412

PEPTIDES AND PROTEINS

[22]

lar weights and to sequence a few of the moderate-sized peptides. These short stretches of peptide sequence could then serve as the basis for synthesizing oligonucleotide probes that, in turn, could be used to isolate the corresponding cDNA clone. The complete amino acid sequence of the protein could then be predicted from the resulting cDNA sequence and the predicted and actual molecular weights for all expected tryptic peptides could be compared. In this way peptides could be selected for mass spectrometric sequencing that either correspond to cDNA regions of sequence that contain DNA sequencing errors, such as single base "deletions," or that contain posttranslational modifications that, in many cases, play an essential role in protein function. It is clear that by rapidly bringing about either a complete or partial resolution of complex enzymatic and chemical digests of proteins, reversed-phase HPLC can make an essential contribution toward elucidating the primary structures of proteins. Acknowledgments The authors wish to thank the Sep/a/ra/tions (Hesperia, CA) and the Nest Group (Southborough, MA), as well as the Waters Chromatography Division, Millipore Corporation (Milford, MA), for providing some of the HPLC columns used in this study. We also thank the Perkin-Elmer Corporation (Emeryville, CA-)for the temporaryloan of an HPLC system.

[22] E l e c t r o s p r a y I o n i z a t i o n M a s s S p e c t r o m e t r y

By CHARLES G. EDMONDS and RICHARD D. SMITH Electrospray ionization (ESI) occurs during the electrostatic nebulization of a solution of charged analyte ions by a large electrostatic field gradient (approximately 3 kV/cm). Highly charged droplets are formed in a dry bath gas, at near atmospheric pressure. These charged droplets shrink as neutral solvent evaporates until the charge repulsion overcomes the cohesive droplet forces leading to a "Coulombic explosion." In the popular model by Iribarne and Thomson 1'2 the smaller droplets continue to evaporate and the process repeats until the droplet surface curvature is sufficiently high to permit the field-assisted evaporation of charged solutes. 1 j. V. Irib arn e and B. A. T h o m s o n , J. Chem. Phys. 64(6), 2287 (1976). 2 B. A. T h o m s o n an d J. V. Iribarne, J. Chem. Phys. 71, 4451 (1979).

METHODS IN ENZYMOLOGY, VOL. 193

Copyright © 1990by AcademicPress, Inc. All rights of reproduction in any form reserved.

[22]

