This article was downloaded by: [Universite Laval] On: 09 July 2014, At: 07:49 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Journal of Toxicology and Environmental Health, Part A: Current Issues Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/uteh20
Endocrine and AhR-CYP1A Pathway Responses to the Water-Soluble Fraction of Oil in Zebrafish (Danio rerio Hamilton) a
b
a
b
Iurgi Salaberria , Odd Gunnar Brakstad , Anders J. Olsen , Trond Nordtug & Bjørn Henrik Hansen
b
a
Department of Biology, Norwegian University of Science and Technology, Trondheim, Norway b
SINTEF Materials and Chemistry, Marine Environmental Technology, Trondheim, Norway Published online: 22 Apr 2014.
To cite this article: Iurgi Salaberria, Odd Gunnar Brakstad, Anders J. Olsen, Trond Nordtug & Bjørn Henrik Hansen (2014) Endocrine and AhR-CYP1A Pathway Responses to the Water-Soluble Fraction of Oil in Zebrafish (Danio rerio Hamilton), Journal of Toxicology and Environmental Health, Part A: Current Issues, 77:9-11, 506-515, DOI: 10.1080/15287394.2014.886983 To link to this article: http://dx.doi.org/10.1080/15287394.2014.886983
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Journal of Toxicology and Environmental Health, Part A, 77:506–515, 2014 Copyright © Taylor & Francis Group, LLC ISSN: 1528-7394 print / 1087-2620 online DOI: 10.1080/15287394.2014.886983
ENDOCRINE AND AhR-CYP1A PATHWAY RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL IN ZEBRAFISH (Danio rerio HAMILTON) Iurgi Salaberria1, Odd Gunnar Brakstad2, Anders J. Olsen1, Trond Nordtug2, Bjørn Henrik Hansen2 1
Downloaded by [Universite Laval] at 07:49 09 July 2014
2
Department of Biology, Norwegian University of Science and Technology, Trondheim, Norway SINTEF Materials and Chemistry, Marine Environmental Technology, Trondheim, Norway
Crude oil is a complex mixture of compounds of which the water-soluble fraction (WSF) is considered to be bioavailable and potentially toxic to aquatic biota. Containing numerous compounds, WSF becomes a source of multiple chemical stressors to wildlife when introduced into the environment. To study the combined effects of WSF components on aquatic biota, the model species zebrafish (Danio rerio Hamilton) was exposed for 24 or 72 h to 10 or 50% WSF solution of known composition, generated from artificially weathered North Sea crude oil. Hepatic expression of genes involved in the aryl hydrocarbon receptor-cytochrome P-450 1A (AhR-CYP1A) pathway (AhR2, AhRR1, CYP1A1) and steroidogenesis (StAR, CYP11A, 3β-HSD, CYP19A, CYP19B) was measured, as well as estrogen receptors ERα and ERβ1. Induction of CYP1A and particularly of AhRR1 was observed while ERα and steroidogenic enzymes CYP11A and 3β-HSD were downregulated. Regression analysis demonstrated a negative relationship between AhR-CYP1A pathway and endocrine transcript levels, although causality remains to be established. These findings indicate that exposure to WSF of oil disrupts steroidogenesis and may therefore constitute a potential risk for reproductive ability of aquatic organisms. In addition, it is proposed that hepatic gene expression of AhRR1 may serve as a novel biomarker of WSF exposure.
2011; Hansen et al., 2013). In addition, unresolved complex mixtures (UCM) may contribute to aquatic toxicology (Melbye et al., 2009). Thus, aquatic organisms inhabiting oilpolluted waters are exposed to a complex mixture of both known and unknown oil constituents whose biological effects remain to be investigated. Xenobiotics including the compounds that constitute WSF are metabolized by cytochrome P-450 enzymes (CYP). More specifically, WSF (Navas et al., 2006; Arukwe et al., 2008) and several of its individual constituents were shown to induce hepatic CYP1A by interaction with the aryl hydrocarbon receptor (AhR) (Bols et al., 1999; Denison and Nagy, 2003). The
Crude oil enters the aquatic environment following accidental and regular discharges related to production, transport, and use of petroleum products. When suspended in the water column, oil is submitted to weathering by drifting, dispersion, dissolution, adhesion to sediments, emulsification, loss of volatile constituents, and photo- and biodegradation (Pastor et al., 2001; Short et al., 2007). These processes create a multi-compound watersoluble fraction (WSF) of the oil which is bioavailable and toxic to aquatic organisms (Melbye et al., 2009). Typically toxicity of WSF is attributed to non-polar naphthalenes and polycyclic aromatic hydrocarbons (PAH), and to alkylated phenols (Nordtug et al.,
Address correspondence to Iurgi Salaberria, Norwegian University of Science and Technology, Department of Biology, N-7491 Trondheim, Norway. E-mail: [email protected] and [email protected] 506
Downloaded by [Universite Laval] at 07:49 09 July 2014
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
zebrafish (Danio rerio Hamilton; Cyprinidae) has three characterized AhRs (AhR1A, AhR1B, and AhR2) (Karchner et al., 2005), of which AhR2 mediates developmental and cardiac toxicity of PAH in zebrafish (Incardona et al., 2006; Van Tiem and Di Giulio, 2011). AhR activity is regulated by an AhR repressor (AhRR), which is induced by the AhR itself and thus forms a negative feedback loop for AhR regulation (Evans et al., 2005). Zebrafish have two characterized AhRR, AhRR1 and AhRR2 (or AhRRa and AhRRb, respectively), with similar roles: They repress AhR2-dependent transactivation to a similar extent and both modulate aromatic hydrocarbon embryotoxicity (Evans et al., 2005, 2008), although some subfunction partitioning occurred (Jenny et al., 2009). Although CYP1A catalyzes the oxidation of xenobiotic molecules such as PAH, its physiological role is to biotransform endogenous compounds. For example, CYP1A and CYP1C are primarily responsible for the metabolism of the estrogen 17β-estradiol (E2) in zebrafish (Scornaienchi et al., 2010). By competing with E2 for CYP1A binding sites and/or by stimulating CYP1A activity, WSF constituents potentially alter E2 metabolism. While CYP1A is known to be induced by WSF and its constituents, little is known regarding the effects of these compounds on CYP involved in de novo synthesis of steroids and on other steroidogenic enzymes. In addition, the PAH 3-methylcholanthrene (3-MC) was found to exert predominantly estrogenic effects by activating estrogen receptor α (ERα) without binding the receptor, possibly mediated by cross-talk between the AhR and ER pathways (Ohtake et al., 2007; Swedenborg et al., 2012). This may affect ERα-mediated processes such as vitellogenesis in fish liver (Ota et al., 2000). Thus, it was of interest to investigate the effects of WSF on the endocrine system. Simultaneously, there is a need for early warning systems of WSF exposure in aquatic biota. Therefore, in vivo effects of the WSF of artificially weathered North Sea oil were studied on hepatic expression of genes involved in the AhR-CYP1A pathway and in steroidogenesis, and of ER genes in an ecotoxicological model species, the zebrafish.
507
METHODS Generation of the Water-Soluble Fraction of Oil Crude oil from the northern part of the North Sea was selected as representative oil for the study. The oil was artificially weathered by heating to 200◦ C to remove volatile compounds (Stiver and Mackay, 1984), and the +200◦ C residue was collected and used for generation of WSF according to Croserf methodology (Aurand and Coelho, 1996): 10-L baked glass bottles were filled with tap water (9.0 L), and oil (225 g) was carefully added onto the surface alongside a glass tube, giving a loading of 1:40 oil:water ratio. To avoid the formation of oil droplets, low-energy magnetic stirring was applied for 72 h before the water phase was siphoned off and used for the experiments.
Chemical Analysis Samples for chemical analysis (approximately 900 ml each) were collected from the prepared WSF prior to the exposure experiments and acidified with diluted hydrochloric acid. Acidified water samples were extracted with dichloromethane (DCM), dried over Na2 SO4 , and concentrated to 1 ml. Analysis of 58 semivolatile compounds in the 100% WSF solution, including phenols, naphthalenes, and three- to five-ring polycyclic aromatic hydrocarbons (PAH), was performed by gas chromatography–mass spectrometry (GC-MS) operated in selected ion monitoring (SIM) mode. The system comprised of an HP6890N gas chromatograph fitted with a HewlettPackard HP7683B Series autosampler and a HP5975B quadrupole mass-selective detector. The column is a Phenomenex ZB-5MS fused silica capillary column (30 m × 0.25 mm ID × 0.25 μm film thickness). Helium was used as the carrier gas at a constant flow of 1 ml/min. A 1-μl sample was injected into a 310◦ C splitless injector. The oven temperature was programmed from 40◦ C for 1 min, then to 315◦ C at 6◦ C/min and held for 15 min. Data and chromatograms were monitored and recorded using MSD ChemStation (version
508
I. SALABERRIA ET AL.
D.03.00.611) software. The quadrupole mass spectrometer ion source temperature was 230◦ C.
