J Oral Pathol Med (2015) 44: 214–221 © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd
doi: 10.1111/jop.12223
wileyonlinelibrary.com/journal/jop
Ellagic acid modulates the expression of oral innate immune mediators: potential role in mucosal protection Aornrutai Promsong1, Whasun Oh Chung2, Surada Satthakarn1, Wipawee Nittayananta3,4,5 1
Department of Biomedical Sciences, Faculty of Medicine, Prince of Songkla University, Hat Yai, Songkhla, Thailand; 2Department of Oral Health Sciences, University of Washington, Seattle, WA, USA; 3Excellent Research Laboratory, Phytomedicine and Pharmaceutical Biotechnology Excellence Center, Hat Yai, Songkhla, Thailand; 4Natural Product Research Center of Excellence, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla, Thailand; 5Graduate School, Prince of Songkla University, Hat Yai, Songkhla, Thailand
BACKGROUND: Ellagic acid (EA) found in various fruits such as pomegranates, blackberries, raspberries, strawberries, and walnuts has different pharmacological functions including antioxidant, antitumor, antiallergic, anti-inflammatory, antibacterial, and antiviral activities. It is not known, however, if EA could enhance mucosal innate immunity. Our goal was to determine the effects of EA on the expression of innate immune mediators produced by oral epithelial cells. METHODS: Culture of primary human gingival epithelial cells (HGEs) was performed in duplicate, and after the primary HGEs had been treated with EA at a concentration ranging from 12.5 to 100 lM for 18 h the cells and supernatants were harvested. The expression of innate immune mediators including human b-defensin 2 (hBD2), secretory leukocyte protease inhibitor (SLPI), and various cytokines and chemokines was measured at both transcriptional and translational levels by using quantitative real-time PCR, ELISA, and Luminex assay. RESULTS: In the presence of EA, the expression of hBD2-and SLPI mRNA was 3.7-folds and 2.6-folds greater than untreated controls, respectively, and consistent with their secreted protein levels. For cytokines and chemokines, increased expression of RANTES, IL-2, and IL-1b was found in response to EA. In contrast, EA decreased the expression of IL-6, IL-8, and TNF-a. CONCLUSIONS: This study demonstrated that oral innate immunity is affected by EA found in fruits. Thus, it may play some roles in mucosal innate immunity. The potential of EA for modulating the innate immune mediators may lead to developing a new topical agent to treat and/or prevent immune-mediated oral diseases. J Oral Pathol Med (2015) 44: 214–221
Correspondence: Prof. Dr. Wipawee Nittayananta, Prince of Songkla University, Hat Yai, Songkhla 90110, Thailand. Tel: +66 74 284406, Fax: +66 74 284406, E-mail: [email protected] Accepted for publication May 19, 2014
Keywords: cytokines; ellagic acid; hBD2; innate immunity; oral epithelial cells; secretory leukocyte protease inhibitor
Introduction Innate immunity plays a crucial role in maintaining homeostasis of the oral cavity and regulating oral infection and cancer (1–4). Human epithelial cells lining mucosal surfaces of the oral cavity consist of stratified squamous epithelia (5), which are parts of the innate immunity. These cells provide not only a physical barrier but also a chemical barrier against adhesion and invasion of microbes. The physical barrier is composed of cell–cell junctions, closely adherent cells, and a complex and continuous differentiation pattern. As for the chemical barrier, the epithelial cells produce various innate immune mediators including human b-defensin 2 (hBD2) and secretory leukocyte protease inhibitor (SLPI) (1, 3) to protect the mucous membranes against colonization and invasion by pathogens and prevent the uptake of undegraded antigen (Ag) (6, 7). In addition, a recent study reported that oral epithelial cells secrete high concentrations of cytokines and chemokines such as tumor necrosis factor a (TNF-a), interleukin-2 (IL-2), and interleukin-4 (IL-4) as pro-inflammatory and immunoregulatory factors (8). These mediators activate and regulate the inflammatory and immune responses of both the innate and adaptive immune systems (9). Impairment of mucosal innate immunity as found in patients with diabetes, cancer, and human immunodeficiency virus (HIV) infection could lead to opportunistic infection such as oral candidiasis (10, 11). Previous studies demonstrated that the expression of hBDs and SLPI was altered in oral squamous cell carcinoma (OSCC) compared with normal oral epithelium (1–3). Pro-inflammatory cytokines such as TNF-a, interleukin 6 (IL-6), and interleukin 8 (IL-8) have also been shown to exert various biological functions including regulating inflammatory responses and cancer development (4). These molecules maintain a central role in the host protective immunity. Thus, changes in their expression may dictate the host defense processes.
Ellagic acid and oral innate immunity Promsong et al.
Ellagic acid (EA) is a dimeric derivative of gallic acid found in various fruits such as pomegranates, blackberries, raspberries, strawberries, and walnuts (12). Its structure is shown in Fig. 1. Plants produce EA and convert it to a form of tannin known as ellagitannins (13). EA has various pharmacological functions. Besides its antioxidant (14) and antitumor properties (15, 16), EA possesses antiallergic, anti-inflammatory, antibacterial (17, 18), and antiviral activities (19). It is not known, however, if EA could enhance mucosal innate immunity. We hypothesized that EA could modulate the expression of innate immune mediators. The purpose of this study was to determine the effects of EA on the expression of innate immune mediators produced by oral epithelial cells.
