MOLECULAR AND CELLULAR BIOLOGY, Mar. 1992, p. 1286-1291
Vol. 12, No. 3
0270-7306/92/031286-06$02.00/0 Copyright © 1992, American Society for Microbiology
Embryonal Long Terminal Repeat-Binding Protein Is a Murine Homolog of FTZ-F1, a Member of the Steroid Receptor Superfamily TOSHIO TSUKIYAMA,' HITOSHI UEDA,2 SUSUMU HIROSE,3 AND OHTSURA NIWAl* Department of Pathology, Research Institute for Nuclear Medicine and Biology, Hiroshima University, Minami-ku, Hiroshima 734,1 and Genetic Stock Research Center2 and DI A Research Center, National Institute of Genetics, Mishima 411, Japan Received 22 October 1991/Accepted 4 December 1991
The embryonal long terminal repeat-binding protein, ELP, is present in undifferentiated mouse embryonal carcinoma cells. It binds to and suppresses transcription of the Moloney leukemia virus long terminal repeat in undifferentiated murine embryonal carcinoma cells. We report here that ELP is a mouse homolog of Drosophila FTZ-F1, which positively regulates transcription of the fushi tarazu gene in blastoderm-stage embryos of the fly. As members of the steroid receptor superfamily, ELP and FTZ-Fl have both DNA binding and putative ligand binding domains which are well conserved between the two. ELP and FTZ-F1 function in cells in the extremely early stage of development. A high degree of conservation between the two transcription factors during the evolution of these species indicates the importance of their functions in early-stage embryogenesis. In addition, the sequence elements they recognize do not contain repeat units, in contrast to other steroid receptors, which usually bind to either palindromic or direct repeat sequences.
Stem cells of early-stage mammalian embryos are unique in that they are totipotent in their capacity for differentiation. Tissue-specific genes are repressed tightly in these cells. Tissue-specific activation of genes takes place only after implantation of embryos. In addition to these genes, many viral genomes are also repressed in the stem cells of the preimplantation-stage embryos as well as in undifferentiated embryonal carcinoma cells (EC cells). Analysis of host range mutations in polyomavirus revealed the complex nature of the repression (17). Retroviruses are also the targets of repression in EC cells (5, 19, 28). The mechanism of the repression of Moloney murine leukemia virus (Mo-MuLV) has been the subject of intensive studies, and at least three mechanisms were shown to be responsible for the repression. The amount and number of activator proteins which bind the enhancer region of the long terminal repeat (LTR) are low in undifferentiated EC cells (27). This repression can be circumvented by the insertion of an active enhancer in the LTR (13). It is also abrogated by a mutation which creates an Spl binding site in the enhancer region (9). The 5' noncoding region of the viral genome functions as a negative element in EC cells (14, 32). The host range mutants of Mo-MuLV which can replicate in EC cells carry mutations in this region (38). In addition, we have previously identified an embryonal LTR-binding protein, ELP, which binds to and represses the LTR in undifferentiated EC cells (31). A 10-fold decrease in the transcription was noted in ECA2 cells, a PCC4-derived subline of EC cells, when the ELP binding element was placed upstream of the enhancer of the LTR (33). Again, a mutation at the ELP site in a host range mutant of Mo-MuLV was reported, indicating the importance of the ELP element in repression of Mo-MuLV in EC cells (10). During the attempts to clone the cDNA of ELP, a report in which a Drosophila transcription factor, FTZ-F1, was shown to bind to the same sequence element as ELP appeared (36). Using the cDNA of FTZ-F1 as a probe (12), *
we have succeeded in cloning the cDNA coding for ELP. Analysis of the cDNA indicated that ELP is indeed a mouse homolog of FTZ-F1.
MATERIALS AND METHODS Cell cultures. Cells used in this study were described previously (31). All the cell lines were maintained in minimal essential medium alpha (Irvine Scientific, Santa Ana, Calif.) supplemented with 8% fetal calf serum. Differentiation of ECA2 cells, a subline of PCC4 EC cells, was induced by addition of all-trans retinoic acid (Sigma Chemical Co., St. Louis, Mo.) to 10-6 M in growth medium. Gel retardation assay. Preparation of the nuclear extracts from ECA2 cells (31), Drosophila embryos (36), and the silk gland of Bombyx mon (34) were as described previously. For in vitro translation of cloned ELP cDNA, RNA was transcribed by T7 RNA polymerase from pBS-ELP, in which the open reading frame of the ELP cDNA was placed downstream of the T7 promoter. RNA was then translated in rabbit reticulocyte lysate according to the manufacturer's recommendation (Promega Co., Madison, Wis.). The binding sites for ELP and FTZ-F1 were used as probes for the gel retardation assay. These sequences were terminally labeled to a specific activity of approximately 8 x 103 cpm/fmol. A 2-fmol sample of the probe was used for each lane. As for the competition assay, 40 fmol of the competitor was added to the reaction mixture. The procedure for the gel retardation assays was as described previously (35). Chloramphenicol acetyltransferase (CAT) assay. NIH 3T3 cells in 60-mm dishes were transfected with 0.5 ,ug of reporter plasmids, 5 p.g of effector plasmids, 2 pg of pact-agal and 2.5 ,ug of pUC119. Transfection was done by the CaPO4 method, and the details of the procedure are as described previously (31). Experiments were repeated at least five times, and the data shown in the figures are those for the typical cases. pRV-ELP was constructed by inserting ELP cDNA in expression vector pRVSVneo (24), containing the Rous
Corresponding author. 1286
CLONING OF LTR REPRESSOR IN EC CELLS
VOL. 12, 1992
B
A Probe
EI__
t I i"I7-F1 sitel
a i Lt
/
Extract
.'
l{} Vi lr
Competitor
lBiFFIZ-FI FLP
si te 5'-GCAGCACCGTC'ICAAGGTCGCCGAGTAGGAGAA-3' -VD-----------f tz2NEI VI)--- -f tzlT --_-_______R --------------------ftzIE f tzlG f tz8A -----------C------T FTz-FI f tz9T ---- --- ---C ---H---A-----f tz3L -------------A-----------------~~BmFTZ-Fl ft 7zfE H R --
0
--------------
~~
.0
0
mu~~~~.
0
FLIX
ftz5-15 f t.uJ. ------f ti9E
ftzNtI 1
1287
Y-----
-----
DDY-
Y
,
t rarls ai d i- I'
0
S0
S: 4
9 0 a
S
S
4'
.I
4' 9
ftz3NE2
FIG. 1. (A) Gel retardation analysis of ELP, FTZ-F1, BmFTZ-F1, and in vitro-translated protein products of the ELP cDNA. Probes used are the recognition sites for ELP (ELP site) and FTZ-F1 (FTZ-F1 site I). The complexes are indicated by arrows. Nuclear extracts from ECA2 cells, Drosophila embryos, and the silk glands of B. mon were used as sources of ELP, FTZ-F1, and BmFTZ-F1, respectively. t.1. + and t.1.-, in vitro-translated protein products with and without RNA transcripts of the ELP cDNA, respectively. (B) Comparison of the specificity of sequence recognition of ELP, BmFTZ-F1, and the in vitro translated protein product. Only the bands corresponding to the complexes are shown. The FTZ-F1 site I sequence was used as a probe. The mutated site I sequences were used as competitors and added at a 20-fold excess in the binding reaction mixture. The nucleotide sequences are depicted under the wild-type sequence. Letters denote mixtures of nucleotides: Y, T+C; R, G+A; D, G+A+T; V, G+A+C; B, G+T+C; H, A+T+C.
sarcoma virus (RSV) LTR and the poly(A)+ signal of simian virus 40. As for the negative control, a stop codon linker (New England Biolabs Inc., Beverly, Mass.) was inserted between PmaCI sites in the zinc finger region of ELP in pRV-ELP, and the resulting plasmid was designated pRVELP-ZFS. pMolPKCAT has the enhancer and promoter regions of Mo-MuLV LTR upstream of the CAT gene, and pSP8PKCAT carries eight copies of ELP binding sites upstream of the enhancer region of pMolPKCAT in the same orientation as in the original ELP site (31). The amounts of cell extracts for the CAT assay were normalized by the level of 13-galactosidase activity. Preparation of cell extracts and assay procedures were as described previously (7, 33). cDNA cloning and sequencing. A randomly primed cDNA library of undifferentiated ECA2 cells was constructed on Agtll and screened by plaque hybridization probed by' the zinc finger region of FTZ-F1. The filters were washed in 2x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate)0.5% sodium dodecyl sulfate (SDS) at 65°C for 60 min. DNAs from positive clones were subcloned into pUC119 and sequenced by the dideoxy chain termination method (25). Production of anti-ELP antibody. A DNA fragment of the ELP cDNA from AvaIII to PmaCI (207 to 572 nucleotides), encoding amino acids 4 to 126 of the ELP protein, was cloned into bacterial expression vector pET3a (22). The protein product of the cDNA was extracted from Escherichia coli,. purified by SDS-polyacrylamide gel electrophoresis, and recovered by electroelution. A New Zealand White rabbit was injected subcutaneously with 100 ,ug of the protein product together with Freund's complete adjuvant (Difco Laboratories, Detroit, Mich.). Rabbits were boosted three times with 50 ,ug of the protein at intervals of 2 weeks. Northern analysis. Total cellular RNA was prepared by sedimentation through cesium chloride (3), electrophoresed, and blotted onto membrane filters which were then hybridized as described previously (16). For the blotting, 30 ,ug of total RNA was loaded onto each lane. Filters were washed with O.lx SSC-0.5% SDS at 65°C.
Nucleotide sequence accession number. The nucleotide sequence data reported in this paper will appear in the DDBJ, EMBL, and GenBank nucleotide sequence data bases under accession no. D90530.
