Original Article doi: 10.1111/joim.12218

Elevated expression of CX3C chemokine receptor 1 mediates recruitment of T cells into bone marrow of patients with acquired aplastic anaemia J. Ren1,2,*, X. Y. Hou1,*, S. H. Ma3, F. K. Zhang3, J. H. Zhen4, L. Sun1, Y. X. Sun1, Y. L. Hao5, Y. F. Cheng6, M. Hou1,7, C. G. Xu1, M. H. Zhang1 & J. Peng1 1 Department of Hematology, Qilu Hospital, Shandong University,Jinan; 2Department of Hematology, First Affiliated Hospital, Xi’an Jiaotong University, Xi’an; 3State Key Laboratory of Experimental Hematology, Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin; 4Department of Pathology, School of Medicine, Shandong University, Jinan; 5Department of Hematology, Jining First People’s Hospital, Jining; 6Department of Hematology, Zhongshan Hospital, Fudan University, Shanghai; and 7Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Jinan, China

Abstract. Ren J, Hou XY, Ma SH, Zhang FK, Zhen JH, Sun L, Sun YX, Hao YL, Cheng YF, Hou M, Xu CG, Zhang MH, Peng J (Qilu Hospital, Shandong University, Jinan; First Affiliated Hospital, Xi’an Jiaotong University, Xi’an; State Key Laboratory of Experimental Hematology, Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin; School of Medicine, Shandong University, Jinan; Jining First People’s Hospital, Jining; Zhongshan Hospital, Fudan University, Shanghai; and Key Laboratory of Cardiovascular Remodeling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Jinan, China). Elevated expression of CX3C chemokine receptor 1 mediates recruitment of T cells into bone marrow of patients with acquired aplastic anaemia. J Intern Med 2014; doi: 10.1111/joim.12218. Objective. Acquired aplastic anaemia (AA) is a T-cellmediated, organ-specific autoimmune disease characterized by haematopoietic stem cell destruction in the bone marrow. The exact molecular mechanism of T-cell trafficking into the bone marrow is unclear in AA. Very late activation antigen-4 (VLA-4) and CX3C chemokine receptor 1 (CX3CR1) play active roles in many autoimmune diseases. Therefore, we investigated whether VLA-4 and CX3CR1 also contribute to T-cell migration into the bone marrow in acquired AA. Design, setting and subjects. Expression levels of CX3CR1 and VLA-4 and their ligands [fractalkine (CX3CL1)

and vascular cell adhesion molecule-1 (VCAM-1)] were examined in 63 patients with AA and 21 healthy control subjects. T-cell chemotaxis and adhesion were analysed in 17 patients with severe AA. We also prospectively evaluated the expression pattern of CX3CR1 during treatment with antithymocyte globulin plus cyclosporine in 11 patients with severe AA. Results. The proportion of peripheral and bone marrow CD4+ and CD8+ T cells expressing CX3CR1 and the level of CX3CL1 was increased in patients with AA. However, there was no significant difference in VLA-4 expression or VCAM-1 levels. Functional studies demonstrated that chemotaxis towards autologous bone marrow plasma or soluble CX3CL1 was significantly higher in T cells from AA patients and could be blocked by CX3CR1 inhibitors. CX3CR1-mediated T-cell adhesion was also upregulated in these patients. The expression of CX3CR1 was associated with the efficacy of immunosuppressive therapy. Conclusion. The present findings demonstrate that CX3CR1 plays a pivotal role in recruitment of T cells into the bone marrow in acquired AA and is a potential therapeutic target for treatment of this disorder. Keywords: aplastic anaemia, CX3C chemokine receptor 1, T cells, very late activation antigen-4.

*These authors contributed equally to this manuscript. Prior presentation: Part of this study was presented orally at the 15th Congress of the European Hematology Association, Barcelona, Spain, 10–13 June 2010.