Downloaded by [Universite Laval] at 07:49 09 July 2014
Fish Exposure and Experimental Design Adult zebrafish of an unspecified wild-type line were purchased from a local pet shop and reared in glass aquaria (2.2 L) with continuous water flow (1 L/min/kg fish). Fish were fed daily with standard aquarium fish meal, and acclimated for a week to the same temperature and light regime as used during the exposure experiment: 28◦ C and 14:10-h light/dark cycle. Eighteen fish were evenly distributed among three tanks (n = 6). The control tank contained clean water and the remaining 2 tanks contained either 10% or 50% WSF solution. Three fish from each tank were sampled after 24 h of exposure, and the remaining 3 fish after 72 h of exposure. Livers were dissected at sampling and stored in RNAlater while awaiting gene expression analysis. RNA Sampling and Extraction Total RNA was extracted using the RNeasy Protect Mini Kit (Qiagen, Crawley, UK) according to the manufacturer’s protocol. Contaminating DNA was removed by DNAase I treatment (DNAfree kit, Ambion, Austin, TX). The concentrations and quality of RNA in samples were assessed by electrophoresis on 1.5% formaldehyde–agarose gels (BioRad Laboratories, Hercules, CA) to confirm integrity of 18S and 28S rRNA bands; purity and concentration were assessed by measurements of absorption at 260 and 280 nm. The 260/280 absorption ratio of 1.9–2.1 indicated pure RNA samples. Real-Time RT-PCR Single-strand cDNA was synthesized from 250 ng of total RNA using the Bio-Rad cDNAsynthesis kit (Bio-Rad). Thereafter cDNA was diluted 1:5 in diethylpyrocarbonate-treated water (DEPC-water). Every sample was analyzed in duplicate. The accession numbers
of the genes used in our study and the primer sequences are shown in Table 1. Amplification of cDNA was monitored using real-time polymerase chain reaction (PCR), performed with the Mx3000P Real-Time PCR System (Stratagene, La Jolla, CA). Each 25-μl DNA amplification reaction contained 12.5 μl of iTaq SYBR Green Supermix with ROX (BioRad) and forward and reverse primers (400 nM concentration of each), and 5 μl diluted cDNA as template. The RT-PCR program included an enzyme activation step at 95◦ C (10 min) and 40 cycles of 95◦ C (30 s), 60◦ C (1 min), and 72◦ C (30 s). Dissociation curves of the PCR products were obtained by gradual heating of the samples from 55 to 95◦ C, and reaction specificity was determined when one peak in the dissociation curve was obtained.
Data Analysis The Mann–Whitney U-test was applied to assess for statistically significant differences in gene expression between controls and each WSF treatment separately (p ≤ .05). Regression analysis was applied to assess for relationships between variables. All data were analyzed using IBM SPSS Statistics Version 20 (International Business Machines Corp., New York, NY).
RESULTS GC-MS analysis of the 100% WSF solution showed a predominance of C0–C4 naphthalenes (64%) and phenols (29%) among the measured analytes (Table 2). Composition of the WSF used in the present study also showed as comparable to that of produced water (i.e., oil production effluent) collected at the same location in the North Sea as the WSF (data not shown). Hepatic expression of AhR2 was not markedly altered by WSF exposure (Figure 1A). In contrast, AhRR1 was significantly upregulated by both 10 and 50% WSF after 24 or 72 h of exposure (Figure 1B). CYP1A expression was significantly raised compared to controls after
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
509
TABLE 1. Primer Pair Sequences, Accession Numbers, and Amplicon Size for Genes of Interest Used for Real-Time PCR Primer sequence∗ Target gene
Forward
AhR2 AhRR1 CYP1A1 StAR CYP11A 3β-HSD CYP19A CYP19B ERα ERβ1
CTACTTGGGCTTCCATCAGTCG GCGCATCAAGAGCTTCTGCAGCGTGTT AATCCCAGACGGGCTACA ACCTGTTTTCTGGCTGGGATG AGGGCCATCACCCCAATAG GCAACTCTGGTTTTCCACACTG CTGAAAGGGCTCAGGACAA CGACAGGCCATCAATAACA AAACACAGTCGGCCCTACAC TGATTAGCTGGGCGAAGA
∗ Sequences
Reverse
Amplicon size (nucleo-tides)
GenBank accession number
GTCACTTGAGGGATTGAGAGCG CCACTGACGACCAGCGCAAACCCT CCGGGCCATAGCACTTAC GGGTCCATTCTCAGCCCTTAC CCAGGCCTTCCCTTCTTTTAG CAGCAGGAGCCGTGTAGCTT TGGTCGATGGTGTCTGATG CGTCCACAGACAGCTCATC GCCAAGAGCTCTCCAACAAC TATCCAGCCAGCAGCATT
118 149 122 81 101 102 92 94 157 87
NM131264 AY928203 AF210727 NM131663 AF527755 AY279108 AF226620 AF183908 AF268283 AJ414566
are given in the 5 –3 order.
Downloaded by [Universite Laval] at 07:49 09 July 2014
TABLE 2. Composition of the Water-Soluble Fraction (WSF) (100% Solution) Residue
μg/L
Residue
μg/L
Decalin C1-decalins C2-decalins C3-decalins C4-decalins Benzo[b]thiophene C1-benzo[b]thiophenes C2-benzo[b]thiophenes C3-benzo[b]thiophenes C4-benzo[b]thiophenes Naphthalene C1-naphthalenes C2-naphthalenes C3-naphthalenes C4-naphthalenes Biphenyl Acenaphthylene Acenaphthene Dibenzofuran Fluorene C1-fluorenes C2-fluorenes C3-fluorenes Phenanthrene Anthracene C1-phenanthrenes/anthracenes C2-phenanthrenes/anthracenes C3-phenanthrenes/anthracenes C4-phenanthrenes/anthracenes
0.53 0.28 ND ND ND ND ND ND ND 1.48 101 120 64.1 14.4 ND 12.0 0.05 0.79 1.16 2.69 3.42 3.08 ND 1.98 0.12 2.16 0.87 ND ND
Dibenzothiophene C1-dibenzothiophenes C2-dibenzothiophenes C3-dibenzothiophenes C4-dibenzothiophenes Fluoranthene Pyrene C1-fluoranthrenes/pyrenes C2-fluoranthenes/pyrenes C3-fluoranthenes/pyrenes Benz[a]anthracene Chrysene C1-chrysenes C2-chrysenes C3-chrysenes C4-chrysenes Benzo[b]fluoranthene Benzo[k]fluoranthene Benzo[e]pyrene Benzo[a]pyrene Perylene Indeno[1.2.3-c.d]pyrene Dibenz[a.h]anthracene Benzo[g.h.i]perylene Phenol C1-Phenols (o/m- and p-cresol) C2-Phenols C3-Phenols C4-Phenols
0.38 1.17 0.68 ND ND 0.03 0.03 0.10 0.01 ND ND 0.01 ND ND ND ND ND ND ND ND ND ND ND ND 0.30 0.42 32.6 47.7 52.5
exposure to 50% WSF but not to 10% WSF after 24 or 72 h of exposure (Figure 1C). Among the endocrine endpoints analyzed only steroidogenic acute regulatory protein (StAR) mRNA levels were significantly elevated by WSF (10% solution) after 24 h of exposure, but at 72 h StAR expression returned
to control levels (Figure 2A). Both cytochrome P-450 side-chain cleavage (CYP11A) and 3βhydroxysteroid dehydrogenase (3β-HSD) transcript levels were suppressed after 72 h of exposure to 50% WSF (Figures 2B and 2C). Fish exposed to 10 and 50% WSF for 24 h showed relatively low expression of 3β-HSD,
I. SALABERRIA ET AL.
Downloaded by [Universite Laval] at 07:49 09 July 2014
510
FIGURE 1. Hepatic expression of genes (as percent of control) involved in the AhR-CYP1A pathway: (A) aryl hydrocarbon receptor 2 (AhR2), (B) AhR repressor 1 (AhRR1), and (C) cytochrome P-450 1A (CYP1A) in zebrafish exposed to either 10% (gray bars) or 50% water-soluble fraction (WSF) solution (black bars) compared to controls (white bars), with exposure for either 24 or 72 h. Bars represent mean and whiskers standard error of mean (SEM). Asterisks denote statistical difference compared to control (p ≤ .05).
FIGURE 2. Hepatic expression of genes (as percent of control) involved in steroidogenesis: (A) steroidogenic acute regulatory protein (StAR), (B) cytochrome P-450 side-chain cleavage (CYP11A), and (C) 3β-hydroxysteroid dehydrogenase (3β-HSD) in zebrafish exposed to either 10% (gray bars) or 50% watersoluble fraction (WSF) solution (black bars) compared to controls (white bars), with exposure for either 24 or 72 h. Bars represent mean and whiskers standard error of mean (SEM). Asterisks denote statistical difference compared to control (p ≤ .05).