RESULTS Binding specificity of ELP and FIZ-Fl. In our previous study, ELP was shown to be present specifically in various undifferentiated EC cells of mouse and human origin. The amount of ELP was especially high in ECA2 cells, a subline of PCC4 cells (31). ELP binds to the sequence element TCAAGGTCA, which is located 12 bp upstream of the enhancer of Mo-MuLV LTR (31). FTZ-F1 is involved in activation of the fushi tarazu gene in early-stage Drosophila embryos by binding to the sequence element YCAAGGYCR in the Zebra element of the gene (36). This sequence completely matches that of the ELP element, suggesting that ELP may have similarity to FTZ-F1. The ELP element and site I, one of the FTZ-F1 elements, were tested for interaction with FTZ-F1, BmFTZ-F1 (the'B. mon homolog of FTZ-F1 [34]), and ELP. BmFTZ-Fl has the same sequence specificity as FTZ-F1 (35). As is clear from Fig. 1A, ELP, FTZ-F1, and BmFTZ-F1 each bound to both of the elements. Although specific activities of the probes were similar, site I of the FTZ-F1 binding element always gave stronger bands than did the ELP site. This suggests that site I of FTZ-F1 may have a higher affinity for all three factors. We then tested by competition assay the specificity of the binding of ELP and BmFTZ-Fl to site I carrying a series of mutations. The patterns of competition were identical between the two factors (Fig. 1B). This indicates that ELP and FTZ-F1 are related and may have sequence homology in the DNA binding domain. Cloning of the mouse homolog of FIZ-Fl. The zinc finger region of the FTZ-F1 cDNA (21) was used as a probe to screen the phage library of undifferentiated ECA2 cells, and one of the isolates contained a complete open reading frame. In order to confirm that this corresponds to that of ELP, an
1288
MOL. CELL. BIOL.
TSUKIYAMA ET AL. 5-ooA!iCCCC:CTCCOTToOCC
AOTACTOOCTOOAO!CTCTOTCTCTTCTAOACTCTCTOCCTCA0OTCTCTOTCOOOOCCC CCAGAACAA!CCAOCTOTOTOCCCSACTTCOCCCTOOTCCCTOOCOTCTOTCTTOCCCO COTCCOAGCCTATCTOATTTTCTCAOAATCOOOOTTTTOTTCTCAOACAAACOAATCTOO ATOO&AATOCATCOAATCCOAOOOTCCCOOATCOOOCOCOOCAOAOOCO.COAOOAAOCA
NetOluNet3iuArgIloArgolyberArgleOlyAr,O1yArOly,loyluOlual.
200
ACCCooCCCoGoCTso@oACCGCCCCOTGTOCACAGACC&oGGCAATCCCAAGCCAoTCo
380
40
leLuLeouProolmAlaAspAlaAlaolyMNtagpTyr
TCOTACOACOAOOACCTOOACOAOCT OTCCAOTOTOTOOTOACAAOOTOTCOOCTAC 8GrTyrAspOluAspL*uAspOluLe yuProValCyuOlyaupLysVal.rolyTJy
500 100
CTACCOOOCTOCST_COTOCOkOAOCTOCAAOOOCTTCTTCAAOCOCACAG!CCAOAAc
560 120
AsmLysEiuTyrThrCysThrOluuerOla.srCysLyUIl1AspLy,ThrOlmArgLy OCTOTCCCTTCTGCCOCTTCCAGAAGTOCCTOACOOTOOOCATOCOCCTGGA
CTSTO
680 160
COTOCTOATCOAATGCGOOOGTGCCOOAACAAGTTTGOOCCCATOTACAAOAGAGACCOO ArgAlaA
740 180
pArgNtArg0glyglyAr;ganLyspb.OlyProM.tTyrLysuargApArg OCCTTGAA0C&CAOCAAGAAAGCACAGATVC@G@CCAATOOCTTCK&&CTOG&GACCOOA AlaLeuLyaOlaglaLyuLyaAlaOlllArgAlaAUn.lyPh.Ly.L.ouluThrOly CTOCACOCACCOOAOCCCAAOOCCCTOOTCTCTOOCCCACCCAOTGOOCCOCT.O.TOAC
920 240
LeuNEiAlarroOlurroLyuAlaL*uValg.rGlyProrro.rOl.ProLuGOlyAop ATTOOACCCCCATCTCTACCCATOTCTOTGCCTGOTCCCCACOGACCTCTOOCTOOCTAC lleGlyAlaProUerLeuProNetgerValProglyproNisglyProLouAla6lyTyr CSCTATCCTOCCTTCTCTAACCOCACCATCAAOTCVG&OTkTCCAOAGCCCT&TOCCAOC LouTyrProklaPhe*er&asArgTh?ll-LJaU.roluTyrproluPro.yrAlal r CCCCCACAACAoCCAGoOCCACCCTACAOCTATCCAGAOCCCTTCTCAOAGOoCCCAAT rrqProgluglnrroglyrroProTyrg.rTyrpro0luProFbr.SrOlyOlyProAn OTACCAGAOCTCATATTOCAGCTGCTGCAJCTA@AOCCAA6GAOGOACCAGOTOCOCOCT ValProgluL-ull-eLeuOlaLouL*uglmOluProOluOluAsp_lAValArgAla
1040 280
CoCATCOTGooCTGoCToCA@AOACCAGCCAAAACCOOCTCTsoACCAoCCACOCCCTTC j.*ra ~ _ _ .
1220
_
I
pUmA
o_ ____ _.
980 260
1100 300
1160 320
1280
GOCAT@OTCTTTAAOGAOCTOAOTASGGCTOACCAGATGACACTGCTCAGAACTOTTOG oluL-uoluyalAlaA.p0l Tr
1340
6CoAoCT@CTGoGTQT
1400
CI M*tVaIVhbLy
MetThrLouLuOl.AsnCys ACCACATCTACCoCCAAGTCCAOTACoOCAAcoAAGACAGC
spPluIleTyrArgOlmValo1uTyralyLyuoluAsp8.r ATCCTOCTOOTTAOTO0ACAO0AGOTAACTOAACTG0XAAACCCCTAOTCCTOCATAAT Il*LeuLeuValSerOlyGlnOluValThrOluL.uValLysProL.uValL ouEiAsa CCCAGOCCTCTCAG@OCTOACTCOGOACACCCCAAATTCCAAATTCAGOGACATOCACTA ProArgProLeuArgAlaAupSerOly.llProLy.Ph-Olull-OIGlylI,EAlaL-u *rgluLeuLeuValL.
360
380 400 1460 420 1520
4O
OCCAOGCTTCTCTGTOTCCTOGOOCCATTTOAGAOACCACASOTGTOAA,GGTCAOTGOA
AlaArgLeuLouCyaValLeuOlyProPheoluoluProOl.Cya.lyXdtValSar0ly
1580 460
AOTTCTTATAGOA@ATAACATOGOAATTOGATCTCCCCAAAATAAGOCAGAOTTGOTCAO Serfer!yrArgArg***
1640
CVsOTACToAAGToACAOETGOCCAoTCTATOCToTCACACATTOoATGCToCAoOATCT A0OACTCAOAOAAGOGATTCOOAATAGGOCCAAGGAACTOTOOOOSOOCAAOGTTAA.AO AT@AO@TTOCAGOCATTOCTAAOGCTSOOTGAOCAGOT@AGACCCTOTAOGTCTCCATTC
1700
TCATAAATOATOAATOAATAAATOAATOAACOAATGAACOAAOOAACACAAOAOTOOCO AAAAG*AAAGAGAOACTCAOACTCA@AATTTOoCCCTTTTAGATCAGAGAATOTATTACOG
O@TO@GAAGTCATTAOGAAOGCCTGGAAACTCCTOAACTCCACCTCCACCCACAOOAaGa ACATTAGOOTTCCTAGTOGATOTGOOTOKAGvAOCCTAAATOTCTOGOOTTTOACACCAT TTAAAGA0-32
4
*CBP
ELP*
i
FIG. 3. Suppression of the binding of ELP by anti-ELP antibody. The preimmune serum and antiserum were tested by gel
retardation assay with nuclear extract of ECA2 cells. The probes used were the site I sequence and the promoter region (XbaI to KpnI) of the Mo-MuLV LTR. CBP, CCAAT box-binding protein (31). Undiluted serum (1 ,ul) was added to 20 p.l of the binding mixture simultaneously with nuclear extracts and incubated for 30 min at room temperature before application to the gel.
340
OCAOAATGOCCOACCAGACCTTTATCTCCATTOTCOACTO6OCACOAAO
lerLeuLv CyArgMNtAlaASpOlmThrPbel-SeerlleValAspTrpAlaAr
0
mW
860 220
AOCCTCCT
-
serum
200
CCACCOATGOGOOTOCCCCCTCCACCCCCTCCCCCACCOOACTACATOTTACCCCCTAOC ProProNetOlyValProProProproProProProProA.pTyrM.tL -r FuProProF
0
620 140
laval
rgCyuProFrhCymArgPheolaLy.CyaL.uThrVally-t7ArSL..l
promoter 0
60
440 so
iasyrOlyLeuLSuThrCyuOluSerCy.Ly.Olrph.phbLy,ArgThrYVaI0As AACAAOCATTAtACOTOCACCOAOATCAAOGOCTOCAAAATCOACAkOACOCCOCOTAA
site I
20
320
bhrArgProOlyLeuglyThrAlaProCyAlaOlTbhrArgAal.lorro..r.la..r CCOTC00CCCOCOCTOACCCGATCCTCCTTCCACAOOC0OACOCCOCOOOCATOOACTAc ProSer&laArgAlaAspproz
Mo-MuLV
probe
260
OCCCTGGAACCCGOTSGCTOCTOCAsCOCAOACATCOCCCACaaACCCccoc
[email protected]
I
20 80 140
465 1760
1820 1880
1940 2000
2060 2068
FIG. 2. Nucleotide and amino acid sequences of the ELP cDNA, numbered on the right. Boxed areas are the zinc finger region (I) and the putative ligand-binding domain (II). Asterisks and underlines in box I indicate the PmaCI sites, between which a stop codon was inserted in the negative control plasmid used for the CAT assay.