ª 2014 The Association for the Publication of the Journal of Internal Medicine

1

J. Ren et al.

Introduction Aplastic anaemia (AA) is a typical example of a syndrome of human bone marrow failure and is characterized by peripheral blood cytopenia and empty bone marrow. Most cases of acquired AA can be pathophysiologically characterized as T-cellmediated, organ-specific destruction of the bone marrow haematopoietic stem cells [1–5]. T-cell recruitment into bone marrow is mediated by adhesion molecules and chemokine receptors on the surface of T cells [6–8]. The results of an elegant study by Olsson et al. [9] suggested that increased expression of very late activation antigen-4 (VLA-4) and CX3C chemokine receptor 1 (CX3CR1) may contribute to the recruitment of T cells into the bone marrow where platelets are destroyed by CD8+ cytotoxic T cells in patients with immune thrombocytopenia [previously termed idiopathic thrombocytopenic purpura (ITP)]. This motivated us to investigate whether VLA-4 and CX3CR1 are involved in the pathogenesis of acquired AA, a classic bone marrow-specific cytotoxic T-cell-mediated disease. VLA-4 is a critical integrin that mediates cell–cell and cell–matrix interactions [10, 11]. The interaction between VLA-4 and its ligand vascular cell adhesion molecule-1 (VCAM-1) plays an important role in differentiation, migration and recruitment of leucocytes to sites of inflammation [12]. It has been reported that VLA-4 is involved in several autoimmune diseases, such as multiple sclerosis, Crohn’s disease and rheumatoid arthritis [13–15]. CX3CR1, the unique receptor for the chemokine fractalkine (CX3CL1), may directly mediate chemotaxis and adhesion of leucocytes. Accumulating evidence indicates that interaction between CX3CL1 and CX3CR1 may have a role in the pathogenesis of certain autoimmune diseases or chronic inflammatory disorders such as glomerulonephritis, rheumatoid arthritis, Wegener’s granulomatosis and systemic lupus erythematosus [16–19]. At present, however, the pathogenic roles of VLA-4/VCAM-1 and CX3CL1/CX3CR1 in T-cell trafficking remain unclear in AA. In the present study, to assess the roles of VLA-4 and CX3CR1 in T-cell accumulation in the bone marrow in AA, we analysed their expression in peripheral blood and bone marrow T cells and measured the levels of the ligands VCAM-1 and CX3CL1 in peripheral and bone marrow plasma. In

2

ª 2014 The Association for the Publication of the Journal of Internal Medicine Journal of Internal Medicine

T-cell recruitment to BM in AA

addition, CX3CR1-mediated chemotaxis and adhesion in response to CX3CL1 stimulation were measured in T cells from AA patients. We also prospectively evaluated the expression of CX3CR1 after immunosuppressive therapy with antithymocyte globulin (ATG) plus cyclosporine (CsA) in a small subset of patients with severe AA (SAA). Our findings reveal the molecular mechanism that underlies the recruitment of T cells from peripheral blood into the bone marrow during the development of acquired AA. Materials and methods Patients and control subjects Sixty-three patients who met the criteria for acquired AA [37 with SAA and 26 with moderate AA (MAA)] were enrolled in the present study from February 2009 to March 2013. The severity of AA was classified according to the criteria proposed by Camitta et al. [20]. All of the 37 SAA patients and 11 of the 26 MAA patients were newly diagnosed and had not received any specific treatments prior to sampling. The remaining 15 MAA patients had been treated with androgen, erythropoietin and/or CsA within the previous 12 months but had never received ATG or antilymphocyte globulin. In addition, 21 adult healthy volunteers were enrolled as the control group; baseline characteristics of the volunteers were comparable to those of the patients. Furthermore, we prospectively treated 11 of the 37 SAA patients with immunosuppressants and evaluated the expression of CX3CR1 by flow cytometry before and after treatment (trial registration: ClinicalTrials.gov NCT01680055). The immunosuppressive treatment regimen was rabbit ATG (Thymoglobulin, Genzyme, Polyclonals S.A.S. Marcy l‘Etoile, France) administered at a dose of 3 mg kg 1 day 1 for 5 days, plus CsA at a dose of 5 mg kg 1 day 1 (given in divided doses twice a day from day 1 and continued for at least 6 months). The CsA dose was adjusted to maintain trough blood levels of 200–400 ng mL 1 [21, 22]. Response was evaluated at 3 to 6 months following ATG plus CsA and was defined as no longer meeting the criteria for SAA; this strongly correlates with lack of requirement for transfusion [21, 23]. The study was approved by the local ethics committee. After receiving information about the nature and possible consequences of the studies, all patients and healthy volunteers provided written consent to participate.