Materials and methods EA preparation Ellagic acid available as commercial powder from chestnut barks was used (Sigma, Saint Louis, MO, USA). It was dissolved in 1 M sodium hydroxide (NaOH), and the final dilution was used as 0.03% of initial solvent (1 M NaOH). Primary human gingival epithelial cell preparation Gingival tissue for primary human gingival epithelial cells (HGEs) was obtained from healthy human subjects, who were patients undergoing surgical removal of third-molar teeth impaction at the Oral Surgery Clinic, School of Dentistry, University of Washington in accordance with the approval of University of Washington Institutional Review Board. HGEs were isolated for cell cultures as previously described (20). HGEs were grown in keratinocyte basal medium (KBM) with 0.03 mM Ca2+ using the supplements from Clonetics BEGM SingleQuots (except retinoic acid) (Lonza, Walkersville, MD, USA) for cell proliferation, then shifted to 0.15 mM Ca2+ in KBM containing the supplements from Clonetics KGM SingleQuots (Lonza) for all experiments. Third-passage cultures of HGEs were used for experimental studies. Cytotoxicity assay Cellular toxicity of EA on HGEs was assessed by CellTiterblueâ cell viability assay (Promega, Madison, WI, USA). The assay was performed according to manufacturer’s instructions. Cells were seeded at a density of
Figure 1 The structure of ellagic acid, IUPAC name is 2,3,7,8-Tetrahydroxy-chromeno [5,4,3-cde] chromene-5,10-dione.
1.8 9 104 cells/well into a 96-well plate with KBM/KGM medium and incubated for cell adhesion at 37°C in a humid atmosphere of 5% CO2 for 24 h. Then the old medium in each well was discarded, and EA at different concentrations ranging from 12.5 to 100 lM was mixed with the medium and replaced into each well (100 ll/well) in triplicate. The wells with untreated cells were used as a vehicle control while wells without cells and with each concentration were used as negative controls to determine background fluorescence. The plate was incubated at 37°C for 18 h. After incubation, CellTiter-blueTM reagent was added directly to each well (20 ll/well). After that, plate was shaken for 10 s and incubated at 37°C for 2 h to allow the conversion of resazurin to resorufin by metabolically active cells. Sodium dodecyl sulfate (SDS) at 3% was added at 50 ll into each well for stopping and stabilizing the reaction. The fluorescence was measured at excitation 570 nm and emission 590 nm.
215
Treatment with EA in human gingival epithelial cell culture To test the hypothesis if EA could induce the expression of innate immunity in cultured HGEs in vitro, HGEs were seeded at a density of 99104 cells/well into a 12-well plate and cultured in KBM/KGM medium and then incubated for cell adhesion at 37 °C in a humid atmosphere of 5% CO2 for 24 h. Subsequently, the cell culture medium was aspirated, and the cells were treated with absence or presence of EA at various concentrations of 12.5, 25, 50, or 100 µM that were mixed with the medium, added into each well (1 ml/well) and incubated at 37 ºC for 18 h. Untreated cells and solvent (NaOH) for EA served as negative controls while cells stimulated with TNF-a at a concentration of 100 ng/ml served as positive controls. After incubation, the supernatants from culture media were collected, and secreted protein levels were measured using ELISA and Luminex technology. For harvesting the cells, 1 ml of sterile phosphate-buffered saline (PBS) was gently added into each well to wash the cells, then aspirated out and repeated again. Finally, total RNA was extracted from the cells using the RNeasy Mini Kit (Qiagen Inc., Valencia, CA, USA) and treated with RNase-Free DNase kit (Qiagen Inc.) to purify RNA from genomic DNA contamination according to the manufacturer’s protocols. The supernatants and total RNA were stored at 80°C until processed. cDNA preparation and quantitative real-time PCR After extraction, concentration of the total RNA was measured using NanoDrop 1000 Spectrophotometer (Thermo scientific, Wilmington, DE, USA). Single stranded cDNA was synthesized using 500 ng of total RNA in 20 ll total volume with the iScriptTM cDNA Synthesis Kit (BioRad Laboratories, Inc., Hercules, CA, USA) according to the manufacturer’s instructions. Briefly, the reaction mix contained 59 iScript reaction mix 4 ll, iScript reverse transcriptase (RT) 1 ll, RNase-free water, and sample RNA template. Controls without RT enzyme were included in every experiment to confirm that cDNA synthesis was free of genomic DNA contamination. For quantitative real-time PCR, cDNA was analyzed using iQTM SYBRâ Green Supermix (Bio-Rad Laboratories, Inc.). The reaction was set up in a 96-well plate in total J Oral Pathol Med
Ellagic acid and oral innate immunity Promsong et al.
216
volume of 20 ll per reaction, and each well contained 10 ll of 29 SYBR Green Supermix, 1 ll of 2 lM each forward and reverse primers, 3 ll of cDNA template for target gene determination, or 2 ll of cDNA template for housekeeping control gene determination. Ribosomal phosphoprotein (RPO) was used as a housekeeping control gene to determine the total RNA level. Additional controls were set up using deionized water instead of cDNA template. Amplification was performed using C1000tm thermal cycler and CFX96TM Real-Time System Software (Bio-Rad) under the following conditions: initial denaturation at 95°C for 3 min followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 55– 60°C (depending on each primer pair) for 30 s, and elongation at 72°C for 60 s. Melt-curve analysis was set up to confirm that the expected amplification product was specific and no binding of primer dimers formed at the end of each real-time PCR. Oligonucleotide primer sequences for RPO, hBD2, SLPI, chemokine (C-X-C motif) ligand 5 (CXCL5), chemokine (C-C motif) ligand 20 (CCL20), and IL-8 were used as shown in Table 1 (21–23). All amplifications were performed in duplicate, and average threshold cycle (Ct) values were calculated. The levels of gene expression were normalized to RPO expression and calculated as relative expression compared with untreated control using mathematical model proposed by Pfaffl (24). Briefly, difference of Ct was calculated ΔCT to determine as the difference between target gene and housekeeping gene RPO. Then the difference between treated cells and untreated cells for each gene was performed ΔΔCT. The fold change was determined as 2ΔΔCT.