in vitro protein product was made from the transcript of the cDNA and used for the gel retardation assay. Figure 1A shows that the in vitro product bound to the ELP site as well as to site I. The mobility of the complex with the in vitro product was slightly lower than that with ELP, and the reason for this is presently unknown. Nevertheless, the results strongly suggest that the cDNA indeed codes for ELP. Further confirmation was made by analyzing the specificity of the binding. Affinity of the in vitro product for the mutant sequences was identical to that of ELP and BmFTZ-Fl (Fig. 1B). Sequence of the cDNA. The cDNA was sequenced, and the result is shown in Fig. 2. The cDNA carried an intact open
reading frame which had a coding capacity for a polypeptide
of 465 amino acids. The molecular mass of the cDNA product was calculated to be 51.3 kDa. The polypeptide has a typical structure of nuclear hormone receptors (2). The DNA binding domain (region I, boxed in Fig. 2) consisted of two zinc finger motifs, and the domain involved in putative ligand binding and dimer formation was located in the C-terminal half. Inhibition of ELP binding by the antibody against the cDNA product. The 5' region of the cDNA was cloned into an expression vector, and the polypeptide spanning the N-terminal portion to the first zinc finger of the putative ELP was produced in E. coli. Gel-purified protein was used to raise antibody in rabbits. The antibody was tested by gel retardation assay. As is clear in Fig. 3, the antibody blocked the formation of the ELP complex with the site I element. This indicates that the antibody raised against the protein product of the cDNA cross-reacted with ELP in a crude nuclear extract of ECA2 cells. The more slowly migrating band appearing after treatment with the antibody may be the tripartite complex of the antibody, ELP, and the probe. The antibody had no effect on the formation of the complex with the promoter region of the Mo-MuLV LTR (nucleotides -150 to + 31). The complex on this fragment was previously shown to be due to the CCAAT box-binding protein in ECA2 cells (31). This confirms the specificity of the antibody. These results clearly demonstrate that the cDNA does code for ELP. Functional analysis of the cDNA product. Figure 4A shows the construction of the reporter plasmids used in the functional assay of ELP. The ELP cDNA was cloned into a mammalian expression vector and tested in NIH 3T3 cells, which completely lacked endogenous ELP activity (31). The efficiency of transfection was normalized by the level of P-galactosidase activity driven by the 1-actin promoter. The ELP expression plasmid contained the 2,068-bp fragment of
VOL. 12, 1992
CLONING OF LTR REPRESSOR IN EC CELLS
A
1289
B ELP sSte
Sau5AI PvuII (-135) ( -3728
6C rlch
TATA
enharce r
reg i on
box
v v
*
Reporter
CrAAT box tl
r
v
AC%
-
43.3
pSP8PKCAT
19.3
23.8 5.7
*
*
99 .
K( I5
P1CUCAT
49.1
35.4
Kcnl
Xmal ( -A50) _
pMoLPKCAT
pRSVCAT
CAT
* OSPSPKCA7
ELP
FIG. 4. Suppression of LTR-driven transcription by forced expression of the cloned ELP cDNA in fibroblasts (14). (A) Constructs of effector plasmids. Eight copies of the Sau3AI (-353) to PvuII (-328) fragment of the LTR were ligated in a head-to-tail orientation. They were placed upstream of the enhancer of pMolPKCAT to make pSP8PKCAT (31). (B) CAT assay. ELP + and -, cotransfection with ELP expression vector, pRV-ELP, and negative control vector, pRV-ELP-ZFS, respectively. AC%, percentage of acetylated chloramphenicol in each assay.
the ELP cDNA placed between the RSV LTR and the poly(A)+ signal of simian virus 40. The negative control plasmid was constructed in a similar fashion, except that the cDNA had a stop codon at the zinc finger region of the cDNA. Experiments were repeated five times, and cotransfection of the ELP construct reproducibly suppressed the CAT activity driven by the LTR containing eight copies of the ELP element by approximately fourfold (Fig. 4B). This suppression was dependent on the amount of the ELP plasmid applied on the cells (data not shown). A low degree of suppression (around twofold) was repeatedly observed for pMolPKCAT, which lacked the ELP site. This may be due to the cryptic ELP target site present in the enhancer region (30a). Transcription from the RSV LTR, which has no ELP site, was not suppressed by the ELP plasmid. These results demonstrate the specificity of the suppression by ELP and confirm that the cDNA carries the coding region of functionally intact ELP.
B
A RA treatment
Expression of ELP mRNA. Expression of ELP mRNA was analyzed during retinoid-induced differentiation of ECA2 cells. As shown in Fig. 5A, expression of ELP decreased until no mRNA was detected at 2 days after the induction. This indicates that expression of ELP is specific in undifferentiated EC cells and is consistent with the result of the gel retardation analysis in which the ELP complex completely disappeared in ECA2 cells treated with retinoid for 2 days (33). As shown in Fig. 5B, ELP mRNA was detected in all of the mouse EC cell lines but not in fibroblastic lines. This was again consistent with the result of the gel retardation assay (31). The apparent lack of ELP mRNA in a human EC line, NEC8, may be due to a low level of expression in this cell line (31) and/or to divergence in the nucleic acid sequences of humans and mice. Sequence comparison of ELP with other nuclear hormone receptors. Figure 6 compares the amino acid sequence of
Th~N
*X>-~
Cell linres
928S
Bass
11
I
,-\
a, \
..
I
n-actin w
\
'14,-
\.-
*28S
U. *18S
*18S
ww~Iw
I
_w ,mw
1w
n-act lfn
FIG. 5. (A) Expression of ELP during differentiation of ECA2 cells. The numbers above the gel indicate the time atter induction of differentiation by retinoic acid. A 1-actin probe was used as a control for the amount of RNA analyzed. (B) Expression of ELP in various cell lines. ECA2, PCC4, PCC3, and F9 cells are mouse EC cells. NEC8 cells are human EC cells. Ltk- and NIH3T3 cells are mouse fibroblasts.
1290
MOL. CELL. BIOL.
TSUKIYAMA ET AL. region 11
Zn finger
ELP
8*5
C~~~~~
FTZ-F1
I
88e.8
ERRI
55.82 521
60.92
37.22
58.02
30.22
862
hRAR ERR2
I
58.02
_
_
39.72
823
COUP-TF(EAR3) 56.52
h6R
56.52
t33
88.22
_
38.92 853
EAR2 55.1X
hTR
M.=Z 30.2Z
hER hAR hVDR
50.72
32.62
50.72
30.22
E I
_
83.5Z
_
-
20.92
FIG. 6. Comparison of amino acid sequences. The number below each box indicates the percentage of identify of amino acids in the zinc finger region and region II of ELP. The numbers on the right represent the total numbers of amino acid residues. Receptors analyzed are FTZ-F1, estrogen receptor-related genes 1 and 2 (ERR1 and ERR2), human retinoid receptor (hRAR), chicken ovalbumin upstream promoter-transcription factor (COUP-TF), human glucocorticoid receptor (hGR), v-erbA-related genes 2 and 3 (EAR2 and EAR3), human thyroid hormone receptor (hTR), human estrogen receptor (hER), human androgen receptor (hAR), and human vitamin D3 receptor (hVDR).
ELP cDNA with sequences of other nuclear hormone receptors. The DNA binding domain of ELP had two zinc finger motifs, and the first finger (amino acid positions 90 to 120), which determines the sequence specificity of the binding (4, 15, 37), was conserved completely between ELP and FTZ-F1 (data not shown). This is consistent with the specificity of DNA binding shared by ELP and FTZ-F1. The domain involved in putative ligand binding and dimer formation was also conserved between ELP and FTZ-F1, though to a lesser degree. ELP lacks region III, which is conserved within known steroid receptors, and this makes ELP unique among members of the family. Other members of the nuclear hormone receptor family are shown in Fig. 6 in order of homology at region I: estrogen receptor-related genes 1 and 2 (6), the human retinoid receptor (21), chicken ovalbumin upstream promoter-transcription factor (40), the human glucocorticoid receptor (11), v-erbA-related genes 2 and 3 (18), the human thyroid hormone receptor (39), the human estrogen receptor (8), the human androgen receptor (30), and the human vitamin D receptor (1). ELP is the closest relative of FTZ-F1, and the degrees of homology of regions I and II for both proteins were 88.4 and 55.8%, respectively. It is interesting that the extent of homology for region I does not necessarily parallel that for region II. For example, estrogen receptor-related gene 1 is next closest to ELP for region I, while v-erbArelated gene 2 is next closest for region II.
DISCUSSION The mouse homolog of Drosophila FTZ-F1 was cloned from the cDNA bank of a mouse EC cell line, ECA2. The
specificity of binding was shown to be the same for ELP, FTZ-F1, and the in vitro translation product of the cDNA. In addition, antibody raised against the N-terminal portion of the cDNA product specifically inhibited the formation of ELP complex when tested by gel retardation assay. These results firmly demonstrated that ELP is a mouse homolog of FTZ-F1, which is a member of the steroid receptor superfamily. ELP and FTZ-F1 are unique among nuclear hormone receptors in that their binding elements do not contain repeat units, which are common among elements for other receptors (11). Another feature common to ELP and FTZ-F1 is the developmental stages during which they are expressed. ELP is expressed in EC cells, which are derived from cells in the blastocyst stage (31), while FTZ-F1 is derived from cells in the blastoderm stage (36). Mice and fruit flies belong to entirely different phyla and have completely different patterns of embryonic development. The fact that both ELP and FTZ-F1 are expressed during early-stage embryogenesis is of great interest. Nuclear hormone receptors have been implicated in a variety of functions during the development of vertebrates, such as morphogenesis, differentiation, and proliferation of cells. It is interesting that ELP is expressed in cells in which tissue-specific genes are repressed. One of the known functions of ELP is to suppress transcription of Mo-MuLV LTR. Viruses have evolved in such a way that they propagate efficiently in adult tissues. Therefore, viral genomes have features common to cellular genes expressed in somatic cells. This makes viral sequences targets of repression in preimplantation-stage stem cells in which tissue-specific genes are usually not expressed. Thus, in addition to MoMuLV LTR, ELP must have cellular targets, which may be specifically regulated in undifferentiated stem cells of early embryos. Identification of the cellular target of ELP is of prime importance. These cellular targets may include differentiation-specific genes which are also suppressed by ELP. In addition to the genes which function downstream of ELP, an upstream factor such as a ligand, if it exists, is another subject of importance. Although we know that ELP belongs to the steroid receptor superfamily, the ligand for ELP has yet to be identified. The function of ELP, so far as we studied it in in vitro systems, may therefore reflect the activity of ELP without the ligand. Until now, only two EC-specific transcription factors, Oct3-Oct4 and Oct6, have been cloned (20, 23, 26, 29). Elucidation of the functions of these factors and of ELP will help to explain the gene regulation in early embryogenesis.