J. Ren et al.

Preparation of peripheral blood or bone marrow mononuclear cells and T lymphocytes Peripheral blood or bone marrow mononuclear cells (PBMCs or BMMCs, respectively) were prepared for flow cytometry and real-time polymerase chain reaction (PCR) from heparinized blood and bone marrow by Ficoll-Hypaque (Pharmacia Biotech, Uppsala, Sweden) gradient centrifugation. CD4+ and CD8+ T cells were isolated from PBMCs or BMMCs by negative selection and then further isolated by positive selection with magnetic microbeads (MACS, order no. 130-050-301, 130053-101, 130-045-201; Miltenyi Biotec, Bergisch Gladbach, Germany) to remove the CD19+ cells according to the manufacturer’s instructions. The purity of CD4+ and CD8+ T cells was >90%.

T-cell recruitment to BM in AA

Thermo Scientific and rabbit monoclonal antiVLA-4 or rabbit polyclonal anti-CX3CR1 antibodies, Abcam, Hong Kong). Next, samples were stained with fluorescently labelled secondary antibodies (goat anti-rat antibody conjugated with Alexa Fluor 633; goat anti-mouse antibody conjugated with Alexa Fluor 555; donkey anti-rabbit antibody conjugated with Alexa Fluor 488, all Invitrogen, Eugene, OR, USA) for 30 min at 37 °C. The sections were analysed using a confocal laser scanning microscope system (Leica TCS SP2, Wetzlar, Germany). The percentage of CD4/ CX3CR1 or CD8/CX3CR1 co-positively stained cells in CD4+ or CD8+ T cells were calculated, and the mean fluorescence intensity (MFI) of VLA4 on CD4+ or CD8+ T cells was analysed in at least 15 high-power fields of each horizontal section.

Flow cytometry Peripheral blood or bone marrow mononuclear cells suspensions containing 1 9 106 cells were phenotypically stained with a three-colour combination using APC-conjugated anti-CD3 (eBioscience, San Diego, CA, USA), FITC-conjugated anti-CD4 and anti-CD8 (eBioscience,) and PEconjugated anti-VLA-4 (eBioscience) and antiCX3CR1 (Biolegend, San Diego, CA, USA) monoclonal antibodies (mAbs). Isotype-matched control mAbs were used as negative controls. After incubation at 4 °C for 30 min in the dark, the cells were washed twice with phosphate-buffered saline (PBS) containing 1% bovine serum albumin (BSA) and subjected to flow cytometry (FACS Calibur, BD Biosciences, San Diego, CA, USA). The proportions of T cells and the expression of VLA-4 and CX3CR1 are presented in Figure S1. Immunofluorescence double staining of bone marrow biopsies Paraffin-embedded bone marrow biopsies (5 lm thick) were sectioned and heated at 67 °C for 1 h. Then, deparaffinization and rehydration were carried out using xylene and alcohol gradients. After rinsing with PBS, the sections were boiled in antigen retrieval buffer (according to the protocol for the primary antibody) for 15 min, cooled at room temperature for at least 20 min and rinsed with PBS. After blocking nonspecific binding by incubation with 10% goat or donkey serum for 30 min at 37 °C, samples were incubated with the primary antibodies for 1 h at room temperature (mouse monoclonal anti-CD4, Thermo Scientific, Cheshire WA, UK; rat polyclonal anti-CD8,

Real-time PCR analysis Total RNA was isolated from the CD4+ and CD8+ T cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and the RNA concentration was measured with an A260/A280 ratio of 1.8 to 2.0. Next, RNA was reverse-transcribed to cDNA using the PrimeScript RT Reagent Kit (Perfect Real Time, Takara, Japan) according to the manufacturer’s instructions. Multiplex real-time PCR was carried out for CX3CR1 and the endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) on an ABIPRISM_7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using SYBR Green (Toyobo, Osaka, Japan) as a doublestrand DNA-specific binding dye. The PCRs were cycled 40 times after initial denaturation (95 °C, 5 min) with the following parameters: denaturation at 95 °C for 15 s; annealing at 65 °C for 15 s; and extension at 72 °C for 35 s, with temperature transition rates of 20 °C s 1. The sequences of the amplification primers for CX3CR1 and GAPDH were as follows: CX3CR1-forward primer, AARGCC TGGCTGTCCTGTGT; CX3CR1-reverse primer, GC CTGCTCCTTTGTGATTCAG; GAPDH-forward primer, GCACCGTCAAGGCTGAGAAC; and GAPDHreverse primer, TGGTGAAGACGCCAGTGGA. We used the comparative threshold cycle (Ct) method for relative quantification of CX3CR1 mRNA according to the relative expression software tool (REST, Michael, Munich, Germany). The amplification efficiencies between the target (CX3CR1) and the reference control (GAPDH) were compared for the delta delta Ct (DDCt) calculation. ª 2014 The Association for the Publication of the Journal of Internal Medicine Journal of Internal Medicine