autoplex analyzer, PerkinElmer and Luminex xMAPTM Technology (Luminex Corporation, Austin, TX, USA). Various cytokines and chemokines were detected including: interferon-c (IFN-c), interleukin-1b (IL-1b), interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-6 (IL-6), interleukin8 (IL-8), interleukin-10 (IL-10), monocyte chemotactic protein (MCP-1), regulated upon activation, normal T cell expressed and secreted (RANTES), and tumor necrosis factor a (TNF-a). Fifty microliters of samples were required to perform the Luminex assay according to the manufacturer’s procedure. The experiments were set in duplicate. Concentration of each cytokine/chemokine was evaluated from a standard curve generated in each set of the experiments by MasterPlex QT version 3.0.1.170 (Luminex Corporation, Austin, TX, USA). The minimum detection limit for these commercial assays was 3.02 pg/ml for IFN-c, 2.81 pg/ml for IL-1b, 0.64 pg/ml for IL-2, 7.08 pg/ml for IL-4, 10.92 pg/ml for IL-6, 3.91 pg/ml for IL-8, 3.09 pg/ml for IL-10, 2.31 pg/ml for MCP-1, 3.43 pg/ml for RANTES, and 5.90 pg/ml for TNF-a while level measurement at below these limits was deemed undetectable.
Detection of innate immune mediators in culture medium Levels of immune mediators in the culture medium were measured by ELISA and Luminex technology. The culture medium stored at 80°C was thawed on wet ice and then centrifuged at 4°C for 10 min at 221 g (Centrifuge 5430R; Eppendorf, Hauppauge, NY, USA) before using. SLPI (R&D Systems, Minneapolis, MN, USA) and hBD2 (Alpha diagnostic international, San Antonio, TX, USA) were quantified by ELISA. One hundred microliters of samples were required to perform each ELISA assay according to the manufacturer’s instructions. Plates were measured via absorbance at 450 nm and wavelength correction at 570 nm (only SLPI) using Skanlt software 2.4.3 Re for Varioskan Flash (Thermo scientific, Waltham, MA, USA). The cytokines and chemokines were measured by Magnetic luminex performance assay (R&D Systems) using CS 1000
Results
Statistical analysis Results were recorded as mean standard deviation (SD) of differences in the gene or protein expression between treated cells and untreated cells in duplicate cultures of two to four separate experiments. The data were analyzed using one-way ANOVA and/or Kruskal–Wallis H-test for the differences between groups at various concentrations. Statistical significance was set at P < 0.05.
Cytotoxicity of EA on human gingival epithelial cells By using CellTiter-blueâ cell viability assay, no cytotoxicity was observed when HGEs were treated in triplicate in three separate experiments with various concentrations of EA for up to 18 h. More than 80% cell viability was noted in the presence of EA ranging from 12.5 to 100 lM (Fig. 2). Effects of EA on the expression of oral innate immunity In the presence of EA, the expressions of both hBD2 and SLPI mRNA were significantly upregulated (P < 0.05) in a dose-dependent manner (Fig. 3A,B). In contrast, the expressions of CCL20, IL-8, and CXCL5 mRNA were downregulated in a dose-dependent manner as shown in Fig. 3C,D,
Table 1 Primer sequences used for quantitative real-time PCR Oligonucleotide primer sequences (50 –30 ) Gene product RPO (NM_001002.3) hBD2 (NM_004942.2) SLPI (NM_003064.3) CCL20 (NM_004591.2) CXCL5 (NM_002994.4) IL-8 (NM_000584.3)
Forward
Reverse
GCCTTGACCTTTTCAGCAAG CCAGCCATCAGCCATGAGGGT CCAGGGAAGAAGAGATGTTG TTTATTGTGGGCTTCACACG TCTGCAAGTGTTCGCCATAG GAGGGTTGTGGAGAAGTTTTTG
GCAGCATCTACAACCCTGAAG GGAGCCCTTTCT GAATCC GCA GGCTTCCTCCTTGTTGGG GATTTGCGCACACAGACAAC TGTCTTCCCTGGGTTCAGAG CTGGCATCTTCACTGATTCTTG
RPO, ribosomal phosphoprotein; hBD2, human beta-defensin 2; SLPI, secretory leukocyte protease inhibitor; CCL20, chemokine (C-C motif) ligand 20; CXCL5, chemokine (C-X-C motif) ligand 5; IL-8, interleukin 8. J Oral Pathol Med
Ellagic acid and oral innate immunity Promsong et al.
120
% cell viability
100 80 60 40 20 0 Untreated 12.5 25 50 100 Concentration of ellagic acid (µM)
Figure 2 Cytotoxicity of ellagic acid (EA) at 12.5–100 lM. No cytotoxic effects on human gingival epithelial cells (HGEs) were detected by CellTiter-blueâ cell viability assay for up to 18 h after the treatment. EA was dissolved in 1 M NaOH at 0.3% final concentration. Results are mean SD of three independent experiments.
E, respectively. In addition, the levels of hBD2 and SLPI proteins in the supernatants were increased in a dosedependent manner consistent with the mRNA expression in HGEs (Fig. 3F,G). The experiments were performed in duplicate in two to four separate experiments. Effects of EA on cytokine and chemokine secretion levels Eight of ten cytokines and/or chemokines were detected by using Luminex assay, including RANTES, IL-1b, IL-2, IL6, IL-8, TNF-a, MPC-1, and IL-4 (Fig. 4A–H), while IFNc and IL-10 were below detectable levels. Interestingly, RANTES level was significantly increased (P < 0.05) in response to EA in a dose-dependent manner (Fig. 4A), whereas the levels of IL-6, IL-8, and TNF-a was decreased in a dose-dependent manner but not significant (Fig. 4D–F). Moreover, significantly increased expression of IL-2 was noted (P < 0.001) at 12.5 lM of EA. In contrast, the expression of IL-2 was decreased in the presence of 50 lM of EA (Fig. 4C). Figure 4B shows that the level of IL-1b was increased in response to 50 lM of EA but not statistically significant. Finally, the levels of MCP-1 and IL-4 were not increased in the presence of EA (Fig. 4G,H). The relative expression of the eight cytokines/chemokines compared with untreated controls is shown in Fig. 4I. Differential expression of the innate immune mediators produced by HGEs was observed in responses to 12.5 lM and 50 lM of EA. The experiments were performed in duplicate in two separate experiments.