ACKNOWLEDGMENTS We thank Carl Wu for permitting us to use the FTZ-F1 cDNA before publication of his work, K. Umesono for information on various steroid receptors, K. Yasuda and A. Nagutuchi for pertinent discussion, A. Adachi for the pRSV plasmid, T. Nishioka for photographic work, and T. Matsuura for typing the manuscript. This work is supported by a grant-in-aid from the Ministry of Education, Science and Culture, Japan, by the Joint Studies Program of the Graduate University for Advanced Studies, and by a grant from the Sagawa Foundation for Promotion of Cancer Research. T.T. is a recipient of a postdoctoral fellowship from the Japan Society for the Promotion of Science in Cancer Research.
REFERENCES 1. Baker, A. R., D. P. McDonnell, M. Hughes, T. M. Crisp, D. J. Mangelsdorf, M. R. Haussler, J. W. Pike, J. Shine, and B. W. O'Malley. 1988. Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc. Natl. Acad. Sci. USA 85:3294-3298.
VOL. 12, 1992
2. Beato, M. 1989. Gene regulation by steroid hormones. Cell 56:335-344. 3. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:52945299. 4. Danielson, M., G. Hink, and G. Ringold. 1989. Two amino acids within the knuckle of the first zinc finger specify DNA response element activation by the glucocorticoid receptor. Cell 57:11311138. 5. Gautsch, J. W., and M. C. Wilson. 1983. Delayed de novo methylation in teratocarcinoma suggests additional tissue-specific mechanisms for controlling gene expression. Nature (London) 301:32-37. 6. Giguere, V., N. Yang, P. Segui, and R. M. Evans. 1988. Identification of a new class of steroid hormone receptors. Nature (London) 331:91-94. 7. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 8. Greene, G. L., P. Gilna, M. Waterfield, A. Baker, Y. Hort, and J. Shine. 1986. Sequence and expression of human estrogen receptor complementary DNA. Science 231:1150-1154. 9. Grez, M., M. Zornig, J. Nowock, and M. Ziegler. 1991. A single point mutation activates the Moloney murine leukemia virus long terminal repeat in embryonal stem cells. J. Virol. 65:46914698. 10. Hilberg, F., C. Stockling, W. Ostertag, and M. Grez. 1987. Functional analysis of a retroviral host-range mutant: altered long terminal repeat sequences allow expression in embryonal carcinoma cells. Proc. Natl. Acad. Sci. USA 84:5232-5236. 11. Hollenberg, S. M., C. Weinberger, E. S. Ong, G. Cerelli, A. Oro, R. Lebo, E. B. Thompson, M. G. Rosenfeld, and R. M. Evans. 1985. Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature (London) 318:635-641. 12. Lavorgna, G., H. Ueda, J. Clos, and C. Wu. 1991. FTZ-Fl, a steroid hormone receptor-like protein implicated in the activation of fushi tarazu. Science 252:848-851. 13. Linney, E., B. Davis, J. Overhauser, E. Chao, and H. Fan. 1984. Non-function of a Moloney murine leukemia virus regulatory sequence in F9 embryonal carcinoma cells. Nature (London) 308:470-472. 14. Loh, T. P., L. L. Sievert, and R. W. Scott. 1990. Evidence for a stem cell-specific repressor of Moloney murine leukemia virus expression in embryonal carcinoma cells. Mol. Cell. Biol. 10:4045-4057. 15. Mader, S., V. Kumar, H. de Verneuil, and P. Chambon. 1989. Three amino acids of the oestrogen receptor are essential to its ability to distinguish an oestrogen from a glucocorticoid-responsive element. Nature (London) 338:271-274. 16. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 17. Melin, F., R. Kemler, C. Kress, H. Pinon, and D. Blangy. 1991. Host range specificity of polyomavirus EC mutants in mouse embryonal carcinoma and embryonal stem cells and preimplantation embryos. J. Virol. 65:3029-3043. 18. Miyajima, N., Y. Kadowaki, S. Fukushige, S. Shimizu, K. Semba, Y. Yamanashi, K. Matsubara, K. Toyoshima, and T. Yamamoto. 1988. Identification of two novel members of erbA superfamily by molecular cloning: the gene products of the two are highly related to each other. Nucleic Acids Res. 16:1105711074. 19. Niwa, O., Y. Yokota, H. Ishida, and T. Sugahara. 1983. Independent mechanisms involved in suppression of the Moloney leukemia virus genome during differentiation of murine teratocarcinoma cells. Cell 32:1105-1113. 20. Okamoto, K., H. Okazawa, A. Okuda, M. Sakai, M. Muramatsu, and H. Hamada. 1990. A novel octamer binding transcription factor is differentially expressed in mouse embryonal carcinoma cells. Cell 60:461-472. 21. Petkovich, M., N. J. Brand, A. Krust, and P. Chambon. 1987. A
CLONING OF LTR REPRESSOR IN EC CELLS
1291
human retinoic acid receptor which belongs to the family of nuclear receptors. Nature (London) 330:444 450. 22. Rosenberg, A. H., B. N. Lade, D.-S. Chui, S.-W. Lin, J. J. Dunn, and F. W. Studier. 1987. Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56:125-135. 23. Rosner, M. H., M. A. Vigano, K. Ozato, P. M. Timmons, F. Poirier, P. W. J. Rigby, and L. M. Staudt. 1990. A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature (London) 345:686-692. 24. Sakai, H., R. Shibata, J. Sakuragi, T. Kiyomasu, M. Kawamura, M. Hayami, A. Ishimoto, and A. Adachi. 1991. Compatibility of rev gene activity in the four groups of primate lentiviruses. Virology 184:513-520. 25. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 26. Scholer, H. R., S. Ruppert, N. Suzuki, K. Chowdhury, and P. Gruss. 1990. New type of POU domain in germ line-specific protein Oct-4. Nature (London) 344:435-439. 27. Speck, N. A., and D. Baltimore. 1987. Six distinct nuclear factors interact with the 75-base-pair repeat of the Moloney murine leukemia virus enhancer. Mol. Cell. Biol. 7:1101-1110. 28. Stewart, C. L., H. Stuhlmann, D. Jahner, and R. Jaenisch. 1982. De novo methylation, expression, and infectivity of retroviral genomes introduced into embryonal carcinoma cells. Proc. Natl. Acad. Sci. USA 79:4098-4102. 29. Suzuki, N., H. Rohdewohld, T. Neuman, P. Gruss, and H. R. Scholer. 1990. Oct-6: a POU transcription factor expressed in embryonal stem cells and in the developing brain. EMBO J. 9:3723-3732. 30. Tilley, W. D., M. Marcell, J. D. Wilson, and M. J. McPhaul. 1989. Characterization and expression of a cDNA encoding the human androgen receptor. Proc. Natl. Acad. Sci. USA 86:327331. 30a.Tsukiyama, T. Unpublished data. 31. Tsukiyama, T., 0. Niwa, and K. Yokoro. 1989. Mechanism of suppression of the long terminal repeat of Moloney leukemia virus in mouse embryonal carcinoma cells. Mol. Cell. Biol. 9:4670-4676. 32. Tsukiyama, T., 0. Niwa, and K. Yokoro. 1990. Characterization of the negative regulatory element of the 5' noncoding region of Moloney murine leukemia virus in mouse embryonal carcinoma cells. Virology 177:772-776. 33. Tsukiyama, T., 0. Niwa, and K. Yokoro. 1991. Analysis of the binding proteins and activity of the long terminal repeat of Moloney murine leukemia virus during differentiation of mouse embryonal carcinoma cells. J. Virol. 65:2979-2986. 34. Ueda, H., and S. Hirose. 1990. Identification and purification of a Bombyx mori homologue of FTZ-F1. Nucleic Acids Res. 18:7229-7234. 35. Ueda, H., and S. Hirose. 1991. Defining the sequence recognized with BmFTZ-F1, a sequence specific DNA binding factor in the silkworm, Bombyx mori, as revealed by direct sequencing of bound oligonucleotides and gel mobility shift competition analysis. Nucleic Acids Res. 19:3689-3693. 36. Ueda, H., S. Sonoda, J. L. Brown, M. P. Scott, and C. Wu. 1990. A sequence-specific DNA binding protein that activates fushi tarazu segmentation gene expression. Genes Dev. 4:624-635. 37. Umesono, K., and R. Evans. 1989. Determinants of target gene specificity for steroid/thyroid hormone receptors. Cell 57:11391146. 38. Weiher, H., E. Barklis, W. Ostertag, and R. Jaenisch. 1987. Two distinct sequence elements mediate retroviral gene expression in embryonal carcinoma cells. J. Virol. 61:2742-2746. 39. Weinberger, C., C. C. Thompson, E. S. Ong, R. Lebo, D. J. Gruol, and R. M. Evans. 1986. The c-erb-A gene encodes a thyroid hormone receptor. Nature (London) 324:641-646. 40. Wong, L.-H., S. Y. Tsai, R. G. Cook, W. G. Beattie, M.-J. Tsai, and B. W. O'Malley. 1989. COUP transcription factor is a member of the steroid receptor superfamily. Nature (London) 340:163-166.