ELECTROSPRAY IONIZATION MASS SPECTROMETRY

413

Details of this mechanism await full experimental verification. However, it is clear that molecular ions (with an unknown initial extent of solvation) are produced from liquid solution under mild conditions by ESI. These ions generally arise by attachment of proton, alkali cation, or ammonium ions for positive ion formation or, with reversal of the nebulizing field, by proton or other cation abstraction for negative ion formation. ESI was originally described by Dole et al. 3 in studies of the intact ions from synthetic and natural polymers of molecular mass in excess of 100,000 Da based on gaseous ion mobility measurements. In the present context it is impressive to note that these workers, employing the so-called "plasma chromatograph," with detection by Faraday-cage current, tentatively (and correctly) interpreted experiments on lysozyme as demonstrating a multiple charging phenomenon.4 After a 10-year hiatus, these experiments were extended by Fenn e t a l : at Yale University (New Haven, CT) employing atmospheric pressure sampling of ions and analysis with a quadrupole mass spectrometer, and essentially simultaneously by researchers in the Soviet Union6 using a magnetic sector instrument. This work outlined the fundamental aspects of ESI, demonstrating its utility for the analysis of biomolecules of modest molecular weight and as an interface for the combination of a liquid chromatograph with a mass spectrometer.7 Access to higher molecular weights through the production of molecular ions bearing multiple charges was demonstrated by the American workers for polyethylene glycol oligomers of nominal molecular mass of 17,500 Da bearing a net charge of up to + 23. 8 In an important extension of these experiments, the multiple protonation of basic residues in the ESI mass spectra of oligopeptides and proteins showed the extension in the mass range for the analysis up to 40,000 Da analyzable using a quadrupole 3 M. Dole, L. L. Mack, R. L. Hines, R. C. Mobley, L. D. Ferguson, and M. B. Alice, J. Chem. Phys. 49(5), 2240 (1968); L. L. Mack, P. Kralik, A. Rheude, and M. Dole, J. Chem. Phys. 52(10), 4977 (1970); G. A. Clegg and M. Dole, Biopolymers 10, 821 (1971). 4 M. Dole, H. L. Cox, Jr., and J. Gieniec, in "Advances in Chemistry Series, No. 125" (E. A. Mason, ed.), p. 73. American Chemical Society, Washington, D.C., 1973; J. Gieniec, L. L. Mack, K. Nakamae, C. Gupta, V. Kumar, and M. Dole, Biomed. Mass Spectrom. 11(6), 259 (1984). 5 M. Yamashita and J. B. Fenn, J. Phys. Chem. 88, 4451 (1984); ibid., p. 4671; J. B. Fenn, M. Mann, C. K. Meng, S. F. Wong, and C. M. Whitehouse, Science 246, 64 (1989); ibid., Mass Spectrom. Rev. 9, 37 (1990). 6 M. L. Alexandrov, L. N. Gall, N. V. Krasnov, V. I. Nikolaev, V. A. Pavlenko, and V. A. Shkurov, Dokl. Akad. Nauk S.S.S.R. 277, 379 (1984); ibid., J. Anal. Chem. U.S.S.R. 40(9/1), 1227 (1985-transl. 1986) and references therein. 7 C. M. Whitehouse, R. N. Dreyer, M. Yamashita, and J. B. Fenn, Anal. Chem. 57, 675 (1985). s S. F. Wong, C. K. Meng, and J. B. Fenn, J. Phys. Chem. 92, 546 (1988).

414

PEPTIDES AND PROTEINS

[22]

mass spectrometer of mass/charge limit 1600. 9 These results were rapidly confirmed by work in other laboratories. 1°'11 The utility of this multiplecharging phenomenon has been demonstrated to extend to more than 130,000 Da, 12 employing quadrupole mass analysis of conventional mass/ charge (m/z) range, and to permit the measurement of relative mass in the range of 5 to 40 kDa with precision of better than 0.01%. H-13

Practice of Electrospray Ionization Atmospheric Pressure Electrospray Ionization Source

The ESI "source" may be simply a metal capillary (e.g., stainless steel hypodermic needle). Such an arrangement with a cylindrical counterelectrode is the basis of source arrangements described by Whitehouse et al. 7 A 1-20/zl/min flow of solution, typically water-methanol mixtures, containing the analyte and often other additives, such as acetic acid, is delivered to the capillary terminus from infusion syringes or liquid chromatographic columns. Alternatively, the ESI process can be accompanied by pneumatic nebulization accomplished by a high-velocity annular flow of gas at the liquid exit of the injection capillary and has been termed ionspray. 14 This method has the advantage of accommodating flow rates up to approximately 100 ml/min, making the method particularly attractive for liquid chromatography (eluent stream split) with gradient elution. The principal disadvantage of such an arrangement is the reduction in sensitivity which accompanies the reduction in the charge/mass for the resulting droplets. A modified ESI source developed at our laboratory for combined capillary electrophoresis-MS 15 is shown in Fig. 1. An organic liquid sheath (typically pure methanol or acetonitrile which may be augmented by small proportions of acetic acid or water) flows in the annular space between 9 C. K. Meng, M. Mann, and J. B. Fenn, Z. Phys. D--Atoms, Molecules Clusters 10, 361 (1988); ibid., Proc. 36th ASMS Conf. Mass Spectrtnn. Allied Topics, San Fram'isco, CA p. 771 (1988). 10j. A. Loo, H. R. Udseth, and R. D. Smith, Biomed. Environ. Mass Spectrom. 17, 411 (1988). 11 T. R. Covey, R. F. Bonner, B. I. Shushan, and J. Henion, Rapid Commun. Mass Spectrom. 2(11), 249 (1988). t2 j. A. Loo, H. R. Udseth, and R. D. Smith, Anal. Biochem. 179, 404 (1989). is M. Mann, C. K. Meng, and J. B. Fenn, Anal. Chem. 61, 1702 (1989). 14 A. P. Bruins, T. R. Covey, and J. D. Henion, Anal. Chem. 59, 2642 (1987). 15 R. D. Smith, J. A. Olivares, N. T. Nguyen, and H. R. Udseth, Anal. Chem. 59, 436 (1988); R. D. Smith, C. J. Barinaga, and H. R. Udseth, Anal. Chem. 60, 1948 (1988).