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
Downloaded by [Universite Laval] at 07:49 09 July 2014
which however was not significantly different from controls due to relatively large variation in the latter (Figure 2C). Expression of aromatase genes CYP19A and 19B was not markedly affected by WSF exposure regime (Figures 3A and 3β). Expression of estrogen receptor a (ERα) was significantly downregulated by 10% WSF after 72 h of exposure, whereas no significant effects on ERβ were observed (Figures 3C and 3D). Three negative relationships between AhR-CYP1A pathway and endocrine responses were observed: between AhRR1 and ERα, AhRR1 and 3β-HSD, and CYP1A and CYP19A (Table 3). DISCUSSION Generally, AhR-CYP1A pathway responses were upregulated in WSF-exposed zebrafish (Figure 1). The observed increases in CYP1A and AhRR1 expression are in agreement with previous observations in fish after exposure to aromatic hydrocarbons (Evans et al., 2005; Jenny et al., 2009). Numerous petrogenic PAH induce AhRR and CYP1A by activating the AhR2, which mediates the adverse effects of these compounds in zebrafish (Incardona et al., 2006; Van Tiem and Di Giulio, 2011). However, in the fish of the present study this stimulation of AhRR1 and CYP1A was not accompanied by an increase in AhR2 expression, and a dose-dependent decrease of AhR2 mRNA was noted previously in WSFexposed zebrafish (Arukwe et al., 2008). This may be attributed to the fact that AhR suppresses itself by inducing AhRR. AhR competes mainly with AhRR for associating with AhR nuclear translocator (ARNT) and for binding to the xenobiotic response element (XRE) on DNA. In addition, the AhRR–ARNT complex also acts as a repressor when bound to XRE. This repressor is induced by AhR itself and thus forms a negative feedback loop for AhR regulation (Evans et al., 2008). AhRR1 was the only one of all the endpoints measured herein to be altered consistently by WSF in a dose-dependent fashion, exhibiting elevated expression following 24 h
511
of exposure to 10% WSF (Figure 1C). In other words, WSF exerted a more rapid and pronounced stimulatory effect on AhRR1 (up to nearly 100-fold of control values) than on CYP1A, an established sensitive biomarker for PAH exposure (van der Oost et al., 2003). This may indicate an important role for AhRR1 as a potential early warning system for WSF exposure in fish. Concomitant with stimulation of the AhRCYP1A pathway, an overall downregulation of endocrine endpoints was observed in fish of the present study after WSF exposure (Figures 2 and 3). Transcription of steroidogenic enzymes CYP11A and 3β-HSD was significantly reduced. Transcription of the aromatase genes was not significantly altered by WSF in zebrafish (Figure 3A-B). However, the negative relationship between CYP19A and CYP1A, the latter of which was induced significantly, indicates a downward trend in CYP19A (Table 3). This is consistent with previous reports of suppressed StAR, CYP11A, 17β-hydroxysteroid dehydrogenase (17β-HSD), CYP19A, and CYP19B observed in zebrafish exposed to North Sea WSF or produced water components (Arukwe et al., 2008; Holth et al., 2008). Suppression of steroidogenesis might result in decreased concentrations of steroid hormones such as testosterone (T) and E2. Indeed, teleosts exposed to WSF-produced water or oil were found to exhibit lowered circulating levels of T and sometimes E2 (Arukwe et al., 2008; Martin-Skilton et al., 2006), and E2-induced egg yolk precursor vitellogenin (Vtg) (Hylland et al., 2008), although not consistently (Tollefsen et al., 2011). Diminished ERα expression was observed in WSF-exposed zebrafish (Figure 3C), consistent with previous findings (Arukwe et al., 2008; Bilbao et al., 2010). This may be associated with inhibitory cross-talk between AhR and ERα (Safe and Wormke, 2003). Indeed, AhR ligands were noted to inhibit AhRmediated expression of the ERα and Vtg genes and to abolish E2-induced accumulation of ERα mRNA in fish liver (Bemanian et al., 2004). It is postulated that enhanced E2 metabolism is one of the possible mechanisms by which inhibitory
Downloaded by [Universite Laval] at 07:49 09 July 2014
512
I. SALABERRIA ET AL.
FIGURE 3. Hepatic gene expression (as percent of control) of (A) aromatase A (CYP19A), (B) aromatase B (CYP19B), (C) estrogen receptor a (ERα), and (D) estrogen receptor b1 (ERβ1) in zebrafish exposed to either 10% (gray bars) or 50% water-soluble fraction (WSF) solution (black bars) compared to controls (white bars), with exposure for either 24 or 72 h. Bars represent mean and whiskers standard error of mean (SEM). Asterisks denote statistical difference compared to control (p ≤ .05).
AhR-ERα cross-talk may occur (Safe and Wormke, 2003). AhR binding by ligands such as PAH stimulates CYP1A, which in zebrafish, together with CYP1C, is primarily responsible for the metabolism of E2 (Scornaienchi et al., 2010). Increased CYP1A activity may accelerate E2 metabolism and hence reduce blood E2 levels (Spink et al., 1990). Other possible mechanisms of inhibitory AhR-ERα cross-talk are (1) induction of inhibitory factors, (2) direct inhibition via inhibitory XRE (iXREs), (3) competition for common nuclear coregulatory proteins, and (4) increased proteasome-dependent degradation of ERα (Safe and Wormke, 2003; Matthews and Gustafsson, 2006). It is noteworthy that most inhibitory AhR-ER crosstalk studies were performed with 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD), and it remains to be established whether petrogenic PAH and other WSF constituents might
TABLE 3. Relationships Between AhR-CYP1A Pathway and Endocrine Responses in Zebrafish Liver R2
p
Log10 (CYP1A) = 2.796 – (0.326∗ Log10 (CYP19a)) 0.318 .015 Log10 (AhRR1) = 4.330 – (0.963∗ Log10 (ERα)) 0.333 .012 Log10 (AhRR1) = 3.194 – (0.435∗ Log10 (3β – HSD)) 0.419 .009
elicit similar effects. However, the fact that in WSF-exposed fish of the present study AhRR1 relates negatively with ERα may indicate potential AhR-mediated endocrine disruption (Table 3). Significant negative relationships between AhR-CYP1A pathway and endocrine endpoints observed in fish of the present study suggest effects of WSF on these two physiological processes may be linked (Table 3). AhRR1 was found to show a negative relationship with both ERα and 3β-HSD, adding weight to the
Downloaded by [Universite Laval] at 07:49 09 July 2014
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
postulation that AhRR1 plays a central role in the responses to WSF exposure. However, it needs to be emphasized that causality of these relationships remains to be established. Ultimately, the exact nature and intensity of the biological effects of WSF depend on its composition, which varies with time and origin. The WSF used in the present study showed predominance of naphthalenes and phenols (Table 2) but contained also UCM. Previous reports indicated that adverse effects of oil in fish may not be exclusively associated with naphthalenes, PAH, and alkylated phenols present in the oil (González-Doncel et al., 2008; Saco-Álvarez et al., 2008) but also associated to branched alkyl indanes and tetralins of UCM (Booth et al., 2008). In summary, an overall suppression of endocrine responses was observed in WSFexposed zebrafish that was inversely related to stimulation of the AhR-CYP1A pathway, although causality remains to be established. Hepatic expression of AhRR1 showed a more rapid and pronounced response to WSF than that of CYP1A, thereby becoming a potential candidate for use as an early warning system following WSF exposure. FUNDING This study was a strategic self-financed project (SEP) financed by SINTEF Materials and Chemistry. The authors thank Prof. A. Arukwe at the Department of Biology of the Norwegian University of Science and Technology for kindly providing access to RT-PCR equipment. REFERENCES Arukwe, A., Nordtug, T., Kortner, T. M., Mortensen, A. S., and Brakstad, O. G. 2008. Modulation of steroidogenesis and xenobiotic biotransformation responses in zebrafish (Danio rerio) exposed to water-soluble fraction of crude oil. Environ. Res. 107: 362–370. Aurand, D., and Coehlo, G. 1996. Proceedings of the 4th meeting of the chemical response to oil spills: Ecological Effects
513
Research Forum (CROSERF), 50. Purceville VA: Ecosystem Management & Associates. Bemanian, V., Male, R., and Goksøyr, A. 2004. The aryl hydrocarbon receptor-mediated disruption of vitellogenin synthesis in the fish liver: cross-talk between AHR- and erasignalling pathways. Comp. Hepatol. 3: 2. Bilbao, E., Raingeard, D., Diaz de Cerio, O., Ortiz-Zarragoitia, M., Ruiz, P., Izagirre, U., Orbea, A., Marigómez, I., Cajaraville, M. P., and Cancio, I. 2010. Effects of exposure to Prestige-like heavy fuel oil and to perfluorooctane sulfonate on conventional biomarkers and target gene transcription in the Thicklip grey mullet Chelon labrosus. Aquat. Toxicol. 98: 282–296. Bols, N. C., Schirmer, K., Joyce, E. M., Dixon, D. G., Greenberg, B. M., and Whyte, J. J. 1999. Ability of polycyclic aromatic hydrocarbons to induce 7-ethoxyresorufinO-deethylase activity in a trout liver cell line. Ecotoxicol. Environ. Safety 44: 118–128. Booth, A. M., Scarlett, A. G., Lewis, C. A., Belt, S. T., and Rowland, S. J. 2008. Unresolved complex mixtures (UCMs) of aromatic hydrocarbons: Branched alkyl indanes and branched alkyl tetralins are present in UCMs and accumulated by and toxic to, the mussel Mytilus edulis. Environ. Sci. Technol. 42: 8122–8126. Denison, M. S., and Nagy, S. R. 2003. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu. Rev. Pharmacol. Toxicol. 43: 309–334. Evans, B. R., Karchner, S. I., Allan, L. L., Pollenz, R. S., Tanguay, R. L., Jenny, M. J., Sherr, D. H., and Hahn, M. E. 2008. Repression of aryl hydrocarbon receptor (AHR) signaling by AHR repressor: Role of DNA binding and competition for AHR nuclear translocator. Mol. Pharmacol. 73: 387–398. Evans, B. R., Karchner, S. I., Franks, D. G., and Hahn, M. E. 2005. Duplicate aryl hydrocarbon receptor repressor genes (ahrr1 and ahrr2) in the zebrafish Danio rerio: Structure, function, evolution, and AHR-dependent regulation in vivo. Arch. Biochem. Biophys. 441: 151–167.