Vol. 12, No. 3
0270-7306/92/031286-06$02.00/0 Copyright © 1992, American Society for Microbiology
Embryonal Long Terminal Repeat-Binding Protein Is a Murine Homolog of FTZ-F1, a Member of the Steroid Receptor Superfamily TOSHIO TSUKIYAMA,' HITOSHI UEDA,2 SUSUMU HIROSE,3 AND OHTSURA NIWAl* Department of Pathology, Research Institute for Nuclear Medicine and Biology, Hiroshima University, Minami-ku, Hiroshima 734,1 and Genetic Stock Research Center2 and DI A Research Center, National Institute of Genetics, Mishima 411, Japan Received 22 October 1991/Accepted 4 December 1991
The embryonal long terminal repeat-binding protein, ELP, is present in undifferentiated mouse embryonal carcinoma cells. It binds to and suppresses transcription of the Moloney leukemia virus long terminal repeat in undifferentiated murine embryonal carcinoma cells. We report here that ELP is a mouse homolog of Drosophila FTZ-F1, which positively regulates transcription of the fushi tarazu gene in blastoderm-stage embryos of the fly. As members of the steroid receptor superfamily, ELP and FTZ-Fl have both DNA binding and putative ligand binding domains which are well conserved between the two. ELP and FTZ-F1 function in cells in the extremely early stage of development. A high degree of conservation between the two transcription factors during the evolution of these species indicates the importance of their functions in early-stage embryogenesis. In addition, the sequence elements they recognize do not contain repeat units, in contrast to other steroid receptors, which usually bind to either palindromic or direct repeat sequences.
Stem cells of early-stage mammalian embryos are unique in that they are totipotent in their capacity for differentiation. Tissue-specific genes are repressed tightly in these cells. Tissue-specific activation of genes takes place only after implantation of embryos. In addition to these genes, many viral genomes are also repressed in the stem cells of the preimplantation-stage embryos as well as in undifferentiated embryonal carcinoma cells (EC cells). Analysis of host range mutations in polyomavirus revealed the complex nature of the repression (17). Retroviruses are also the targets of repression in EC cells (5, 19, 28). The mechanism of the repression of Moloney murine leukemia virus (Mo-MuLV) has been the subject of intensive studies, and at least three mechanisms were shown to be responsible for the repression. The amount and number of activator proteins which bind the enhancer region of the long terminal repeat (LTR) are low in undifferentiated EC cells (27). This repression can be circumvented by the insertion of an active enhancer in the LTR (13). It is also abrogated by a mutation which creates an Spl binding site in the enhancer region (9). The 5' noncoding region of the viral genome functions as a negative element in EC cells (14, 32). The host range mutants of Mo-MuLV which can replicate in EC cells carry mutations in this region (38). In addition, we have previously identified an embryonal LTR-binding protein, ELP, which binds to and represses the LTR in undifferentiated EC cells (31). A 10-fold decrease in the transcription was noted in ECA2 cells, a PCC4-derived subline of EC cells, when the ELP binding element was placed upstream of the enhancer of the LTR (33). Again, a mutation at the ELP site in a host range mutant of Mo-MuLV was reported, indicating the importance of the ELP element in repression of Mo-MuLV in EC cells (10). During the attempts to clone the cDNA of ELP, a report in which a Drosophila transcription factor, FTZ-F1, was shown to bind to the same sequence element as ELP appeared (36). Using the cDNA of FTZ-F1 as a probe (12), *
we have succeeded in cloning the cDNA coding for ELP. Analysis of the cDNA indicated that ELP is indeed a mouse homolog of FTZ-F1.
MATERIALS AND METHODS Cell cultures. Cells used in this study were described previously (31). All the cell lines were maintained in minimal essential medium alpha (Irvine Scientific, Santa Ana, Calif.) supplemented with 8% fetal calf serum. Differentiation of ECA2 cells, a subline of PCC4 EC cells, was induced by addition of all-trans retinoic acid (Sigma Chemical Co., St. Louis, Mo.) to 10-6 M in growth medium. Gel retardation assay. Preparation of the nuclear extracts from ECA2 cells (31), Drosophila embryos (36), and the silk gland of Bombyx mon (34) were as described previously. For in vitro translation of cloned ELP cDNA, RNA was transcribed by T7 RNA polymerase from pBS-ELP, in which the open reading frame of the ELP cDNA was placed downstream of the T7 promoter. RNA was then translated in rabbit reticulocyte lysate according to the manufacturer's recommendation (Promega Co., Madison, Wis.). The binding sites for ELP and FTZ-F1 were used as probes for the gel retardation assay. These sequences were terminally labeled to a specific activity of approximately 8 x 103 cpm/fmol. A 2-fmol sample of the probe was used for each lane. As for the competition assay, 40 fmol of the competitor was added to the reaction mixture. The procedure for the gel retardation assays was as described previously (35). Chloramphenicol acetyltransferase (CAT) assay. NIH 3T3 cells in 60-mm dishes were transfected with 0.5 ,ug of reporter plasmids, 5 p.g of effector plasmids, 2 pg of pact-agal and 2.5 ,ug of pUC119. Transfection was done by the CaPO4 method, and the details of the procedure are as described previously (31). Experiments were repeated at least five times, and the data shown in the figures are those for the typical cases. pRV-ELP was constructed by inserting ELP cDNA in expression vector pRVSVneo (24), containing the Rous
Corresponding author. 1286
CLONING OF LTR REPRESSOR IN EC CELLS
VOL. 12, 1992
B
A Probe
EI__
t I i"I7-F1 sitel
a i Lt
/
Extract
.'
l{} Vi lr
Competitor
lBiFFIZ-FI FLP
si te 5'-GCAGCACCGTC'ICAAGGTCGCCGAGTAGGAGAA-3' -VD-----------f tz2NEI VI)--- -f tzlT --_-_______R --------------------ftzIE f tzlG f tz8A -----------C------T FTz-FI f tz9T ---- --- ---C ---H---A-----f tz3L -------------A-----------------~~BmFTZ-Fl ft 7zfE H R --
0
--------------
~~
.0
0
mu~~~~.
0
FLIX
ftz5-15 f t.uJ. ------f ti9E
ftzNtI 1
1287
Y-----
-----
DDY-
Y
,
t rarls ai d i- I'
0
S0
S: 4
9 0 a
S
S
4'
.I
4' 9
ftz3NE2
FIG. 1. (A) Gel retardation analysis of ELP, FTZ-F1, BmFTZ-F1, and in vitro-translated protein products of the ELP cDNA. Probes used are the recognition sites for ELP (ELP site) and FTZ-F1 (FTZ-F1 site I). The complexes are indicated by arrows. Nuclear extracts from ECA2 cells, Drosophila embryos, and the silk glands of B. mon were used as sources of ELP, FTZ-F1, and BmFTZ-F1, respectively. t.1. + and t.1.-, in vitro-translated protein products with and without RNA transcripts of the ELP cDNA, respectively. (B) Comparison of the specificity of sequence recognition of ELP, BmFTZ-F1, and the in vitro translated protein product. Only the bands corresponding to the complexes are shown. The FTZ-F1 site I sequence was used as a probe. The mutated site I sequences were used as competitors and added at a 20-fold excess in the binding reaction mixture. The nucleotide sequences are depicted under the wild-type sequence. Letters denote mixtures of nucleotides: Y, T+C; R, G+A; D, G+A+T; V, G+A+C; B, G+T+C; H, A+T+C.
sarcoma virus (RSV) LTR and the poly(A)+ signal of simian virus 40. As for the negative control, a stop codon linker (New England Biolabs Inc., Beverly, Mass.) was inserted between PmaCI sites in the zinc finger region of ELP in pRV-ELP, and the resulting plasmid was designated pRVELP-ZFS. pMolPKCAT has the enhancer and promoter regions of Mo-MuLV LTR upstream of the CAT gene, and pSP8PKCAT carries eight copies of ELP binding sites upstream of the enhancer region of pMolPKCAT in the same orientation as in the original ELP site (31). The amounts of cell extracts for the CAT assay were normalized by the level of 13-galactosidase activity. Preparation of cell extracts and assay procedures were as described previously (7, 33). cDNA cloning and sequencing. A randomly primed cDNA library of undifferentiated ECA2 cells was constructed on Agtll and screened by plaque hybridization probed by' the zinc finger region of FTZ-F1. The filters were washed in 2x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate)0.5% sodium dodecyl sulfate (SDS) at 65°C for 60 min. DNAs from positive clones were subcloned into pUC119 and sequenced by the dideoxy chain termination method (25). Production of anti-ELP antibody. A DNA fragment of the ELP cDNA from AvaIII to PmaCI (207 to 572 nucleotides), encoding amino acids 4 to 126 of the ELP protein, was cloned into bacterial expression vector pET3a (22). The protein product of the cDNA was extracted from Escherichia coli,. purified by SDS-polyacrylamide gel electrophoresis, and recovered by electroelution. A New Zealand White rabbit was injected subcutaneously with 100 ,ug of the protein product together with Freund's complete adjuvant (Difco Laboratories, Detroit, Mich.). Rabbits were boosted three times with 50 ,ug of the protein at intervals of 2 weeks. Northern analysis. Total cellular RNA was prepared by sedimentation through cesium chloride (3), electrophoresed, and blotted onto membrane filters which were then hybridized as described previously (16). For the blotting, 30 ,ug of total RNA was loaded onto each lane. Filters were washed with O.lx SSC-0.5% SDS at 65°C.
Nucleotide sequence accession number. The nucleotide sequence data reported in this paper will appear in the DDBJ, EMBL, and GenBank nucleotide sequence data bases under accession no. D90530.