3

J. Ren et al.

CX3CL1 and VCAM-1 enzyme-linked immunosorbent assay Plasma samples obtained from all participants by centrifugation of heparinized peripheral blood and bone marrow were cryopreserved at 80 °C until use, as described by Olsson et al. [9]. The levels of CX3CL1 and VCAM-1 were measured using commercially available enzyme-linked immunosorbent assay kits for human CX3CL1 (R&D Systems, Shanghai, China) and human VCAM-1 (Bender MedSystems Gmbh, Vienna, Austria) according to manufacturers’ instructions. All experiments were performed in triplicate. Chemotaxis assay Chemotactic activities were evaluated in 24-well transwell plates (Costar, Corning Incorp., Corning, NY, USA) as previously described [18] with minor modifications. In brief, the lower wells were filled with either 500 lL of autologous bone marrow plasma collected from SAA patients or healthy control subjects, or 500 lL of chemoattractant solution containing assay medium (RPMI 1640 with 0.5% BSA, 20 mmol L 1 HEPES, pH 7.4) and human CX3CL1 (chemokine domain full length with a poly-His-tail, R&D Systems) at concentrations known to be chemotactic for T cells and monocytes [24]. To estimate random migration, only assay medium was added to the lower chamber in negative control experiments. A fibronectincoated (10 lg mL 1, Sigma Chemical Co., St Louis, MO, USA) polycarbonate membrane with 8-lm pores was layered over the wells, and then, freshly isolated peripheral blood T cells (2.5 9 105 cells in 200 lL assay medium) from SAA patients and healthy individuals were seeded in the upper chamber and incubated (37 °C, 5% CO2, 12 h). In blank control samples, no cells were added. For blocking assays, a neutralizing anti-human CX3CL1/fractalkine mAb (10 lg mL 1; clone: 81506, R&D Systems) [25] or an engineered CX3CR1 antagonist (F1, provided by Dr. Philippe Deterre, Immunity and infection Laboratory, INSERM and UPMC Paris 6, France) was loaded into the lower wells at a final concentration of 300 ng mL 1 [26]. The nonmigrated cells were washed and scraped from the upper surface of the filters, and migrated cells were fixed with 4% formaldehyde and stained with crystal violet; the numbers of migrated cells in five random high-power fields (4009) were counted for each well. The results were expressed as a chemotactic index (CI), which represents the ratio of cells migrating in the presence of CX3CL1 or bone marrow plasma to 4

ª 2014 The Association for the Publication of the Journal of Internal Medicine Journal of Internal Medicine

T-cell recruitment to BM in AA

those in negative control experiments [26]. All experiments were performed in triplicate. Adhesion assay Cell adhesion was estimated using 96-well plates (Costar, Corning Incorp., Corning, NY, USA) coated with antipolyhistidine antibody (R&D Systems) diluted in PBS (1 : 1000) overnight at 4 °C [18]. After two washes with PBS, the wells were blocked with assay medium for 2 h at 37 °C and washed. CX3CL1 (full length with a polyhistidine tail, R&D Systems) at a final concentration of 30 nM was added to each well and incubated for 1 h at room temperature. To estimate random adhesion, uncoated wells were treated in parallel in the absence of antipoly-His antibody and CX3CL1. Following two washes with chemoattractant solution, freshly isolated bone marrow CD4+ and CD8+ T cells (5 9 105 cells in 100 lL assay medium) from SAA patients and healthy control subjects were added to each well and incubated for 1 h at 37 °C with or without F1 at a final concentration of 300 ng mL 1. After removing any unbound cells by washing with PBS, the bound cells were fixed with 4% formaldehyde and stained with Wright’s stain. The adherent cells were counted in five random high-power fields (4009). Random adhesion was subtracted, and data were expressed as the mean number of cells per field. All experiments were performed in triplicate. Statistical analysis Data are expressed as mean  SD. Statistical comparisons between groups were evaluated using the Student’s t-test (SPSS 17.0, SPSS Inc., Chicago, IL, USA). The expression of CX3CR1 and the efficacy of immunosuppressive therapy were analysed using Fisher’s exact probabilities in 2 9 2 tables, as appropriate. Differences with P-values