Downloaded by [Universite Laval] at 07:49 09 July 2014
514
González-Doncel, M., González, L., Fernandez-Torija, C., Navas, J. M., and Tarazona, J. V. 2008. Toxic effects of an oil spill on fish early life stages may not be exclusively associated to PAHs: Studies with Prestige oil and medaka (Oryzias latipes). Aquat. Toxicol. 87: 280–288. Hansen, B. H., Altin, D., Øverjordet, I. B., Jager, T., and Nordtug, T. 2013. Acute exposure of water soluble fractions of marine diesel on Arctic Calanus glacialis and boreal Calanus finmarchicus: Effects on survival and biomarker response. Sci. Total Environ. 449: 276–284. Holth, T. F., Nourizadeh-Lillabadi, R., Blaesbjerg, M., Grung, M., Holbech, H., Petersen, G. I., Alestrom, P., and Hylland, K. 2008. Differential gene expression and biomarkers in zebrafish (Danio rerio) following exposure to produced water components. Aquat. Toxicol. 90: 277–291. Hylland, K., Tollefsen, K.-E., Ruus, A., Jonsson, G., Sundt, R. C., Sanni, S., Utvik, T. I. R., Johnsen, S., Nilssen, I., Pinturier, L., Balk, L., Barsiene, J., Marigómez, I., Feist, S. W., and Børseth, J. F. 2008. Water column monitoring near oil installations in the North Sea 2001–2004. Mar. Pollut. Bull. 56: 414–429. Incardona, J. P., Day, H. L., Collier, T. K., and Scholz, N. L. 2006. Developmental toxicity of 4-ring polycyclic aromatic hydrocarbons in zebrafish is differentially dependent on AH receptor isoforms and hepatic cytochrome P4501A metabolism. Toxicol. Appl. Pharmacol. 217: 308–321. Jenny, M. J., Karchner, S. I., Franks, D. G., Woodin, B. R., Stegeman, J. J., and Hahn, M. E. 2009. Distinct roles of two zebrafish AHR repressors (AHRRa and AHRRb) in embryonic development and regulating the response to 2,3,7,8-tetrachlorodibenzo-pdioxin. Toxicol. Sci. 110: 426–441. Karchner, S. I., Franks, D. G., and Hahn, M. E. 2005. AHR1B, a new functional aryl hydrocarbon receptor in zebrafish: Tandem arrangement of ahr1b and ahr2 genes. Biochem. J. 392: 153–161. Martin-Skilton, R., Thibaut, R., and Porte, C. 2006. Endocrine alteration in juvenile
I. SALABERRIA ET AL.
cod and turbot exposed to dispersed crude oil and alkylphenols. Aquat. Toxicol. 78: S57–S64. Matthews, J., and Gustafsson, J.-Å. 2006. Estrogen receptor and aryl hydrocarbon receptor signaling pathways. Nuclear Receptor Signaling 4: e016. Melbye, A. G., Brakstad, O. G., Hokstad, J. N., Gregersen, I. K., Hansen, B. H., Booth, A. M., Rowland, S. J., and Tollefsen, K. E. 2009. Chemical and toxicological characterization of an unresolved complex mixturerich biodegraded crude oil. Environ. Toxicol. Chem. 28: 1815–1824. Navas, J. M., Babin, M., Casado, S., Fernandez, C., and Tarazona, J. V. 2006. The Prestige oil spill: A laboratory study about the toxicity of the water-soluble fraction of the fuel oil. Mar. Environ. Res. 62: S352–S355. Nordtug, T., Olsen, A. J., Altin, D., Overrein, I., Storoy, W., Hansen, B. H., and De Laender, F. 2011. Oil droplets do not affect assimilation and survival probability of first feeding larvae of North-East Arctic cod. Sci. Total Environ. 412: 148–153. Ohtake, F., Baba, A., Takada, I., Okada, M., Iwasaki K., Miki, H., Takahashi, S., Kouzmenko, A., Nohara, K., Chiba, T., FujiiKuriyama, Y., and Kato, S. 2007. Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature 446: 562–566. Ota, M., Saito, T., Yoshizaki, G., and Otsuki, A. 2000. Vitellogenin-like gene expression in liver of male zebrafish (Danio rerio) by 1 μM 3-methylcholanthrene treatment: The possibility of a rapid and sensitive in vivo bioassay. Water Res. 34: 2400–2403. Pastor, D., Sanchez, J., Porte, C., and Albaiges, J. 2001. The Aegean Sea oil spill in the Galicia coast (NW Spain). I. Distribution and fate of the crude oil and combustion products in subtidal sediments. Mar. Pollut. Bull. 42: 895–904. Saco-Alvarez, L., Bellas, J., Nieto, O., Bayona, J. M., Albaiges, J., and Beiras, R. 2008. Toxicity and phototoxicity of water-accommodated fraction obtained from Prestige fuel oil and marine fuel oil evaluated by marine bioassays. Sci. Total Environ. 394: 275–282.
Downloaded by [Universite Laval] at 07:49 09 July 2014
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
Safe, S., and Wormke, M. 2003. Inhibitory aryl hydrocarbon receptor-estrogen receptor a cross-talk and mechanisms of action. Chem. Res. Toxicol. 16: 807–816. Scornaienchi, M. L., Thornton, C., Willett, K. L., and Wilson, J. Y. 2010. Cytochrome P450-mediated 17β-estradiol metabolism in zebrafish (Danio rerio). J. Endocrinol. 206: 317–325. Short, J. W., Irvine, G. V., Mann, D. H., Maselko, J. M., Pella, J. J., Lindeberg, M. R., Payne, J. R., Driskell, W. B., and Rice, S. D. 2007. Slightly weathered Exxon Valdez oil persists in Gulf of Alaska beach sediments after 16 years. Environ. Sci. Technol. 41: 1245–1250. Spink, D. C., Lincoln, D. W., Dickerman, H. W. and Gierthy, J. F. 1990. 2,3,7,8Tetrachlorodibenzo-p-dioxin causes an extensive alteration of 17β-estradiol metabolism in MCF-7 breast tumor cells. Proc. Natl. Acad. Sci. USA 87: 6917–6921. Stiver, W., and Mackay, Environ. Sci. Technol. 18: 834–840.
515
Swedenborg, E., Kotka, M., Seifert, M., Kanno, J., Pongratz, I., and Rueegg, J. 2012. The aryl hydrocarbon receptor ligands 2,3,7,8-tetrachlorodibenzo-p-dioxin and 3-methylcholanthrene regulate distinct genetic networks. Mol. Cell. Endocrinol. 362: 39–47. Tollefsen, K. E., Sundt, R. C., Beyer, J., Meier, S., and Hylland, K. 2011. Endocrine modulation in Atlantic cod (Gadus morhua L.) exposed to alkylphenols, polyaromatic hydrocarbons, produced water, and dispersed oil. J. Toxicol. Environ. Health A 74: 529–542. van der Oost, R., Beyer, J., and Vermeulen, N. P. E. 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: A review. Environ. Toxicol. Pharmacol. 13: 57–149. Van Tiem, L. A., and Di Giulio, R. T. 2011. AHR2 knockdown prevents PAH-mediated cardiac toxicity and XRE- and ARE-associated gene induction in zebrafish (Danio rerio). Toxicol. Appl. Pharmacol. 254: 280–287.