RESULTS Binding specificity of ELP and FIZ-Fl. In our previous study, ELP was shown to be present specifically in various undifferentiated EC cells of mouse and human origin. The amount of ELP was especially high in ECA2 cells, a subline of PCC4 cells (31). ELP binds to the sequence element TCAAGGTCA, which is located 12 bp upstream of the enhancer of Mo-MuLV LTR (31). FTZ-F1 is involved in activation of the fushi tarazu gene in early-stage Drosophila embryos by binding to the sequence element YCAAGGYCR in the Zebra element of the gene (36). This sequence completely matches that of the ELP element, suggesting that ELP may have similarity to FTZ-F1. The ELP element and site I, one of the FTZ-F1 elements, were tested for interaction with FTZ-F1, BmFTZ-F1 (the'B. mon homolog of FTZ-F1 [34]), and ELP. BmFTZ-Fl has the same sequence specificity as FTZ-F1 (35). As is clear from Fig. 1A, ELP, FTZ-F1, and BmFTZ-F1 each bound to both of the elements. Although specific activities of the probes were similar, site I of the FTZ-F1 binding element always gave stronger bands than did the ELP site. This suggests that site I of FTZ-F1 may have a higher affinity for all three factors. We then tested by competition assay the specificity of the binding of ELP and BmFTZ-Fl to site I carrying a series of mutations. The patterns of competition were identical between the two factors (Fig. 1B). This indicates that ELP and FTZ-F1 are related and may have sequence homology in the DNA binding domain. Cloning of the mouse homolog of FIZ-Fl. The zinc finger region of the FTZ-F1 cDNA (21) was used as a probe to screen the phage library of undifferentiated ECA2 cells, and one of the isolates contained a complete open reading frame. In order to confirm that this corresponds to that of ELP, an
1288
MOL. CELL. BIOL.
TSUKIYAMA ET AL. 5-ooA!iCCCC:CTCCOTToOCC
AOTACTOOCTOOAO!CTCTOTCTCTTCTAOACTCTCTOCCTCA0OTCTCTOTCOOOOCCC CCAGAACAA!CCAOCTOTOTOCCCSACTTCOCCCTOOTCCCTOOCOTCTOTCTTOCCCO COTCCOAGCCTATCTOATTTTCTCAOAATCOOOOTTTTOTTCTCAOACAAACOAATCTOO ATOO&AATOCATCOAATCCOAOOOTCCCOOATCOOOCOCOOCAOAOOCO.COAOOAAOCA
NetOluNet3iuArgIloArgolyberArgleOlyAr,O1yArOly,loyluOlual.
200
ACCCooCCCoGoCTso@oACCGCCCCOTGTOCACAGACC&oGGCAATCCCAAGCCAoTCo
380
40
leLuLeouProolmAlaAspAlaAlaolyMNtagpTyr
TCOTACOACOAOOACCTOOACOAOCT OTCCAOTOTOTOOTOACAAOOTOTCOOCTAC 8GrTyrAspOluAspL*uAspOluLe yuProValCyuOlyaupLysVal.rolyTJy
500 100
CTACCOOOCTOCST_COTOCOkOAOCTOCAAOOOCTTCTTCAAOCOCACAG!CCAOAAc
560 120
AsmLysEiuTyrThrCysThrOluuerOla.srCysLyUIl1AspLy,ThrOlmArgLy OCTOTCCCTTCTGCCOCTTCCAGAAGTOCCTOACOOTOOOCATOCOCCTGGA
CTSTO
680 160
COTOCTOATCOAATGCGOOOGTGCCOOAACAAGTTTGOOCCCATOTACAAOAGAGACCOO ArgAlaA
740 180
pArgNtArg0glyglyAr;ganLyspb.OlyProM.tTyrLysuargApArg OCCTTGAA0C&CAOCAAGAAAGCACAGATVC@G@CCAATOOCTTCK&&CTOG&GACCOOA AlaLeuLyaOlaglaLyuLyaAlaOlllArgAlaAUn.lyPh.Ly.L.ouluThrOly CTOCACOCACCOOAOCCCAAOOCCCTOOTCTCTOOCCCACCCAOTGOOCCOCT.O.TOAC
920 240
LeuNEiAlarroOlurroLyuAlaL*uValg.rGlyProrro.rOl.ProLuGOlyAop ATTOOACCCCCATCTCTACCCATOTCTOTGCCTGOTCCCCACOGACCTCTOOCTOOCTAC lleGlyAlaProUerLeuProNetgerValProglyproNisglyProLouAla6lyTyr CSCTATCCTOCCTTCTCTAACCOCACCATCAAOTCVG&OTkTCCAOAGCCCT&TOCCAOC LouTyrProklaPhe*er&asArgTh?ll-LJaU.roluTyrproluPro.yrAlal r CCCCCACAACAoCCAGoOCCACCCTACAOCTATCCAGAOCCCTTCTCAOAGOoCCCAAT rrqProgluglnrroglyrroProTyrg.rTyrpro0luProFbr.SrOlyOlyProAn OTACCAGAOCTCATATTOCAGCTGCTGCAJCTA@AOCCAA6GAOGOACCAGOTOCOCOCT ValProgluL-ull-eLeuOlaLouL*uglmOluProOluOluAsp_lAValArgAla
1040 280
CoCATCOTGooCTGoCToCA@AOACCAGCCAAAACCOOCTCTsoACCAoCCACOCCCTTC j.*ra ~ _ _ .
1220
_
I
pUmA
o_ ____ _.
980 260
1100 300
1160 320
1280
GOCAT@OTCTTTAAOGAOCTOAOTASGGCTOACCAGATGACACTGCTCAGAACTOTTOG oluL-uoluyalAlaA.p0l Tr
1340
6CoAoCT@CTGoGTQT
1400
CI M*tVaIVhbLy
MetThrLouLuOl.AsnCys ACCACATCTACCoCCAAGTCCAOTACoOCAAcoAAGACAGC
spPluIleTyrArgOlmValo1uTyralyLyuoluAsp8.r ATCCTOCTOOTTAOTO0ACAO0AGOTAACTOAACTG0XAAACCCCTAOTCCTOCATAAT Il*LeuLeuValSerOlyGlnOluValThrOluL.uValLysProL.uValL ouEiAsa CCCAGOCCTCTCAG@OCTOACTCOGOACACCCCAAATTCCAAATTCAGOGACATOCACTA ProArgProLeuArgAlaAupSerOly.llProLy.Ph-Olull-OIGlylI,EAlaL-u *rgluLeuLeuValL.
360
380 400 1460 420 1520
4O
OCCAOGCTTCTCTGTOTCCTOGOOCCATTTOAGAOACCACASOTGTOAA,GGTCAOTGOA
AlaArgLeuLouCyaValLeuOlyProPheoluoluProOl.Cya.lyXdtValSar0ly
1580 460
AOTTCTTATAGOA@ATAACATOGOAATTOGATCTCCCCAAAATAAGOCAGAOTTGOTCAO Serfer!yrArgArg***
1640
CVsOTACToAAGToACAOETGOCCAoTCTATOCToTCACACATTOoATGCToCAoOATCT A0OACTCAOAOAAGOGATTCOOAATAGGOCCAAGGAACTOTOOOOSOOCAAOGTTAA.AO AT@AO@TTOCAGOCATTOCTAAOGCTSOOTGAOCAGOT@AGACCCTOTAOGTCTCCATTC
1700
TCATAAATOATOAATOAATAAATOAATOAACOAATGAACOAAOOAACACAAOAOTOOCO AAAAG*AAAGAGAOACTCAOACTCA@AATTTOoCCCTTTTAGATCAGAGAATOTATTACOG
O@TO@GAAGTCATTAOGAAOGCCTGGAAACTCCTOAACTCCACCTCCACCCACAOOAaGa ACATTAGOOTTCCTAGTOGATOTGOOTOKAGvAOCCTAAATOTCTOGOOTTTOACACCAT TTAAAGA0-32
4
*CBP
ELP*
i
FIG. 3. Suppression of the binding of ELP by anti-ELP antibody. The preimmune serum and antiserum were tested by gel
retardation assay with nuclear extract of ECA2 cells. The probes used were the site I sequence and the promoter region (XbaI to KpnI) of the Mo-MuLV LTR. CBP, CCAAT box-binding protein (31). Undiluted serum (1 ,ul) was added to 20 p.l of the binding mixture simultaneously with nuclear extracts and incubated for 30 min at room temperature before application to the gel.
340
OCAOAATGOCCOACCAGACCTTTATCTCCATTOTCOACTO6OCACOAAO
lerLeuLv CyArgMNtAlaASpOlmThrPbel-SeerlleValAspTrpAlaAr
0
mW
860 220
AOCCTCCT
-
serum
200
CCACCOATGOGOOTOCCCCCTCCACCCCCTCCCCCACCOOACTACATOTTACCCCCTAOC ProProNetOlyValProProProproProProProProA.pTyrM.tL -r FuProProF
0
620 140
laval
rgCyuProFrhCymArgPheolaLy.CyaL.uThrVally-t7ArSL..l
promoter 0
60
440 so
iasyrOlyLeuLSuThrCyuOluSerCy.Ly.Olrph.phbLy,ArgThrYVaI0As AACAAOCATTAtACOTOCACCOAOATCAAOGOCTOCAAAATCOACAkOACOCCOCOTAA
site I
20
320
bhrArgProOlyLeuglyThrAlaProCyAlaOlTbhrArgAal.lorro..r.la..r CCOTC00CCCOCOCTOACCCGATCCTCCTTCCACAOOC0OACOCCOCOOOCATOOACTAc ProSer&laArgAlaAspproz
Mo-MuLV
probe
260
OCCCTGGAACCCGOTSGCTOCTOCAsCOCAOACATCOCCCACaaACCCccoc
[email protected]
I
20 80 140
465 1760
1820 1880
1940 2000
2060 2068
FIG. 2. Nucleotide and amino acid sequences of the ELP cDNA, numbered on the right. Boxed areas are the zinc finger region (I) and the putative ligand-binding domain (II). Asterisks and underlines in box I indicate the PmaCI sites, between which a stop codon was inserted in the negative control plasmid used for the CAT assay.