Discussion This study demonstrated the effects of EA on various innate immune mediators produced by oral epithelial cells. We found that EA significantly induced the expression of hBD2 and SLPI without cytotoxicity at both transcriptional and translational levels. Differential expression of pro-inflammatory and immunoregulatory cytokines and chemokines in response to EA was also observed. The findings of this study suggest that EA, which is a natural polyphenolic compound found in different kinds of fruits, has the potential to induce the expression/secretion of innate immune mediators if applied in vivo. Prospective in vivo studies are needed to determine whether EA can help in restoring impaired mucosal immunity.
Epithelial cells covering mucosal surfaces play significant roles in mucosal innate immunity (25). Besides providing a physical barrier, the cells express different antimicrobial peptides, cytokines, and chemokines as parts of innate immune defense against infection (8, 9). Infection at mucosal surfaces may be prevented by enhancing mucosal innate immunity. As our findings demonstrated that EA modulates the expression of various innate immune mediators, the prevention of infection at mucosal surfaces may be more efficient in the presence of EA. Upregulated expression of hBD2 and SLPI by oral epithelial cells in response to EA was observed in the present study. It has been shown that EA possesses a wide biological properties such as antimicrobial, antioxidant, anti-inflammatory, and anticancer effects in several in vivo and in vitro models (14, 16, 18, 26). It exhibits antimutagenic and anticarcinogenic effects against diversity of carcinogens and functions as a blocking and suppressing agent in carcinogenesis (27, 28). Previous studies reported that hBD2 and SLPI were less expressed in oral cancer cells compared with normal oral epithelium (1, 3). Additionally, hBD2 showed a potent antimicrobial activity against Candida albicans (29), commonly found as an opportunistic pathogen in immunocompromised patients, such as diabetes, cancer, and HIV patients (10, 11). The upregulated expression of hBD2 and SLPI by oral epithelial cells in response to EA in the present study may imply that consuming EA-rich fruits or using topical agent products such as EA-containing mouthwash might help maintain oral homeostasis in those patients. The induction of hBD2 and SLPI expression at protein levels in response to EA may also enhance mucosal innate immunity against HIV-1 infection. Previous studies have shown that hBD2 and SLPI proteins possess anti-HIV-1 activities (30, 31). HBD2 could inhibit HIV-1 replication, especially of X4 viruses (30). Also, SLPI exerts an antiHIV-1 effect by binding to annexin II (a cell surface cofactor) and by weakening annexin II-mediated stabilization of fusion (31, 32). Thus, the increased expression of these proteins could promote the innate immunity. In addition, a previous study has reported that EA can inhibit HIV-1 integrase enzyme (33). As more than 90% of global HIV-1 transmission occurs across mucosal surfaces (34), it would be interesting to explore the impact of EA on HIV-1 transmission on mucosal cells, and to determine if it can be used as a topical microbicide to prevent the viral infection. In the present study, the effects of EA on the production of both pro-inflammatory and immunoregulatory cytokines by oral epithelial cells were investigated. Markers identified as pro-inflammatory cytokines were IL1b, IL-6, IL-8, MCP-1, RANTES, and TNF-a and as immunoregulatory cytokines were IL-2 and IL-4. The increased expression of RANTES, IL-1b, and IL-2 was noted while the decreased expression of IL-6, IL-8, TNFa, CCL20, and CXCL5 was observed in a dose-dependent manner in response to EA. In contrast, the expression of MCP-1 and IL-4 was not changed in the presence of EA. These findings suggest that EA could differentially affect the expression of cytokines/chemokines produced by oral epithelial cells.
217
J Oral Pathol Med
Ellagic acid and oral innate immunity Promsong et al.
218
hBD2
B **
4.0
**
3.0 *
2.0 1.0
Relative expression
Relative expression
A
SLPI *** 2
12.5
25
50
Untreated
100
Concentration of ellagic acid (µM)
C
12.5
25
D
100
IL-8
0.9 **
0.6 0.3
Relative expression
1.2
**
50
Concentration of ellagic acid (µM)
CCL20
1.2
Relative expression
**
0 Untreated
1.0 0.8 **
0.6
***
**
50
100
0.4 0.2 0.0
0.0 Untreated
12.5
25
50
Untreated
100
CXCL5
1.2 0.9
*
0.6
25
hBD2 protein
F
1.5
*
0.3
Relative expression
E
12.5
Concentration of ellagic acid (µM)
Concentration of ellagic acid (µM)
Relative expression
*
1
0.0
4.0
**
3.0 2.0 1.0 0.0
0.0 Untreated
12.5
25
50
100
G
Untreated
12.5
25
50
100
Concentration of ellagic acid (µM)
Concentration of ellagic acid (µM)
Relative expression
***
3
SLPI protein
1.5 1.0 0.5 0.0 Untreated
12.5
25
50
100
Concentration of ellagic acid (µM)
Figure 3 The effects of ellagic acid (EA) on hBD2, SLPI, CCL20, IL-8, and CXCL5 expression in human gingival epithelial cells (HGEs). EA was used at various concentrations ranging from 12.5 to 100 lM to treat the cells for 18 h. (A) and (B) the expression of hBD2 and SLPI mRNA was significantly increased in a dose-dependent manner. (C), (D), and (E) the expression of CCL20, IL-8 and CXCL5 mRNA was decreased in a dose-dependent manner. The levels of gene expression were normalized to ribosomal phosphoprotein (RPO) expression by quantitative real-time PCR. (F) and (G) hBD2 and SLPI protein was secreted in a dose-dependent manner consistent with mRNA expression levels. The levels of protein expression were measured by ELISA. Untreated cells and cells stimulated with tumor necrosis factor a (TNF-a) were served as negative and positive controls, respectively. Values represent relative expression compared to untreated control. Results were analyzed as mean SD of two to four independent experiments. P-values were presented as *