Journal of Toxicology and Environmental Health, Part A: Current Issues Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/uteh20
Endocrine and AhR-CYP1A Pathway Responses to the Water-Soluble Fraction of Oil in Zebrafish (Danio rerio Hamilton) a
b
a
b
Iurgi Salaberria , Odd Gunnar Brakstad , Anders J. Olsen , Trond Nordtug & Bjørn Henrik Hansen
b
a
Department of Biology, Norwegian University of Science and Technology, Trondheim, Norway b
SINTEF Materials and Chemistry, Marine Environmental Technology, Trondheim, Norway Published online: 22 Apr 2014.
To cite this article: Iurgi Salaberria, Odd Gunnar Brakstad, Anders J. Olsen, Trond Nordtug & Bjørn Henrik Hansen (2014) Endocrine and AhR-CYP1A Pathway Responses to the Water-Soluble Fraction of Oil in Zebrafish (Danio rerio Hamilton), Journal of Toxicology and Environmental Health, Part A: Current Issues, 77:9-11, 506-515, DOI: 10.1080/15287394.2014.886983 To link to this article: http://dx.doi.org/10.1080/15287394.2014.886983
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Journal of Toxicology and Environmental Health, Part A, 77:506–515, 2014 Copyright © Taylor & Francis Group, LLC ISSN: 1528-7394 print / 1087-2620 online DOI: 10.1080/15287394.2014.886983
ENDOCRINE AND AhR-CYP1A PATHWAY RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL IN ZEBRAFISH (Danio rerio HAMILTON) Iurgi Salaberria1, Odd Gunnar Brakstad2, Anders J. Olsen1, Trond Nordtug2, Bjørn Henrik Hansen2 1
Downloaded by [Universite Laval] at 07:49 09 July 2014
2
Department of Biology, Norwegian University of Science and Technology, Trondheim, Norway SINTEF Materials and Chemistry, Marine Environmental Technology, Trondheim, Norway
Crude oil is a complex mixture of compounds of which the water-soluble fraction (WSF) is considered to be bioavailable and potentially toxic to aquatic biota. Containing numerous compounds, WSF becomes a source of multiple chemical stressors to wildlife when introduced into the environment. To study the combined effects of WSF components on aquatic biota, the model species zebrafish (Danio rerio Hamilton) was exposed for 24 or 72 h to 10 or 50% WSF solution of known composition, generated from artificially weathered North Sea crude oil. Hepatic expression of genes involved in the aryl hydrocarbon receptor-cytochrome P-450 1A (AhR-CYP1A) pathway (AhR2, AhRR1, CYP1A1) and steroidogenesis (StAR, CYP11A, 3β-HSD, CYP19A, CYP19B) was measured, as well as estrogen receptors ERα and ERβ1. Induction of CYP1A and particularly of AhRR1 was observed while ERα and steroidogenic enzymes CYP11A and 3β-HSD were downregulated. Regression analysis demonstrated a negative relationship between AhR-CYP1A pathway and endocrine transcript levels, although causality remains to be established. These findings indicate that exposure to WSF of oil disrupts steroidogenesis and may therefore constitute a potential risk for reproductive ability of aquatic organisms. In addition, it is proposed that hepatic gene expression of AhRR1 may serve as a novel biomarker of WSF exposure.
2011; Hansen et al., 2013). In addition, unresolved complex mixtures (UCM) may contribute to aquatic toxicology (Melbye et al., 2009). Thus, aquatic organisms inhabiting oilpolluted waters are exposed to a complex mixture of both known and unknown oil constituents whose biological effects remain to be investigated. Xenobiotics including the compounds that constitute WSF are metabolized by cytochrome P-450 enzymes (CYP). More specifically, WSF (Navas et al., 2006; Arukwe et al., 2008) and several of its individual constituents were shown to induce hepatic CYP1A by interaction with the aryl hydrocarbon receptor (AhR) (Bols et al., 1999; Denison and Nagy, 2003). The
Crude oil enters the aquatic environment following accidental and regular discharges related to production, transport, and use of petroleum products. When suspended in the water column, oil is submitted to weathering by drifting, dispersion, dissolution, adhesion to sediments, emulsification, loss of volatile constituents, and photo- and biodegradation (Pastor et al., 2001; Short et al., 2007). These processes create a multi-compound watersoluble fraction (WSF) of the oil which is bioavailable and toxic to aquatic organisms (Melbye et al., 2009). Typically toxicity of WSF is attributed to non-polar naphthalenes and polycyclic aromatic hydrocarbons (PAH), and to alkylated phenols (Nordtug et al.,
Address correspondence to Iurgi Salaberria, Norwegian University of Science and Technology, Department of Biology, N-7491 Trondheim, Norway. E-mail: [email protected] and [email protected] 506
Downloaded by [Universite Laval] at 07:49 09 July 2014
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
zebrafish (Danio rerio Hamilton; Cyprinidae) has three characterized AhRs (AhR1A, AhR1B, and AhR2) (Karchner et al., 2005), of which AhR2 mediates developmental and cardiac toxicity of PAH in zebrafish (Incardona et al., 2006; Van Tiem and Di Giulio, 2011). AhR activity is regulated by an AhR repressor (AhRR), which is induced by the AhR itself and thus forms a negative feedback loop for AhR regulation (Evans et al., 2005). Zebrafish have two characterized AhRR, AhRR1 and AhRR2 (or AhRRa and AhRRb, respectively), with similar roles: They repress AhR2-dependent transactivation to a similar extent and both modulate aromatic hydrocarbon embryotoxicity (Evans et al., 2005, 2008), although some subfunction partitioning occurred (Jenny et al., 2009). Although CYP1A catalyzes the oxidation of xenobiotic molecules such as PAH, its physiological role is to biotransform endogenous compounds. For example, CYP1A and CYP1C are primarily responsible for the metabolism of the estrogen 17β-estradiol (E2) in zebrafish (Scornaienchi et al., 2010). By competing with E2 for CYP1A binding sites and/or by stimulating CYP1A activity, WSF constituents potentially alter E2 metabolism. While CYP1A is known to be induced by WSF and its constituents, little is known regarding the effects of these compounds on CYP involved in de novo synthesis of steroids and on other steroidogenic enzymes. In addition, the PAH 3-methylcholanthrene (3-MC) was found to exert predominantly estrogenic effects by activating estrogen receptor α (ERα) without binding the receptor, possibly mediated by cross-talk between the AhR and ER pathways (Ohtake et al., 2007; Swedenborg et al., 2012). This may affect ERα-mediated processes such as vitellogenesis in fish liver (Ota et al., 2000). Thus, it was of interest to investigate the effects of WSF on the endocrine system. Simultaneously, there is a need for early warning systems of WSF exposure in aquatic biota. Therefore, in vivo effects of the WSF of artificially weathered North Sea oil were studied on hepatic expression of genes involved in the AhR-CYP1A pathway and in steroidogenesis, and of ER genes in an ecotoxicological model species, the zebrafish.
507
METHODS Generation of the Water-Soluble Fraction of Oil Crude oil from the northern part of the North Sea was selected as representative oil for the study. The oil was artificially weathered by heating to 200◦ C to remove volatile compounds (Stiver and Mackay, 1984), and the +200◦ C residue was collected and used for generation of WSF according to Croserf methodology (Aurand and Coelho, 1996): 10-L baked glass bottles were filled with tap water (9.0 L), and oil (225 g) was carefully added onto the surface alongside a glass tube, giving a loading of 1:40 oil:water ratio. To avoid the formation of oil droplets, low-energy magnetic stirring was applied for 72 h before the water phase was siphoned off and used for the experiments.
Chemical Analysis Samples for chemical analysis (approximately 900 ml each) were collected from the prepared WSF prior to the exposure experiments and acidified with diluted hydrochloric acid. Acidified water samples were extracted with dichloromethane (DCM), dried over Na2 SO4 , and concentrated to 1 ml. Analysis of 58 semivolatile compounds in the 100% WSF solution, including phenols, naphthalenes, and three- to five-ring polycyclic aromatic hydrocarbons (PAH), was performed by gas chromatography–mass spectrometry (GC-MS) operated in selected ion monitoring (SIM) mode. The system comprised of an HP6890N gas chromatograph fitted with a HewlettPackard HP7683B Series autosampler and a HP5975B quadrupole mass-selective detector. The column is a Phenomenex ZB-5MS fused silica capillary column (30 m × 0.25 mm ID × 0.25 μm film thickness). Helium was used as the carrier gas at a constant flow of 1 ml/min. A 1-μl sample was injected into a 310◦ C splitless injector. The oven temperature was programmed from 40◦ C for 1 min, then to 315◦ C at 6◦ C/min and held for 15 min. Data and chromatograms were monitored and recorded using MSD ChemStation (version
508
I. SALABERRIA ET AL.
D.03.00.611) software. The quadrupole mass spectrometer ion source temperature was 230◦ C.