in vitro protein product was made from the transcript of the cDNA and used for the gel retardation assay. Figure 1A shows that the in vitro product bound to the ELP site as well as to site I. The mobility of the complex with the in vitro product was slightly lower than that with ELP, and the reason for this is presently unknown. Nevertheless, the results strongly suggest that the cDNA indeed codes for ELP. Further confirmation was made by analyzing the specificity of the binding. Affinity of the in vitro product for the mutant sequences was identical to that of ELP and BmFTZ-Fl (Fig. 1B). Sequence of the cDNA. The cDNA was sequenced, and the result is shown in Fig. 2. The cDNA carried an intact open
reading frame which had a coding capacity for a polypeptide
of 465 amino acids. The molecular mass of the cDNA product was calculated to be 51.3 kDa. The polypeptide has a typical structure of nuclear hormone receptors (2). The DNA binding domain (region I, boxed in Fig. 2) consisted of two zinc finger motifs, and the domain involved in putative ligand binding and dimer formation was located in the C-terminal half. Inhibition of ELP binding by the antibody against the cDNA product. The 5' region of the cDNA was cloned into an expression vector, and the polypeptide spanning the N-terminal portion to the first zinc finger of the putative ELP was produced in E. coli. Gel-purified protein was used to raise antibody in rabbits. The antibody was tested by gel retardation assay. As is clear in Fig. 3, the antibody blocked the formation of the ELP complex with the site I element. This indicates that the antibody raised against the protein product of the cDNA cross-reacted with ELP in a crude nuclear extract of ECA2 cells. The more slowly migrating band appearing after treatment with the antibody may be the tripartite complex of the antibody, ELP, and the probe. The antibody had no effect on the formation of the complex with the promoter region of the Mo-MuLV LTR (nucleotides -150 to + 31). The complex on this fragment was previously shown to be due to the CCAAT box-binding protein in ECA2 cells (31). This confirms the specificity of the antibody. These results clearly demonstrate that the cDNA does code for ELP. Functional analysis of the cDNA product. Figure 4A shows the construction of the reporter plasmids used in the functional assay of ELP. The ELP cDNA was cloned into a mammalian expression vector and tested in NIH 3T3 cells, which completely lacked endogenous ELP activity (31). The efficiency of transfection was normalized by the level of P-galactosidase activity driven by the 1-actin promoter. The ELP expression plasmid contained the 2,068-bp fragment of
VOL. 12, 1992
CLONING OF LTR REPRESSOR IN EC CELLS
A
1289
B ELP sSte
Sau5AI PvuII (-135) ( -3728
6C rlch
TATA
enharce r
reg i on
box
v v
*
Reporter
CrAAT box tl
r
v
AC%
-
43.3
pSP8PKCAT
19.3
23.8 5.7
*
*
99 .
K( I5
P1CUCAT
49.1
35.4
Kcnl
Xmal ( -A50) _
pMoLPKCAT
pRSVCAT
CAT
* OSPSPKCA7
ELP
FIG. 4. Suppression of LTR-driven transcription by forced expression of the cloned ELP cDNA in fibroblasts (14). (A) Constructs of effector plasmids. Eight copies of the Sau3AI (-353) to PvuII (-328) fragment of the LTR were ligated in a head-to-tail orientation. They were placed upstream of the enhancer of pMolPKCAT to make pSP8PKCAT (31). (B) CAT assay. ELP + and -, cotransfection with ELP expression vector, pRV-ELP, and negative control vector, pRV-ELP-ZFS, respectively. AC%, percentage of acetylated chloramphenicol in each assay.
the ELP cDNA placed between the RSV LTR and the poly(A)+ signal of simian virus 40. The negative control plasmid was constructed in a similar fashion, except that the cDNA had a stop codon at the zinc finger region of the cDNA. Experiments were repeated five times, and cotransfection of the ELP construct reproducibly suppressed the CAT activity driven by the LTR containing eight copies of the ELP element by approximately fourfold (Fig. 4B). This suppression was dependent on the amount of the ELP plasmid applied on the cells (data not shown). A low degree of suppression (around twofold) was repeatedly observed for pMolPKCAT, which lacked the ELP site. This may be due to the cryptic ELP target site present in the enhancer region (30a). Transcription from the RSV LTR, which has no ELP site, was not suppressed by the ELP plasmid. These results demonstrate the specificity of the suppression by ELP and confirm that the cDNA carries the coding region of functionally intact ELP.
B
A RA treatment
Expression of ELP mRNA. Expression of ELP mRNA was analyzed during retinoid-induced differentiation of ECA2 cells. As shown in Fig. 5A, expression of ELP decreased until no mRNA was detected at 2 days after the induction. This indicates that expression of ELP is specific in undifferentiated EC cells and is consistent with the result of the gel retardation analysis in which the ELP complex completely disappeared in ECA2 cells treated with retinoid for 2 days (33). As shown in Fig. 5B, ELP mRNA was detected in all of the mouse EC cell lines but not in fibroblastic lines. This was again consistent with the result of the gel retardation assay (31). The apparent lack of ELP mRNA in a human EC line, NEC8, may be due to a low level of expression in this cell line (31) and/or to divergence in the nucleic acid sequences of humans and mice. Sequence comparison of ELP with other nuclear hormone receptors. Figure 6 compares the amino acid sequence of
Th~N
*X>-~
Cell linres
928S
Bass
11
I
,-\
a, \
..
I
n-actin w
\
'14,-
\.-
*28S
U. *18S
*18S
ww~Iw
I
_w ,mw
1w
n-act lfn
FIG. 5. (A) Expression of ELP during differentiation of ECA2 cells. The numbers above the gel indicate the time atter induction of differentiation by retinoic acid. A 1-actin probe was used as a control for the amount of RNA analyzed. (B) Expression of ELP in various cell lines. ECA2, PCC4, PCC3, and F9 cells are mouse EC cells. NEC8 cells are human EC cells. Ltk- and NIH3T3 cells are mouse fibroblasts.
1290
MOL. CELL. BIOL.
TSUKIYAMA ET AL. region 11
Zn finger
ELP
8*5
C~~~~~
FTZ-F1
I
88e.8
ERRI
55.82 521
60.92
37.22
58.02
30.22
862
hRAR ERR2
I
58.02
_
_
39.72
823
COUP-TF(EAR3) 56.52
h6R
56.52
t33
88.22
_
38.92 853
EAR2 55.1X
hTR
M.=Z 30.2Z
hER hAR hVDR
50.72
32.62
50.72
30.22
E I
_
83.5Z
_
-
20.92
FIG. 6. Comparison of amino acid sequences. The number below each box indicates the percentage of identify of amino acids in the zinc finger region and region II of ELP. The numbers on the right represent the total numbers of amino acid residues. Receptors analyzed are FTZ-F1, estrogen receptor-related genes 1 and 2 (ERR1 and ERR2), human retinoid receptor (hRAR), chicken ovalbumin upstream promoter-transcription factor (COUP-TF), human glucocorticoid receptor (hGR), v-erbA-related genes 2 and 3 (EAR2 and EAR3), human thyroid hormone receptor (hTR), human estrogen receptor (hER), human androgen receptor (hAR), and human vitamin D3 receptor (hVDR).
ELP cDNA with sequences of other nuclear hormone receptors. The DNA binding domain of ELP had two zinc finger motifs, and the first finger (amino acid positions 90 to 120), which determines the sequence specificity of the binding (4, 15, 37), was conserved completely between ELP and FTZ-F1 (data not shown). This is consistent with the specificity of DNA binding shared by ELP and FTZ-F1. The domain involved in putative ligand binding and dimer formation was also conserved between ELP and FTZ-F1, though to a lesser degree. ELP lacks region III, which is conserved within known steroid receptors, and this makes ELP unique among members of the family. Other members of the nuclear hormone receptor family are shown in Fig. 6 in order of homology at region I: estrogen receptor-related genes 1 and 2 (6), the human retinoid receptor (21), chicken ovalbumin upstream promoter-transcription factor (40), the human glucocorticoid receptor (11), v-erbA-related genes 2 and 3 (18), the human thyroid hormone receptor (39), the human estrogen receptor (8), the human androgen receptor (30), and the human vitamin D receptor (1). ELP is the closest relative of FTZ-F1, and the degrees of homology of regions I and II for both proteins were 88.4 and 55.8%, respectively. It is interesting that the extent of homology for region I does not necessarily parallel that for region II. For example, estrogen receptor-related gene 1 is next closest to ELP for region I, while v-erbArelated gene 2 is next closest for region II.
DISCUSSION The mouse homolog of Drosophila FTZ-F1 was cloned from the cDNA bank of a mouse EC cell line, ECA2. The
specificity of binding was shown to be the same for ELP, FTZ-F1, and the in vitro translation product of the cDNA. In addition, antibody raised against the N-terminal portion of the cDNA product specifically inhibited the formation of ELP complex when tested by gel retardation assay. These results firmly demonstrated that ELP is a mouse homolog of FTZ-F1, which is a member of the steroid receptor superfamily. ELP and FTZ-F1 are unique among nuclear hormone receptors in that their binding elements do not contain repeat units, which are common among elements for other receptors (11). Another feature common to ELP and FTZ-F1 is the developmental stages during which they are expressed. ELP is expressed in EC cells, which are derived from cells in the blastocyst stage (31), while FTZ-F1 is derived from cells in the blastoderm stage (36). Mice and fruit flies belong to entirely different phyla and have completely different patterns of embryonic development. The fact that both ELP and FTZ-F1 are expressed during early-stage embryogenesis is of great interest. Nuclear hormone receptors have been implicated in a variety of functions during the development of vertebrates, such as morphogenesis, differentiation, and proliferation of cells. It is interesting that ELP is expressed in cells in which tissue-specific genes are repressed. One of the known functions of ELP is to suppress transcription of Mo-MuLV LTR. Viruses have evolved in such a way that they propagate efficiently in adult tissues. Therefore, viral genomes have features common to cellular genes expressed in somatic cells. This makes viral sequences targets of repression in preimplantation-stage stem cells in which tissue-specific genes are usually not expressed. Thus, in addition to MoMuLV LTR, ELP must have cellular targets, which may be specifically regulated in undifferentiated stem cells of early embryos. Identification of the cellular target of ELP is of prime importance. These cellular targets may include differentiation-specific genes which are also suppressed by ELP. In addition to the genes which function downstream of ELP, an upstream factor such as a ligand, if it exists, is another subject of importance. Although we know that ELP belongs to the steroid receptor superfamily, the ligand for ELP has yet to be identified. The function of ELP, so far as we studied it in in vitro systems, may therefore reflect the activity of ELP without the ligand. Until now, only two EC-specific transcription factors, Oct3-Oct4 and Oct6, have been cloned (20, 23, 26, 29). Elucidation of the functions of these factors and of ELP will help to explain the gene regulation in early embryogenesis.
