms under native conditions. J Neurochem 113, 92–104. Watts JC, Huo H, Bai Y, Ehsani S, Jeon AH, Shi T, Daude N, Lau A, Young R, Xu L et al. (2009) Interactome analyses identify ties of PrP and its mammalian paralogs to oligomannosidic N-glycans and endoplasmic reticulum-derived chaperones. PLoS Pathog 5, e1000608. Ehsani S, Salehzadeh A, Huo H, Reginold W, Pocanschi CL, Ren H, Wang H, So K, Sato C, Mehrabian M et al. (2012) LIV-1 ZIP ectodomain shedding in prion-infected mice resembles cellular response to transition metal starvation. J Mol Biol 422, 556–574. Sakthivelu V, Seidel RP, Winklhofer KF & Tatzelt J (2011) Conserved stress-protective activity between prion protein and shadoo. J Biol Chem 286, 8901–8. B€ ueler H, Fischer M, Lang Y, Bluethmann H, Lipp HP, DeArmond SJ, Prusiner SB, Aguet M & Weissmann C (1992) Normal development and behaviour of mice lacking the neuronal cell-surface PrP protein. Nature 356, 577–82. Behrens A, Genoud N, Naumann H, R€ ulicke T, Janett F, Heppner FL, Ledermann B & Aguzzi A (2002) Absence of the prion protein homologue Doppel causes male sterility. EMBO J 21, 1–7. Paisley D, Banks S, Selfridge J, McLennan NF, Ritchie AM, McEwan C, Irvine DS, Saunders PT, Manson JC & Melton DW (2004) Male infertility and DNA damage in Doppel knockout and prion protein/Doppel double-knockout mice. Am J Pathol 164, 2279–2288. Genoud N, Behrens A, Miele G, Robay D, Heppner FL, Freigang S & Aguzzi A (2004) Disruption of Doppel prevents neurodegeneration in mice with extensive Prnp deletions. Proc Natl Acad Sci USA 101, 4198–203.

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS

Endoproteolysis of Shadoo and Doppel

51 Liang J, Wang W, Sorensen D, Medina S, Ilchenko S, Kiselar J, Surewicz WK, Booth SA & Kong Q (2012) Cellular prion protein regulates its own a-cleavage through ADAM8 in skeletal muscle. J Biol Chem 287, 16510–20. 52 Moore R, Lee I, Silverman GS, Harrison P, Strome R, Heinrich C, Karunaratne A, Pasternak SH, Chishti MA, Liang Y et al. (1999) Ataxia in prion protein (PrP) deficient mice is associated with upregulation of the novel PrP-like protein doppel. J Mol Biol 293, 797–817. 53 Vilette D (2008) Cell models of prion infection. Vet Res 39, 10. 54 Peoc’h K, Guerin C, Brandel JP, Launay JM & Laplanche JL (2000) First report of polymorphisms in the prion-like protein gene (PRND): implications for human prion diseases. Neurosci Lett 286, 144–48. 55 Lu K, Wang W, Xie Z, Wong BS, Li R, Petersen RB, Sy MS & Chen SG (2000) Expression and structural characterization of the recombinant human doppel protein. Biochemistry 39, 13575–83. 56 Li Q, Chevalier C, Henry C, Richard C-A, Moudjou M & Vidic J (2013) Shadoo binds lipid membranes and undergoes aggregation and fibrillization. Biochem Biophys Res Commun 438, 519–25. 57 Petersen TN, Brunak S, von Heijne G & Nielsen H (2011) SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 8, 785–786. 58 Sunyach C, Jen A, Deng J, Fitzgerald KT, Frobert Y, Grassi J, McCaffrey MW & Morris R (2003) The mechanism of internalization of glycosylphosphatidylinositol-anchored prion protein. EMBO J 22, 3591–601. 59 Daude N, Wohlgemuth S, Rogaeva E, Farid AH, Heaton M & Westaway D (2009) Frequent missense and insertion/deletion polymorphisms in the ovine Shadoo gene parallel species-specific variation in PrP. PLoS ONE 4, e6538. 60 Lutz J, Brabeck C, Niemann HH, Kloz U, Korth C, Lingappa VR & B€ urkle A (2010) Microdeletions within the hydrophobic core region of cellular prion protein alter its topology and metabolism. Biochem Biophys Res Commun 393, 439–44. 61 Caputo A, Sarnataro D, Campana V, Costanzo M, Negro A, Sorgato MC & Zurzolo C (2010) Doppel and PrPC co-immunoprecipitate in detergent-resistant membrane domains of epithelial FRT cells. Biochem J 425, 341–51. 62 Priola SA & Lawson VA (2001) Glycosylation influences cross-species formation of protease-resistant prion protein. EMBO J 20, 6692–99. 63 Somerville RA (1999) Host and transmissible spongiform encephalopathy agent strain control glycosylation of PrP. J Gen Virol 80, 1865–72. 64 DeArmond SJ, Qiu Y, Sanchez H, Spilman PR, Ninchak-Casey A, Alonso D & Daggett V (1999) PrPC