Downloaded by [Universite Laval] at 07:49 09 July 2014
Fish Exposure and Experimental Design Adult zebrafish of an unspecified wild-type line were purchased from a local pet shop and reared in glass aquaria (2.2 L) with continuous water flow (1 L/min/kg fish). Fish were fed daily with standard aquarium fish meal, and acclimated for a week to the same temperature and light regime as used during the exposure experiment: 28◦ C and 14:10-h light/dark cycle. Eighteen fish were evenly distributed among three tanks (n = 6). The control tank contained clean water and the remaining 2 tanks contained either 10% or 50% WSF solution. Three fish from each tank were sampled after 24 h of exposure, and the remaining 3 fish after 72 h of exposure. Livers were dissected at sampling and stored in RNAlater while awaiting gene expression analysis. RNA Sampling and Extraction Total RNA was extracted using the RNeasy Protect Mini Kit (Qiagen, Crawley, UK) according to the manufacturer’s protocol. Contaminating DNA was removed by DNAase I treatment (DNAfree kit, Ambion, Austin, TX). The concentrations and quality of RNA in samples were assessed by electrophoresis on 1.5% formaldehyde–agarose gels (BioRad Laboratories, Hercules, CA) to confirm integrity of 18S and 28S rRNA bands; purity and concentration were assessed by measurements of absorption at 260 and 280 nm. The 260/280 absorption ratio of 1.9–2.1 indicated pure RNA samples. Real-Time RT-PCR Single-strand cDNA was synthesized from 250 ng of total RNA using the Bio-Rad cDNAsynthesis kit (Bio-Rad). Thereafter cDNA was diluted 1:5 in diethylpyrocarbonate-treated water (DEPC-water). Every sample was analyzed in duplicate. The accession numbers
of the genes used in our study and the primer sequences are shown in Table 1. Amplification of cDNA was monitored using real-time polymerase chain reaction (PCR), performed with the Mx3000P Real-Time PCR System (Stratagene, La Jolla, CA). Each 25-μl DNA amplification reaction contained 12.5 μl of iTaq SYBR Green Supermix with ROX (BioRad) and forward and reverse primers (400 nM concentration of each), and 5 μl diluted cDNA as template. The RT-PCR program included an enzyme activation step at 95◦ C (10 min) and 40 cycles of 95◦ C (30 s), 60◦ C (1 min), and 72◦ C (30 s). Dissociation curves of the PCR products were obtained by gradual heating of the samples from 55 to 95◦ C, and reaction specificity was determined when one peak in the dissociation curve was obtained.
Data Analysis The Mann–Whitney U-test was applied to assess for statistically significant differences in gene expression between controls and each WSF treatment separately (p ≤ .05). Regression analysis was applied to assess for relationships between variables. All data were analyzed using IBM SPSS Statistics Version 20 (International Business Machines Corp., New York, NY).
RESULTS GC-MS analysis of the 100% WSF solution showed a predominance of C0–C4 naphthalenes (64%) and phenols (29%) among the measured analytes (Table 2). Composition of the WSF used in the present study also showed as comparable to that of produced water (i.e., oil production effluent) collected at the same location in the North Sea as the WSF (data not shown). Hepatic expression of AhR2 was not markedly altered by WSF exposure (Figure 1A). In contrast, AhRR1 was significantly upregulated by both 10 and 50% WSF after 24 or 72 h of exposure (Figure 1B). CYP1A expression was significantly raised compared to controls after
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
509
TABLE 1. Primer Pair Sequences, Accession Numbers, and Amplicon Size for Genes of Interest Used for Real-Time PCR Primer sequence∗ Target gene
Forward
AhR2 AhRR1 CYP1A1 StAR CYP11A 3β-HSD CYP19A CYP19B ERα ERβ1
CTACTTGGGCTTCCATCAGTCG GCGCATCAAGAGCTTCTGCAGCGTGTT AATCCCAGACGGGCTACA ACCTGTTTTCTGGCTGGGATG AGGGCCATCACCCCAATAG GCAACTCTGGTTTTCCACACTG CTGAAAGGGCTCAGGACAA CGACAGGCCATCAATAACA AAACACAGTCGGCCCTACAC TGATTAGCTGGGCGAAGA
∗ Sequences
Reverse
Amplicon size (nucleo-tides)
GenBank accession number
GTCACTTGAGGGATTGAGAGCG CCACTGACGACCAGCGCAAACCCT CCGGGCCATAGCACTTAC GGGTCCATTCTCAGCCCTTAC CCAGGCCTTCCCTTCTTTTAG CAGCAGGAGCCGTGTAGCTT TGGTCGATGGTGTCTGATG CGTCCACAGACAGCTCATC GCCAAGAGCTCTCCAACAAC TATCCAGCCAGCAGCATT
118 149 122 81 101 102 92 94 157 87
NM131264 AY928203 AF210727 NM131663 AF527755 AY279108 AF226620 AF183908 AF268283 AJ414566
are given in the 5 –3 order.
Downloaded by [Universite Laval] at 07:49 09 July 2014
TABLE 2. Composition of the Water-Soluble Fraction (WSF) (100% Solution) Residue
μg/L
Residue
μg/L
Decalin C1-decalins C2-decalins C3-decalins C4-decalins Benzo[b]thiophene C1-benzo[b]thiophenes C2-benzo[b]thiophenes C3-benzo[b]thiophenes C4-benzo[b]thiophenes Naphthalene C1-naphthalenes C2-naphthalenes C3-naphthalenes C4-naphthalenes Biphenyl Acenaphthylene Acenaphthene Dibenzofuran Fluorene C1-fluorenes C2-fluorenes C3-fluorenes Phenanthrene Anthracene C1-phenanthrenes/anthracenes C2-phenanthrenes/anthracenes C3-phenanthrenes/anthracenes C4-phenanthrenes/anthracenes
0.53 0.28 ND ND ND ND ND ND ND 1.48 101 120 64.1 14.4 ND 12.0 0.05 0.79 1.16 2.69 3.42 3.08 ND 1.98 0.12 2.16 0.87 ND ND
Dibenzothiophene C1-dibenzothiophenes C2-dibenzothiophenes C3-dibenzothiophenes C4-dibenzothiophenes Fluoranthene Pyrene C1-fluoranthrenes/pyrenes C2-fluoranthenes/pyrenes C3-fluoranthenes/pyrenes Benz[a]anthracene Chrysene C1-chrysenes C2-chrysenes C3-chrysenes C4-chrysenes Benzo[b]fluoranthene Benzo[k]fluoranthene Benzo[e]pyrene Benzo[a]pyrene Perylene Indeno[1.2.3-c.d]pyrene Dibenz[a.h]anthracene Benzo[g.h.i]perylene Phenol C1-Phenols (o/m- and p-cresol) C2-Phenols C3-Phenols C4-Phenols
0.38 1.17 0.68 ND ND 0.03 0.03 0.10 0.01 ND ND 0.01 ND ND ND ND ND ND ND ND ND ND ND ND 0.30 0.42 32.6 47.7 52.5
exposure to 50% WSF but not to 10% WSF after 24 or 72 h of exposure (Figure 1C). Among the endocrine endpoints analyzed only steroidogenic acute regulatory protein (StAR) mRNA levels were significantly elevated by WSF (10% solution) after 24 h of exposure, but at 72 h StAR expression returned
to control levels (Figure 2A). Both cytochrome P-450 side-chain cleavage (CYP11A) and 3βhydroxysteroid dehydrogenase (3β-HSD) transcript levels were suppressed after 72 h of exposure to 50% WSF (Figures 2B and 2C). Fish exposed to 10 and 50% WSF for 24 h showed relatively low expression of 3β-HSD,
I. SALABERRIA ET AL.
Downloaded by [Universite Laval] at 07:49 09 July 2014
510
FIGURE 1. Hepatic expression of genes (as percent of control) involved in the AhR-CYP1A pathway: (A) aryl hydrocarbon receptor 2 (AhR2), (B) AhR repressor 1 (AhRR1), and (C) cytochrome P-450 1A (CYP1A) in zebrafish exposed to either 10% (gray bars) or 50% water-soluble fraction (WSF) solution (black bars) compared to controls (white bars), with exposure for either 24 or 72 h. Bars represent mean and whiskers standard error of mean (SEM). Asterisks denote statistical difference compared to control (p ≤ .05).
FIGURE 2. Hepatic expression of genes (as percent of control) involved in steroidogenesis: (A) steroidogenic acute regulatory protein (StAR), (B) cytochrome P-450 side-chain cleavage (CYP11A), and (C) 3β-hydroxysteroid dehydrogenase (3β-HSD) in zebrafish exposed to either 10% (gray bars) or 50% watersoluble fraction (WSF) solution (black bars) compared to controls (white bars), with exposure for either 24 or 72 h. Bars represent mean and whiskers standard error of mean (SEM). Asterisks denote statistical difference compared to control (p ≤ .05).