doi: 10.1111/jop.12223
wileyonlinelibrary.com/journal/jop
Ellagic acid modulates the expression of oral innate immune mediators: potential role in mucosal protection Aornrutai Promsong1, Whasun Oh Chung2, Surada Satthakarn1, Wipawee Nittayananta3,4,5 1
Department of Biomedical Sciences, Faculty of Medicine, Prince of Songkla University, Hat Yai, Songkhla, Thailand; 2Department of Oral Health Sciences, University of Washington, Seattle, WA, USA; 3Excellent Research Laboratory, Phytomedicine and Pharmaceutical Biotechnology Excellence Center, Hat Yai, Songkhla, Thailand; 4Natural Product Research Center of Excellence, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla, Thailand; 5Graduate School, Prince of Songkla University, Hat Yai, Songkhla, Thailand
BACKGROUND: Ellagic acid (EA) found in various fruits such as pomegranates, blackberries, raspberries, strawberries, and walnuts has different pharmacological functions including antioxidant, antitumor, antiallergic, anti-inflammatory, antibacterial, and antiviral activities. It is not known, however, if EA could enhance mucosal innate immunity. Our goal was to determine the effects of EA on the expression of innate immune mediators produced by oral epithelial cells. METHODS: Culture of primary human gingival epithelial cells (HGEs) was performed in duplicate, and after the primary HGEs had been treated with EA at a concentration ranging from 12.5 to 100 lM for 18 h the cells and supernatants were harvested. The expression of innate immune mediators including human b-defensin 2 (hBD2), secretory leukocyte protease inhibitor (SLPI), and various cytokines and chemokines was measured at both transcriptional and translational levels by using quantitative real-time PCR, ELISA, and Luminex assay. RESULTS: In the presence of EA, the expression of hBD2-and SLPI mRNA was 3.7-folds and 2.6-folds greater than untreated controls, respectively, and consistent with their secreted protein levels. For cytokines and chemokines, increased expression of RANTES, IL-2, and IL-1b was found in response to EA. In contrast, EA decreased the expression of IL-6, IL-8, and TNF-a. CONCLUSIONS: This study demonstrated that oral innate immunity is affected by EA found in fruits. Thus, it may play some roles in mucosal innate immunity. The potential of EA for modulating the innate immune mediators may lead to developing a new topical agent to treat and/or prevent immune-mediated oral diseases. J Oral Pathol Med (2015) 44: 214–221
Correspondence: Prof. Dr. Wipawee Nittayananta, Prince of Songkla University, Hat Yai, Songkhla 90110, Thailand. Tel: +66 74 284406, Fax: +66 74 284406, E-mail: [email protected] Accepted for publication May 19, 2014
Keywords: cytokines; ellagic acid; hBD2; innate immunity; oral epithelial cells; secretory leukocyte protease inhibitor
Introduction Innate immunity plays a crucial role in maintaining homeostasis of the oral cavity and regulating oral infection and cancer (1–4). Human epithelial cells lining mucosal surfaces of the oral cavity consist of stratified squamous epithelia (5), which are parts of the innate immunity. These cells provide not only a physical barrier but also a chemical barrier against adhesion and invasion of microbes. The physical barrier is composed of cell–cell junctions, closely adherent cells, and a complex and continuous differentiation pattern. As for the chemical barrier, the epithelial cells produce various innate immune mediators including human b-defensin 2 (hBD2) and secretory leukocyte protease inhibitor (SLPI) (1, 3) to protect the mucous membranes against colonization and invasion by pathogens and prevent the uptake of undegraded antigen (Ag) (6, 7). In addition, a recent study reported that oral epithelial cells secrete high concentrations of cytokines and chemokines such as tumor necrosis factor a (TNF-a), interleukin-2 (IL-2), and interleukin-4 (IL-4) as pro-inflammatory and immunoregulatory factors (8). These mediators activate and regulate the inflammatory and immune responses of both the innate and adaptive immune systems (9). Impairment of mucosal innate immunity as found in patients with diabetes, cancer, and human immunodeficiency virus (HIV) infection could lead to opportunistic infection such as oral candidiasis (10, 11). Previous studies demonstrated that the expression of hBDs and SLPI was altered in oral squamous cell carcinoma (OSCC) compared with normal oral epithelium (1–3). Pro-inflammatory cytokines such as TNF-a, interleukin 6 (IL-6), and interleukin 8 (IL-8) have also been shown to exert various biological functions including regulating inflammatory responses and cancer development (4). These molecules maintain a central role in the host protective immunity. Thus, changes in their expression may dictate the host defense processes.
Ellagic acid and oral innate immunity Promsong et al.
Ellagic acid (EA) is a dimeric derivative of gallic acid found in various fruits such as pomegranates, blackberries, raspberries, strawberries, and walnuts (12). Its structure is shown in Fig. 1. Plants produce EA and convert it to a form of tannin known as ellagitannins (13). EA has various pharmacological functions. Besides its antioxidant (14) and antitumor properties (15, 16), EA possesses antiallergic, anti-inflammatory, antibacterial (17, 18), and antiviral activities (19). It is not known, however, if EA could enhance mucosal innate immunity. We hypothesized that EA could modulate the expression of innate immune mediators. The purpose of this study was to determine the effects of EA on the expression of innate immune mediators produced by oral epithelial cells.