ACKNOWLEDGMENTS We thank Carl Wu for permitting us to use the FTZ-F1 cDNA before publication of his work, K. Umesono for information on various steroid receptors, K. Yasuda and A. Nagutuchi for pertinent discussion, A. Adachi for the pRSV plasmid, T. Nishioka for photographic work, and T. Matsuura for typing the manuscript. This work is supported by a grant-in-aid from the Ministry of Education, Science and Culture, Japan, by the Joint Studies Program of the Graduate University for Advanced Studies, and by a grant from the Sagawa Foundation for Promotion of Cancer Research. T.T. is a recipient of a postdoctoral fellowship from the Japan Society for the Promotion of Science in Cancer Research.
REFERENCES 1. Baker, A. R., D. P. McDonnell, M. Hughes, T. M. Crisp, D. J. Mangelsdorf, M. R. Haussler, J. W. Pike, J. Shine, and B. W. O'Malley. 1988. Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc. Natl. Acad. Sci. USA 85:3294-3298.
VOL. 12, 1992
2. Beato, M. 1989. Gene regulation by steroid hormones. Cell 56:335-344. 3. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:52945299. 4. Danielson, M., G. Hink, and G. Ringold. 1989. Two amino acids within the knuckle of the first zinc finger specify DNA response element activation by the glucocorticoid receptor. Cell 57:11311138. 5. Gautsch, J. W., and M. C. Wilson. 1983. Delayed de novo methylation in teratocarcinoma suggests additional tissue-specific mechanisms for controlling gene expression. Nature (London) 301:32-37. 6. Giguere, V., N. Yang, P. Segui, and R. M. Evans. 1988. Identification of a new class of steroid hormone receptors. Nature (London) 331:91-94. 7. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 8. Greene, G. L., P. Gilna, M. Waterfield, A. Baker, Y. Hort, and J. Shine. 1986. Sequence and expression of human estrogen receptor complementary DNA. Science 231:1150-1154. 9. Grez, M., M. Zornig, J. Nowock, and M. Ziegler. 1991. A single point mutation activates the Moloney murine leukemia virus long terminal repeat in embryonal stem cells. J. Virol. 65:46914698. 10. Hilberg, F., C. Stockling, W. Ostertag, and M. Grez. 1987. Functional analysis of a retroviral host-range mutant: altered long terminal repeat sequences allow expression in embryonal carcinoma cells. Proc. Natl. Acad. Sci. USA 84:5232-5236. 11. Hollenberg, S. M., C. Weinberger, E. S. Ong, G. Cerelli, A. Oro, R. Lebo, E. B. Thompson, M. G. Rosenfeld, and R. M. Evans. 1985. Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature (London) 318:635-641. 12. Lavorgna, G., H. Ueda, J. Clos, and C. Wu. 1991. FTZ-Fl, a steroid hormone receptor-like protein implicated in the activation of fushi tarazu. Science 252:848-851. 13. Linney, E., B. Davis, J. Overhauser, E. Chao, and H. Fan. 1984. Non-function of a Moloney murine leukemia virus regulatory sequence in F9 embryonal carcinoma cells. Nature (London) 308:470-472. 14. Loh, T. P., L. L. Sievert, and R. W. Scott. 1990. Evidence for a stem cell-specific repressor of Moloney murine leukemia virus expression in embryonal carcinoma cells. Mol. Cell. Biol. 10:4045-4057. 15. Mader, S., V. Kumar, H. de Verneuil, and P. Chambon. 1989. Three amino acids of the oestrogen receptor are essential to its ability to distinguish an oestrogen from a glucocorticoid-responsive element. Nature (London) 338:271-274. 16. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 17. Melin, F., R. Kemler, C. Kress, H. Pinon, and D. Blangy. 1991. Host range specificity of polyomavirus EC mutants in mouse embryonal carcinoma and embryonal stem cells and preimplantation embryos. J. Virol. 65:3029-3043. 18. Miyajima, N., Y. Kadowaki, S. Fukushige, S. Shimizu, K. Semba, Y. Yamanashi, K. Matsubara, K. Toyoshima, and T. Yamamoto. 1988. Identification of two novel members of erbA superfamily by molecular cloning: the gene products of the two are highly related to each other. Nucleic Acids Res. 16:1105711074. 19. Niwa, O., Y. Yokota, H. Ishida, and T. Sugahara. 1983. Independent mechanisms involved in suppression of the Moloney leukemia virus genome during differentiation of murine teratocarcinoma cells. Cell 32:1105-1113. 20. Okamoto, K., H. Okazawa, A. Okuda, M. Sakai, M. Muramatsu, and H. Hamada. 1990. A novel octamer binding transcription factor is differentially expressed in mouse embryonal carcinoma cells. Cell 60:461-472. 21. Petkovich, M., N. J. Brand, A. Krust, and P. Chambon. 1987. A
CLONING OF LTR REPRESSOR IN EC CELLS
1291
human retinoic acid receptor which belongs to the family of nuclear receptors. Nature (London) 330:444 450. 22. Rosenberg, A. H., B. N. Lade, D.-S. Chui, S.-W. Lin, J. J. Dunn, and F. W. Studier. 1987. Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56:125-135. 23. Rosner, M. H., M. A. Vigano, K. Ozato, P. M. Timmons, F. Poirier, P. W. J. Rigby, and L. M. Staudt. 1990. A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature (London) 345:686-692. 24. Sakai, H., R. Shibata, J. Sakuragi, T. Kiyomasu, M. Kawamura, M. Hayami, A. Ishimoto, and A. Adachi. 1991. Compatibility of rev gene activity in the four groups of primate lentiviruses. Virology 184:513-520. 25. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 26. Scholer, H. R., S. Ruppert, N. Suzuki, K. Chowdhury, and P. Gruss. 1990. New type of POU domain in germ line-specific protein Oct-4. Nature (London) 344:435-439. 27. Speck, N. A., and D. Baltimore. 1987. Six distinct nuclear factors interact with the 75-base-pair repeat of the Moloney murine leukemia virus enhancer. Mol. Cell. Biol. 7:1101-1110. 28. Stewart, C. L., H. Stuhlmann, D. Jahner, and R. Jaenisch. 1982. De novo methylation, expression, and infectivity of retroviral genomes introduced into embryonal carcinoma cells. Proc. Natl. Acad. Sci. USA 79:4098-4102. 29. Suzuki, N., H. Rohdewohld, T. Neuman, P. Gruss, and H. R. Scholer. 1990. Oct-6: a POU transcription factor expressed in embryonal stem cells and in the developing brain. EMBO J. 9:3723-3732. 30. Tilley, W. D., M. Marcell, J. D. Wilson, and M. J. McPhaul. 1989. Characterization and expression of a cDNA encoding the human androgen receptor. Proc. Natl. Acad. Sci. USA 86:327331. 30a.Tsukiyama, T. Unpublished data. 31. Tsukiyama, T., 0. Niwa, and K. Yokoro. 1989. Mechanism of suppression of the long terminal repeat of Moloney leukemia virus in mouse embryonal carcinoma cells. Mol. Cell. Biol. 9:4670-4676. 32. Tsukiyama, T., 0. Niwa, and K. Yokoro. 1990. Characterization of the negative regulatory element of the 5' noncoding region of Moloney murine leukemia virus in mouse embryonal carcinoma cells. Virology 177:772-776. 33. Tsukiyama, T., 0. Niwa, and K. Yokoro. 1991. Analysis of the binding proteins and activity of the long terminal repeat of Moloney murine leukemia virus during differentiation of mouse embryonal carcinoma cells. J. Virol. 65:2979-2986. 34. Ueda, H., and S. Hirose. 1990. Identification and purification of a Bombyx mori homologue of FTZ-F1. Nucleic Acids Res. 18:7229-7234. 35. Ueda, H., and S. Hirose. 1991. Defining the sequence recognized with BmFTZ-F1, a sequence specific DNA binding factor in the silkworm, Bombyx mori, as revealed by direct sequencing of bound oligonucleotides and gel mobility shift competition analysis. Nucleic Acids Res. 19:3689-3693. 36. Ueda, H., S. Sonoda, J. L. Brown, M. P. Scott, and C. Wu. 1990. A sequence-specific DNA binding protein that activates fushi tarazu segmentation gene expression. Genes Dev. 4:624-635. 37. Umesono, K., and R. Evans. 1989. Determinants of target gene specificity for steroid/thyroid hormone receptors. Cell 57:11391146. 38. Weiher, H., E. Barklis, W. Ostertag, and R. Jaenisch. 1987. Two distinct sequence elements mediate retroviral gene expression in embryonal carcinoma cells. J. Virol. 61:2742-2746. 39. Weinberger, C., C. C. Thompson, E. S. Ong, R. Lebo, D. J. Gruol, and R. M. Evans. 1986. The c-erb-A gene encodes a thyroid hormone receptor. Nature (London) 324:641-646. 40. Wong, L.-H., S. Y. Tsai, R. G. Cook, W. G. Beattie, M.-J. Tsai, and B. W. O'Malley. 1989. COUP transcription factor is a member of the steroid receptor superfamily. Nature (London) 340:163-166.