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
Downloaded by [Universite Laval] at 07:49 09 July 2014
which however was not significantly different from controls due to relatively large variation in the latter (Figure 2C). Expression of aromatase genes CYP19A and 19B was not markedly affected by WSF exposure regime (Figures 3A and 3β). Expression of estrogen receptor a (ERα) was significantly downregulated by 10% WSF after 72 h of exposure, whereas no significant effects on ERβ were observed (Figures 3C and 3D). Three negative relationships between AhR-CYP1A pathway and endocrine responses were observed: between AhRR1 and ERα, AhRR1 and 3β-HSD, and CYP1A and CYP19A (Table 3). DISCUSSION Generally, AhR-CYP1A pathway responses were upregulated in WSF-exposed zebrafish (Figure 1). The observed increases in CYP1A and AhRR1 expression are in agreement with previous observations in fish after exposure to aromatic hydrocarbons (Evans et al., 2005; Jenny et al., 2009). Numerous petrogenic PAH induce AhRR and CYP1A by activating the AhR2, which mediates the adverse effects of these compounds in zebrafish (Incardona et al., 2006; Van Tiem and Di Giulio, 2011). However, in the fish of the present study this stimulation of AhRR1 and CYP1A was not accompanied by an increase in AhR2 expression, and a dose-dependent decrease of AhR2 mRNA was noted previously in WSFexposed zebrafish (Arukwe et al., 2008). This may be attributed to the fact that AhR suppresses itself by inducing AhRR. AhR competes mainly with AhRR for associating with AhR nuclear translocator (ARNT) and for binding to the xenobiotic response element (XRE) on DNA. In addition, the AhRR–ARNT complex also acts as a repressor when bound to XRE. This repressor is induced by AhR itself and thus forms a negative feedback loop for AhR regulation (Evans et al., 2008). AhRR1 was the only one of all the endpoints measured herein to be altered consistently by WSF in a dose-dependent fashion, exhibiting elevated expression following 24 h
511
of exposure to 10% WSF (Figure 1C). In other words, WSF exerted a more rapid and pronounced stimulatory effect on AhRR1 (up to nearly 100-fold of control values) than on CYP1A, an established sensitive biomarker for PAH exposure (van der Oost et al., 2003). This may indicate an important role for AhRR1 as a potential early warning system for WSF exposure in fish. Concomitant with stimulation of the AhRCYP1A pathway, an overall downregulation of endocrine endpoints was observed in fish of the present study after WSF exposure (Figures 2 and 3). Transcription of steroidogenic enzymes CYP11A and 3β-HSD was significantly reduced. Transcription of the aromatase genes was not significantly altered by WSF in zebrafish (Figure 3A-B). However, the negative relationship between CYP19A and CYP1A, the latter of which was induced significantly, indicates a downward trend in CYP19A (Table 3). This is consistent with previous reports of suppressed StAR, CYP11A, 17β-hydroxysteroid dehydrogenase (17β-HSD), CYP19A, and CYP19B observed in zebrafish exposed to North Sea WSF or produced water components (Arukwe et al., 2008; Holth et al., 2008). Suppression of steroidogenesis might result in decreased concentrations of steroid hormones such as testosterone (T) and E2. Indeed, teleosts exposed to WSF-produced water or oil were found to exhibit lowered circulating levels of T and sometimes E2 (Arukwe et al., 2008; Martin-Skilton et al., 2006), and E2-induced egg yolk precursor vitellogenin (Vtg) (Hylland et al., 2008), although not consistently (Tollefsen et al., 2011). Diminished ERα expression was observed in WSF-exposed zebrafish (Figure 3C), consistent with previous findings (Arukwe et al., 2008; Bilbao et al., 2010). This may be associated with inhibitory cross-talk between AhR and ERα (Safe and Wormke, 2003). Indeed, AhR ligands were noted to inhibit AhRmediated expression of the ERα and Vtg genes and to abolish E2-induced accumulation of ERα mRNA in fish liver (Bemanian et al., 2004). It is postulated that enhanced E2 metabolism is one of the possible mechanisms by which inhibitory
Downloaded by [Universite Laval] at 07:49 09 July 2014
512
I. SALABERRIA ET AL.
FIGURE 3. Hepatic gene expression (as percent of control) of (A) aromatase A (CYP19A), (B) aromatase B (CYP19B), (C) estrogen receptor a (ERα), and (D) estrogen receptor b1 (ERβ1) in zebrafish exposed to either 10% (gray bars) or 50% water-soluble fraction (WSF) solution (black bars) compared to controls (white bars), with exposure for either 24 or 72 h. Bars represent mean and whiskers standard error of mean (SEM). Asterisks denote statistical difference compared to control (p ≤ .05).
AhR-ERα cross-talk may occur (Safe and Wormke, 2003). AhR binding by ligands such as PAH stimulates CYP1A, which in zebrafish, together with CYP1C, is primarily responsible for the metabolism of E2 (Scornaienchi et al., 2010). Increased CYP1A activity may accelerate E2 metabolism and hence reduce blood E2 levels (Spink et al., 1990). Other possible mechanisms of inhibitory AhR-ERα cross-talk are (1) induction of inhibitory factors, (2) direct inhibition via inhibitory XRE (iXREs), (3) competition for common nuclear coregulatory proteins, and (4) increased proteasome-dependent degradation of ERα (Safe and Wormke, 2003; Matthews and Gustafsson, 2006). It is noteworthy that most inhibitory AhR-ER crosstalk studies were performed with 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD), and it remains to be established whether petrogenic PAH and other WSF constituents might
TABLE 3. Relationships Between AhR-CYP1A Pathway and Endocrine Responses in Zebrafish Liver R2
p
Log10 (CYP1A) = 2.796 – (0.326∗ Log10 (CYP19a)) 0.318 .015 Log10 (AhRR1) = 4.330 – (0.963∗ Log10 (ERα)) 0.333 .012 Log10 (AhRR1) = 3.194 – (0.435∗ Log10 (3β – HSD)) 0.419 .009
elicit similar effects. However, the fact that in WSF-exposed fish of the present study AhRR1 relates negatively with ERα may indicate potential AhR-mediated endocrine disruption (Table 3). Significant negative relationships between AhR-CYP1A pathway and endocrine endpoints observed in fish of the present study suggest effects of WSF on these two physiological processes may be linked (Table 3). AhRR1 was found to show a negative relationship with both ERα and 3β-HSD, adding weight to the
Downloaded by [Universite Laval] at 07:49 09 July 2014
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
postulation that AhRR1 plays a central role in the responses to WSF exposure. However, it needs to be emphasized that causality of these relationships remains to be established. Ultimately, the exact nature and intensity of the biological effects of WSF depend on its composition, which varies with time and origin. The WSF used in the present study showed predominance of naphthalenes and phenols (Table 2) but contained also UCM. Previous reports indicated that adverse effects of oil in fish may not be exclusively associated with naphthalenes, PAH, and alkylated phenols present in the oil (González-Doncel et al., 2008; Saco-Álvarez et al., 2008) but also associated to branched alkyl indanes and tetralins of UCM (Booth et al., 2008). In summary, an overall suppression of endocrine responses was observed in WSFexposed zebrafish that was inversely related to stimulation of the AhR-CYP1A pathway, although causality remains to be established. Hepatic expression of AhRR1 showed a more rapid and pronounced response to WSF than that of CYP1A, thereby becoming a potential candidate for use as an early warning system following WSF exposure. FUNDING This study was a strategic self-financed project (SEP) financed by SINTEF Materials and Chemistry. The authors thank Prof. A. Arukwe at the Department of Biology of the Norwegian University of Science and Technology for kindly providing access to RT-PCR equipment. REFERENCES Arukwe, A., Nordtug, T., Kortner, T. M., Mortensen, A. S., and Brakstad, O. G. 2008. Modulation of steroidogenesis and xenobiotic biotransformation responses in zebrafish (Danio rerio) exposed to water-soluble fraction of crude oil. Environ. Res. 107: 362–370. Aurand, D., and Coehlo, G. 1996. Proceedings of the 4th meeting of the chemical response to oil spills: Ecological Effects
513
Research Forum (CROSERF), 50. Purceville VA: Ecosystem Management & Associates. Bemanian, V., Male, R., and Goksøyr, A. 2004. The aryl hydrocarbon receptor-mediated disruption of vitellogenin synthesis in the fish liver: cross-talk between AHR- and erasignalling pathways. Comp. Hepatol. 3: 2. Bilbao, E., Raingeard, D., Diaz de Cerio, O., Ortiz-Zarragoitia, M., Ruiz, P., Izagirre, U., Orbea, A., Marigómez, I., Cajaraville, M. P., and Cancio, I. 2010. Effects of exposure to Prestige-like heavy fuel oil and to perfluorooctane sulfonate on conventional biomarkers and target gene transcription in the Thicklip grey mullet Chelon labrosus. Aquat. Toxicol. 98: 282–296. Bols, N. C., Schirmer, K., Joyce, E. M., Dixon, D. G., Greenberg, B. M., and Whyte, J. J. 1999. Ability of polycyclic aromatic hydrocarbons to induce 7-ethoxyresorufinO-deethylase activity in a trout liver cell line. Ecotoxicol. Environ. Safety 44: 118–128. Booth, A. M., Scarlett, A. G., Lewis, C. A., Belt, S. T., and Rowland, S. J. 2008. Unresolved complex mixtures (UCMs) of aromatic hydrocarbons: Branched alkyl indanes and branched alkyl tetralins are present in UCMs and accumulated by and toxic to, the mussel Mytilus edulis. Environ. Sci. Technol. 42: 8122–8126. Denison, M. S., and Nagy, S. R. 2003. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu. Rev. Pharmacol. Toxicol. 43: 309–334. Evans, B. R., Karchner, S. I., Allan, L. L., Pollenz, R. S., Tanguay, R. L., Jenny, M. J., Sherr, D. H., and Hahn, M. E. 2008. Repression of aryl hydrocarbon receptor (AHR) signaling by AHR repressor: Role of DNA binding and competition for AHR nuclear translocator. Mol. Pharmacol. 73: 387–398. Evans, B. R., Karchner, S. I., Franks, D. G., and Hahn, M. E. 2005. Duplicate aryl hydrocarbon receptor repressor genes (ahrr1 and ahrr2) in the zebrafish Danio rerio: Structure, function, evolution, and AHR-dependent regulation in vivo. Arch. Biochem. Biophys. 441: 151–167.