875

C. E. Mays et al.

Endoproteolysis of Shadoo and Doppel

65

66

67

68

69

70

71

72

876

glycoform heterogeneity as a function of brain region: implications for selective targeting of neurons by prion strains. J Neuropathol Exp Neurol 58, 1000–9. Xiao X, Yuan J, Ha€ık S, Cali I, Zhan Y, Moudjou M, Li B, Laplanche J-L, Laude H, Langeveld J et al. (2013) Glycoform-selective prion formation in sporadic and familial forms of prion disease. PLoS ONE 8, e58786. Watt NT & Hooper NM (2005) Reactive oxygen species (ROS)-mediated beta-cleavage of the prion protein in the mechanism of the cellular response to oxidative stress. Biochem Soc Trans 33, 1123–25. Walmsley AR, Zeng F & Hooper NM (2003) The N-terminal region of the prion protein ectodomain contains a lipid raft targeting determinant. J Biol Chem 278, 37241–48. Sisodia SS (1992) b-Amyloid precursor protein cleavage by a membrane-bound protease. Proc Natl Acad Sci USA 89, 6075–79. Pan KM, Stahl N & Prusiner SB (1992) Purification and properties of the cellular prion protein from Syrian hamster brain. Protein Sci 1, 1343–52. Mays CE, Kim C, Haldiman T, Merwe JVD, Lau A, Yang J, Grams J, Bari MAD, Nonno R, Telling GC et al. (2014) Substrate reduction as a host response determining the tempo of prion disease. J Clin Invest in press. Vincent B, Paitel E, Saftig P, Frobert Y, Hartmann D, De Strooper B, Grassi J, Lopez-Perez E & Checler F (2001) The disintegrins ADAM10 and TACE contribute to the constitutive and phorbol ester-regulated normal cleavage of the cellular prion protein. J Biol Chem 276, 37743–46. Cisse MA, Sunyach C, Lefranc-Jullien S, Postina R, Vincent B & Checler F (2005) The disintegrin ADAM9

73

74

75

76

indirectly contributes to the physiological processing of cellular prion by modulating ADAM10 activity. J Biol Chem 280, 40624–31. B
eland M, Motard J, Barbarin A & Roucou X (2012) PrPC homodimerization stimulates the production of PrPC cleaved fragments PrPN1 and PrPC1. J Neurosci 32, 13255–63. Wik L, Klingeborn M, Willander H & Linn
e T (2012) Separate mechanisms act concurrently to shed and release the prion protein from the cell. Prion 6, 498–509. Drisaldi B, Coomaraswamy J, Mastrangelo P, Strome B, Yang J, Watts JC, Chishti MA, Marvi M, Windl O, Ahrens R et al. (2004) Genetic mapping of activity determinants within cellular prion proteins: N-terminal modules in PrPC offset pro-apoptotic activity of the doppel helix B/B′ region. J Biol Chem 279, 55443–54. Schneider CA, Rasband WS & Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671–75.

Supporting information Additional supporting information may be found in the online version of this article at the publisher’s web site: Fig. S1. Localization of signal peptidase cleavage in Dpl. Fig. S2. Dpl fusion proteins. Fig. S3. SIGNALIP-4.0-predicted signal peptidase cleavage site for Sho. Fig. S4. Examining signal peptidase cleavage and Nterminal products for Sho via in vitro expression.

FEBS Journal 281 (2014) 862–876 ª 2013 FEBS