Materials and methods EA preparation Ellagic acid available as commercial powder from chestnut barks was used (Sigma, Saint Louis, MO, USA). It was dissolved in 1 M sodium hydroxide (NaOH), and the final dilution was used as 0.03% of initial solvent (1 M NaOH). Primary human gingival epithelial cell preparation Gingival tissue for primary human gingival epithelial cells (HGEs) was obtained from healthy human subjects, who were patients undergoing surgical removal of third-molar teeth impaction at the Oral Surgery Clinic, School of Dentistry, University of Washington in accordance with the approval of University of Washington Institutional Review Board. HGEs were isolated for cell cultures as previously described (20). HGEs were grown in keratinocyte basal medium (KBM) with 0.03 mM Ca2+ using the supplements from Clonetics BEGM SingleQuots (except retinoic acid) (Lonza, Walkersville, MD, USA) for cell proliferation, then shifted to 0.15 mM Ca2+ in KBM containing the supplements from Clonetics KGM SingleQuots (Lonza) for all experiments. Third-passage cultures of HGEs were used for experimental studies. Cytotoxicity assay Cellular toxicity of EA on HGEs was assessed by CellTiterblueâ cell viability assay (Promega, Madison, WI, USA). The assay was performed according to manufacturer’s instructions. Cells were seeded at a density of
Figure 1 The structure of ellagic acid, IUPAC name is 2,3,7,8-Tetrahydroxy-chromeno [5,4,3-cde] chromene-5,10-dione.
1.8 9 104 cells/well into a 96-well plate with KBM/KGM medium and incubated for cell adhesion at 37°C in a humid atmosphere of 5% CO2 for 24 h. Then the old medium in each well was discarded, and EA at different concentrations ranging from 12.5 to 100 lM was mixed with the medium and replaced into each well (100 ll/well) in triplicate. The wells with untreated cells were used as a vehicle control while wells without cells and with each concentration were used as negative controls to determine background fluorescence. The plate was incubated at 37°C for 18 h. After incubation, CellTiter-blueTM reagent was added directly to each well (20 ll/well). After that, plate was shaken for 10 s and incubated at 37°C for 2 h to allow the conversion of resazurin to resorufin by metabolically active cells. Sodium dodecyl sulfate (SDS) at 3% was added at 50 ll into each well for stopping and stabilizing the reaction. The fluorescence was measured at excitation 570 nm and emission 590 nm.
215
Treatment with EA in human gingival epithelial cell culture To test the hypothesis if EA could induce the expression of innate immunity in cultured HGEs in vitro, HGEs were seeded at a density of 99104 cells/well into a 12-well plate and cultured in KBM/KGM medium and then incubated for cell adhesion at 37 °C in a humid atmosphere of 5% CO2 for 24 h. Subsequently, the cell culture medium was aspirated, and the cells were treated with absence or presence of EA at various concentrations of 12.5, 25, 50, or 100 µM that were mixed with the medium, added into each well (1 ml/well) and incubated at 37 ºC for 18 h. Untreated cells and solvent (NaOH) for EA served as negative controls while cells stimulated with TNF-a at a concentration of 100 ng/ml served as positive controls. After incubation, the supernatants from culture media were collected, and secreted protein levels were measured using ELISA and Luminex technology. For harvesting the cells, 1 ml of sterile phosphate-buffered saline (PBS) was gently added into each well to wash the cells, then aspirated out and repeated again. Finally, total RNA was extracted from the cells using the RNeasy Mini Kit (Qiagen Inc., Valencia, CA, USA) and treated with RNase-Free DNase kit (Qiagen Inc.) to purify RNA from genomic DNA contamination according to the manufacturer’s protocols. The supernatants and total RNA were stored at 80°C until processed. cDNA preparation and quantitative real-time PCR After extraction, concentration of the total RNA was measured using NanoDrop 1000 Spectrophotometer (Thermo scientific, Wilmington, DE, USA). Single stranded cDNA was synthesized using 500 ng of total RNA in 20 ll total volume with the iScriptTM cDNA Synthesis Kit (BioRad Laboratories, Inc., Hercules, CA, USA) according to the manufacturer’s instructions. Briefly, the reaction mix contained 59 iScript reaction mix 4 ll, iScript reverse transcriptase (RT) 1 ll, RNase-free water, and sample RNA template. Controls without RT enzyme were included in every experiment to confirm that cDNA synthesis was free of genomic DNA contamination. For quantitative real-time PCR, cDNA was analyzed using iQTM SYBRâ Green Supermix (Bio-Rad Laboratories, Inc.). The reaction was set up in a 96-well plate in total J Oral Pathol Med
Ellagic acid and oral innate immunity Promsong et al.
216
volume of 20 ll per reaction, and each well contained 10 ll of 29 SYBR Green Supermix, 1 ll of 2 lM each forward and reverse primers, 3 ll of cDNA template for target gene determination, or 2 ll of cDNA template for housekeeping control gene determination. Ribosomal phosphoprotein (RPO) was used as a housekeeping control gene to determine the total RNA level. Additional controls were set up using deionized water instead of cDNA template. Amplification was performed using C1000tm thermal cycler and CFX96TM Real-Time System Software (Bio-Rad) under the following conditions: initial denaturation at 95°C for 3 min followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 55– 60°C (depending on each primer pair) for 30 s, and elongation at 72°C for 60 s. Melt-curve analysis was set up to confirm that the expected amplification product was specific and no binding of primer dimers formed at the end of each real-time PCR. Oligonucleotide primer sequences for RPO, hBD2, SLPI, chemokine (C-X-C motif) ligand 5 (CXCL5), chemokine (C-C motif) ligand 20 (CCL20), and IL-8 were used as shown in Table 1 (21–23). All amplifications were performed in duplicate, and average threshold cycle (Ct) values were calculated. The levels of gene expression were normalized to RPO expression and calculated as relative expression compared with untreated control using mathematical model proposed by Pfaffl (24). Briefly, difference of Ct was calculated ΔCT to determine as the difference between target gene and housekeeping gene RPO. Then the difference between treated cells and untreated cells for each gene was performed ΔΔCT. The fold change was determined as 2ΔΔCT.