Downloaded by [Universite Laval] at 07:49 09 July 2014
514
González-Doncel, M., González, L., Fernandez-Torija, C., Navas, J. M., and Tarazona, J. V. 2008. Toxic effects of an oil spill on fish early life stages may not be exclusively associated to PAHs: Studies with Prestige oil and medaka (Oryzias latipes). Aquat. Toxicol. 87: 280–288. Hansen, B. H., Altin, D., Øverjordet, I. B., Jager, T., and Nordtug, T. 2013. Acute exposure of water soluble fractions of marine diesel on Arctic Calanus glacialis and boreal Calanus finmarchicus: Effects on survival and biomarker response. Sci. Total Environ. 449: 276–284. Holth, T. F., Nourizadeh-Lillabadi, R., Blaesbjerg, M., Grung, M., Holbech, H., Petersen, G. I., Alestrom, P., and Hylland, K. 2008. Differential gene expression and biomarkers in zebrafish (Danio rerio) following exposure to produced water components. Aquat. Toxicol. 90: 277–291. Hylland, K., Tollefsen, K.-E., Ruus, A., Jonsson, G., Sundt, R. C., Sanni, S., Utvik, T. I. R., Johnsen, S., Nilssen, I., Pinturier, L., Balk, L., Barsiene, J., Marigómez, I., Feist, S. W., and Børseth, J. F. 2008. Water column monitoring near oil installations in the North Sea 2001–2004. Mar. Pollut. Bull. 56: 414–429. Incardona, J. P., Day, H. L., Collier, T. K., and Scholz, N. L. 2006. Developmental toxicity of 4-ring polycyclic aromatic hydrocarbons in zebrafish is differentially dependent on AH receptor isoforms and hepatic cytochrome P4501A metabolism. Toxicol. Appl. Pharmacol. 217: 308–321. Jenny, M. J., Karchner, S. I., Franks, D. G., Woodin, B. R., Stegeman, J. J., and Hahn, M. E. 2009. Distinct roles of two zebrafish AHR repressors (AHRRa and AHRRb) in embryonic development and regulating the response to 2,3,7,8-tetrachlorodibenzo-pdioxin. Toxicol. Sci. 110: 426–441. Karchner, S. I., Franks, D. G., and Hahn, M. E. 2005. AHR1B, a new functional aryl hydrocarbon receptor in zebrafish: Tandem arrangement of ahr1b and ahr2 genes. Biochem. J. 392: 153–161. Martin-Skilton, R., Thibaut, R., and Porte, C. 2006. Endocrine alteration in juvenile
I. SALABERRIA ET AL.
cod and turbot exposed to dispersed crude oil and alkylphenols. Aquat. Toxicol. 78: S57–S64. Matthews, J., and Gustafsson, J.-Å. 2006. Estrogen receptor and aryl hydrocarbon receptor signaling pathways. Nuclear Receptor Signaling 4: e016. Melbye, A. G., Brakstad, O. G., Hokstad, J. N., Gregersen, I. K., Hansen, B. H., Booth, A. M., Rowland, S. J., and Tollefsen, K. E. 2009. Chemical and toxicological characterization of an unresolved complex mixturerich biodegraded crude oil. Environ. Toxicol. Chem. 28: 1815–1824. Navas, J. M., Babin, M., Casado, S., Fernandez, C., and Tarazona, J. V. 2006. The Prestige oil spill: A laboratory study about the toxicity of the water-soluble fraction of the fuel oil. Mar. Environ. Res. 62: S352–S355. Nordtug, T., Olsen, A. J., Altin, D., Overrein, I., Storoy, W., Hansen, B. H., and De Laender, F. 2011. Oil droplets do not affect assimilation and survival probability of first feeding larvae of North-East Arctic cod. Sci. Total Environ. 412: 148–153. Ohtake, F., Baba, A., Takada, I., Okada, M., Iwasaki K., Miki, H., Takahashi, S., Kouzmenko, A., Nohara, K., Chiba, T., FujiiKuriyama, Y., and Kato, S. 2007. Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature 446: 562–566. Ota, M., Saito, T., Yoshizaki, G., and Otsuki, A. 2000. Vitellogenin-like gene expression in liver of male zebrafish (Danio rerio) by 1 μM 3-methylcholanthrene treatment: The possibility of a rapid and sensitive in vivo bioassay. Water Res. 34: 2400–2403. Pastor, D., Sanchez, J., Porte, C., and Albaiges, J. 2001. The Aegean Sea oil spill in the Galicia coast (NW Spain). I. Distribution and fate of the crude oil and combustion products in subtidal sediments. Mar. Pollut. Bull. 42: 895–904. Saco-Alvarez, L., Bellas, J., Nieto, O., Bayona, J. M., Albaiges, J., and Beiras, R. 2008. Toxicity and phototoxicity of water-accommodated fraction obtained from Prestige fuel oil and marine fuel oil evaluated by marine bioassays. Sci. Total Environ. 394: 275–282.
Downloaded by [Universite Laval] at 07:49 09 July 2014
RESPONSES TO THE WATER-SOLUBLE FRACTION OF OIL
Safe, S., and Wormke, M. 2003. Inhibitory aryl hydrocarbon receptor-estrogen receptor a cross-talk and mechanisms of action. Chem. Res. Toxicol. 16: 807–816. Scornaienchi, M. L., Thornton, C., Willett, K. L., and Wilson, J. Y. 2010. Cytochrome P450-mediated 17β-estradiol metabolism in zebrafish (Danio rerio). J. Endocrinol. 206: 317–325. Short, J. W., Irvine, G. V., Mann, D. H., Maselko, J. M., Pella, J. J., Lindeberg, M. R., Payne, J. R., Driskell, W. B., and Rice, S. D. 2007. Slightly weathered Exxon Valdez oil persists in Gulf of Alaska beach sediments after 16 years. Environ. Sci. Technol. 41: 1245–1250. Spink, D. C., Lincoln, D. W., Dickerman, H. W. and Gierthy, J. F. 1990. 2,3,7,8Tetrachlorodibenzo-p-dioxin causes an extensive alteration of 17β-estradiol metabolism in MCF-7 breast tumor cells. Proc. Natl. Acad. Sci. USA 87: 6917–6921. Stiver, W., and Mackay, Environ. Sci. Technol. 18: 834–840.
515
Swedenborg, E., Kotka, M., Seifert, M., Kanno, J., Pongratz, I., and Rueegg, J. 2012. The aryl hydrocarbon receptor ligands 2,3,7,8-tetrachlorodibenzo-p-dioxin and 3-methylcholanthrene regulate distinct genetic networks. Mol. Cell. Endocrinol. 362: 39–47. Tollefsen, K. E., Sundt, R. C., Beyer, J., Meier, S., and Hylland, K. 2011. Endocrine modulation in Atlantic cod (Gadus morhua L.) exposed to alkylphenols, polyaromatic hydrocarbons, produced water, and dispersed oil. J. Toxicol. Environ. Health A 74: 529–542. van der Oost, R., Beyer, J., and Vermeulen, N. P. E. 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: A review. Environ. Toxicol. Pharmacol. 13: 57–149. Van Tiem, L. A., and Di Giulio, R. T. 2011. AHR2 knockdown prevents PAH-mediated cardiac toxicity and XRE- and ARE-associated gene induction in zebrafish (Danio rerio). Toxicol. Appl. Pharmacol. 254: 280–287.