autoplex analyzer, PerkinElmer and Luminex xMAPTM Technology (Luminex Corporation, Austin, TX, USA). Various cytokines and chemokines were detected including: interferon-c (IFN-c), interleukin-1b (IL-1b), interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-6 (IL-6), interleukin8 (IL-8), interleukin-10 (IL-10), monocyte chemotactic protein (MCP-1), regulated upon activation, normal T cell expressed and secreted (RANTES), and tumor necrosis factor a (TNF-a). Fifty microliters of samples were required to perform the Luminex assay according to the manufacturer’s procedure. The experiments were set in duplicate. Concentration of each cytokine/chemokine was evaluated from a standard curve generated in each set of the experiments by MasterPlex QT version 3.0.1.170 (Luminex Corporation, Austin, TX, USA). The minimum detection limit for these commercial assays was 3.02 pg/ml for IFN-c, 2.81 pg/ml for IL-1b, 0.64 pg/ml for IL-2, 7.08 pg/ml for IL-4, 10.92 pg/ml for IL-6, 3.91 pg/ml for IL-8, 3.09 pg/ml for IL-10, 2.31 pg/ml for MCP-1, 3.43 pg/ml for RANTES, and 5.90 pg/ml for TNF-a while level measurement at below these limits was deemed undetectable.
Detection of innate immune mediators in culture medium Levels of immune mediators in the culture medium were measured by ELISA and Luminex technology. The culture medium stored at 80°C was thawed on wet ice and then centrifuged at 4°C for 10 min at 221 g (Centrifuge 5430R; Eppendorf, Hauppauge, NY, USA) before using. SLPI (R&D Systems, Minneapolis, MN, USA) and hBD2 (Alpha diagnostic international, San Antonio, TX, USA) were quantified by ELISA. One hundred microliters of samples were required to perform each ELISA assay according to the manufacturer’s instructions. Plates were measured via absorbance at 450 nm and wavelength correction at 570 nm (only SLPI) using Skanlt software 2.4.3 Re for Varioskan Flash (Thermo scientific, Waltham, MA, USA). The cytokines and chemokines were measured by Magnetic luminex performance assay (R&D Systems) using CS 1000
Results
Statistical analysis Results were recorded as mean standard deviation (SD) of differences in the gene or protein expression between treated cells and untreated cells in duplicate cultures of two to four separate experiments. The data were analyzed using one-way ANOVA and/or Kruskal–Wallis H-test for the differences between groups at various concentrations. Statistical significance was set at P < 0.05.
Cytotoxicity of EA on human gingival epithelial cells By using CellTiter-blueâ cell viability assay, no cytotoxicity was observed when HGEs were treated in triplicate in three separate experiments with various concentrations of EA for up to 18 h. More than 80% cell viability was noted in the presence of EA ranging from 12.5 to 100 lM (Fig. 2). Effects of EA on the expression of oral innate immunity In the presence of EA, the expressions of both hBD2 and SLPI mRNA were significantly upregulated (P < 0.05) in a dose-dependent manner (Fig. 3A,B). In contrast, the expressions of CCL20, IL-8, and CXCL5 mRNA were downregulated in a dose-dependent manner as shown in Fig. 3C,D,
Table 1 Primer sequences used for quantitative real-time PCR Oligonucleotide primer sequences (50 –30 ) Gene product RPO (NM_001002.3) hBD2 (NM_004942.2) SLPI (NM_003064.3) CCL20 (NM_004591.2) CXCL5 (NM_002994.4) IL-8 (NM_000584.3)
Forward
Reverse
GCCTTGACCTTTTCAGCAAG CCAGCCATCAGCCATGAGGGT CCAGGGAAGAAGAGATGTTG TTTATTGTGGGCTTCACACG TCTGCAAGTGTTCGCCATAG GAGGGTTGTGGAGAAGTTTTTG
GCAGCATCTACAACCCTGAAG GGAGCCCTTTCT GAATCC GCA GGCTTCCTCCTTGTTGGG GATTTGCGCACACAGACAAC TGTCTTCCCTGGGTTCAGAG CTGGCATCTTCACTGATTCTTG
RPO, ribosomal phosphoprotein; hBD2, human beta-defensin 2; SLPI, secretory leukocyte protease inhibitor; CCL20, chemokine (C-C motif) ligand 20; CXCL5, chemokine (C-X-C motif) ligand 5; IL-8, interleukin 8. J Oral Pathol Med
Ellagic acid and oral innate immunity Promsong et al.
120
% cell viability
100 80 60 40 20 0 Untreated 12.5 25 50 100 Concentration of ellagic acid (µM)
Figure 2 Cytotoxicity of ellagic acid (EA) at 12.5–100 lM. No cytotoxic effects on human gingival epithelial cells (HGEs) were detected by CellTiter-blueâ cell viability assay for up to 18 h after the treatment. EA was dissolved in 1 M NaOH at 0.3% final concentration. Results are mean SD of three independent experiments.
E, respectively. In addition, the levels of hBD2 and SLPI proteins in the supernatants were increased in a dosedependent manner consistent with the mRNA expression in HGEs (Fig. 3F,G). The experiments were performed in duplicate in two to four separate experiments. Effects of EA on cytokine and chemokine secretion levels Eight of ten cytokines and/or chemokines were detected by using Luminex assay, including RANTES, IL-1b, IL-2, IL6, IL-8, TNF-a, MPC-1, and IL-4 (Fig. 4A–H), while IFNc and IL-10 were below detectable levels. Interestingly, RANTES level was significantly increased (P < 0.05) in response to EA in a dose-dependent manner (Fig. 4A), whereas the levels of IL-6, IL-8, and TNF-a was decreased in a dose-dependent manner but not significant (Fig. 4D–F). Moreover, significantly increased expression of IL-2 was noted (P < 0.001) at 12.5 lM of EA. In contrast, the expression of IL-2 was decreased in the presence of 50 lM of EA (Fig. 4C). Figure 4B shows that the level of IL-1b was increased in response to 50 lM of EA but not statistically significant. Finally, the levels of MCP-1 and IL-4 were not increased in the presence of EA (Fig. 4G,H). The relative expression of the eight cytokines/chemokines compared with untreated controls is shown in Fig. 4I. Differential expression of the innate immune mediators produced by HGEs was observed in responses to 12.5 lM and 50 lM of EA. The experiments were performed in duplicate in two separate experiments.
Discussion This study demonstrated the effects of EA on various innate immune mediators produced by oral epithelial cells. We found that EA significantly induced the expression of hBD2 and SLPI without cytotoxicity at both transcriptional and translational levels. Differential expression of pro-inflammatory and immunoregulatory cytokines and chemokines in response to EA was also observed. The findings of this study suggest that EA, which is a natural polyphenolic compound found in different kinds of fruits, has the potential to induce the expression/secretion of innate immune mediators if applied in vivo. Prospective in vivo studies are needed to determine whether EA can help in restoring impaired mucosal immunity.
Epithelial cells covering mucosal surfaces play significant roles in mucosal innate immunity (25). Besides providing a physical barrier, the cells express different antimicrobial peptides, cytokines, and chemokines as parts of innate immune defense against infection (8, 9). Infection at mucosal surfaces may be prevented by enhancing mucosal innate immunity. As our findings demonstrated that EA modulates the expression of various innate immune mediators, the prevention of infection at mucosal surfaces may be more efficient in the presence of EA. Upregulated expression of hBD2 and SLPI by oral epithelial cells in response to EA was observed in the present study. It has been shown that EA possesses a wide biological properties such as antimicrobial, antioxidant, anti-inflammatory, and anticancer effects in several in vivo and in vitro models (14, 16, 18, 26). It exhibits antimutagenic and anticarcinogenic effects against diversity of carcinogens and functions as a blocking and suppressing agent in carcinogenesis (27, 28). Previous studies reported that hBD2 and SLPI were less expressed in oral cancer cells compared with normal oral epithelium (1, 3). Additionally, hBD2 showed a potent antimicrobial activity against Candida albicans (29), commonly found as an opportunistic pathogen in immunocompromised patients, such as diabetes, cancer, and HIV patients (10, 11). The upregulated expression of hBD2 and SLPI by oral epithelial cells in response to EA in the present study may imply that consuming EA-rich fruits or using topical agent products such as EA-containing mouthwash might help maintain oral homeostasis in those patients. The induction of hBD2 and SLPI expression at protein levels in response to EA may also enhance mucosal innate immunity against HIV-1 infection. Previous studies have shown that hBD2 and SLPI proteins possess anti-HIV-1 activities (30, 31). HBD2 could inhibit HIV-1 replication, especially of X4 viruses (30). Also, SLPI exerts an antiHIV-1 effect by binding to annexin II (a cell surface cofactor) and by weakening annexin II-mediated stabilization of fusion (31, 32). Thus, the increased expression of these proteins could promote the innate immunity. In addition, a previous study has reported that EA can inhibit HIV-1 integrase enzyme (33). As more than 90% of global HIV-1 transmission occurs across mucosal surfaces (34), it would be interesting to explore the impact of EA on HIV-1 transmission on mucosal cells, and to determine if it can be used as a topical microbicide to prevent the viral infection. In the present study, the effects of EA on the production of both pro-inflammatory and immunoregulatory cytokines by oral epithelial cells were investigated. Markers identified as pro-inflammatory cytokines were IL1b, IL-6, IL-8, MCP-1, RANTES, and TNF-a and as immunoregulatory cytokines were IL-2 and IL-4. The increased expression of RANTES, IL-1b, and IL-2 was noted while the decreased expression of IL-6, IL-8, TNFa, CCL20, and CXCL5 was observed in a dose-dependent manner in response to EA. In contrast, the expression of MCP-1 and IL-4 was not changed in the presence of EA. These findings suggest that EA could differentially affect the expression of cytokines/chemokines produced by oral epithelial cells.
217
J Oral Pathol Med
Ellagic acid and oral innate immunity Promsong et al.
218
hBD2
B **
4.0
**
3.0 *
2.0 1.0
Relative expression
Relative expression
A
SLPI *** 2
12.5
25
50
Untreated
100
Concentration of ellagic acid (µM)
C
12.5
25
D
100
IL-8
0.9 **
0.6 0.3
Relative expression
1.2
**
50
Concentration of ellagic acid (µM)
CCL20
1.2
Relative expression
**
0 Untreated
1.0 0.8 **
0.6
***
**
50
100
0.4 0.2 0.0
0.0 Untreated
12.5
25
50
Untreated
100
CXCL5
1.2 0.9
*
0.6
25
hBD2 protein
F
1.5
*
0.3
Relative expression
E
12.5
Concentration of ellagic acid (µM)
Concentration of ellagic acid (µM)
Relative expression
*
1
0.0
4.0
**
3.0 2.0 1.0 0.0
0.0 Untreated
12.5
25
50
100
G
Untreated
12.5
25
50
100
Concentration of ellagic acid (µM)
Concentration of ellagic acid (µM)
Relative expression
***
3
SLPI protein
1.5 1.0 0.5 0.0 Untreated
12.5
25
50
100
Concentration of ellagic acid (µM)
Figure 3 The effects of ellagic acid (EA) on hBD2, SLPI, CCL20, IL-8, and CXCL5 expression in human gingival epithelial cells (HGEs). EA was used at various concentrations ranging from 12.5 to 100 lM to treat the cells for 18 h. (A) and (B) the expression of hBD2 and SLPI mRNA was significantly increased in a dose-dependent manner. (C), (D), and (E) the expression of CCL20, IL-8 and CXCL5 mRNA was decreased in a dose-dependent manner. The levels of gene expression were normalized to ribosomal phosphoprotein (RPO) expression by quantitative real-time PCR. (F) and (G) hBD2 and SLPI protein was secreted in a dose-dependent manner consistent with mRNA expression levels. The levels of protein expression were measured by ELISA. Untreated cells and cells stimulated with tumor necrosis factor a (TNF-a) were served as negative and positive controls, respectively. Values represent relative expression compared to untreated control. Results were analyzed as mean SD of two to four independent experiments. P-values were presented as *