[22]

ELECTROSPRAY IONIZATION MASS SPECTROMETRY

415

Electrospray Liquid Sheath Electrode

Fused-Silica Stainless Steel Capillary

air

HV

Capillary

Mleroliter Sample Syringe I

_

i

I

Milliliter Sheath Liquid Syringe .

Bubble air 6--

y

~

lubble Trap

Restrictor

Capillary

l

FIG. 1. Schematic of the sheath flow interface for ESI mass spectrometry showing the conventional arrangement for direct infusion of analyte solutions.

100/zm id fused-silica capillary and a cylindrical stainless steel electrode (500/zm id) which delivers analyte solution to the ion source. An electrospray voltage of 4-6 kV is applied to this surrounding electrode from which the fused-silica tube protrudes approximately 0.2 mm. For experiments in which sample solution is directly infused to the ESI source, syringe pumps deliver controlled flows of analyte and sheath liquids at rates of 0.5-1 and 2-4/~l/min, respectively. The best ESI performance requires a matching of solution conductivity and flow rate as discussed below. Stability of the ESI source depends critically on the stability of these flows. For analyte flows in our laboratory, microliter syringes (50--250/zl gas-tight, Hamilton Co., Reno, NV) installed in a syringe infusion pump (Pump 22, Harvard

416

PEPTIDES A N D PROTEINS

[22]

Apparatus, Cambridge, MA) delivered through 30-70 cm lengths of fusedsilica capillary are used. Electrical isolation through this length of fused silica is adequate for electrospray voltages of ---6 kV. Sheath flows from 1.5- to 5-ml disposable (Becton Dickinson and Co., Rutherford, NJ) or glass gas-tight syringes (Hamilton Co., Reno, NV) originate in a syringe pump (Model 341B, Sage Instruments, Cambridge, MA). In the case of this flow, further stabilization is accomplished with a fused-silica flow restrictor (20 cm × 50 /zm) in combination with the compliance of a deliberately introduced bubble in the delivery syringe of approximately 200/zl. Problems which arise from the formation of bubbles in the sheath solvent in the connecting lines are minimized by the inclusion of a trapping volume. Additional stability may be obtained with degassing (by brief sonication) of the organic solvents used in the sheath and avoiding unnecessarily high ambient temperatures. A cooling of the entire assembly has been found advantageous for the combination of capillary electrophoresis with ESI mass spectrometry. Within this general scheme, many satisfactory arrangements for capillary tubing and ESI components are possible. Positively or negatively charged droplets and ions may be produced depending upon the capillary bias. In the negative ion mode, an electron scavenger, such as oxygen, is required to inhibit electrical discharge at the capillary terminus. This is accomplished using an air flow (250 ml/min) through a third 1/8 inch id annular passage in the electrospray ion source. This flow is also used in positive ion operation. Its velocity is much lower than required for nebulization and is observed to minimize the effects of air circulation around the ion source. It should be noted that power supplies for electrospray application should be selected to minimize the hazard to operators from electrical shock. These should be of the radio frequency oscillator design where stored energy is minimized (generally less than 1 joule). Sample solutions of proteins and peptides are typically prepared in 5% (v/v) acetic acid in good-quality (> 17 Mf~/cm) deionized water. Useful analysis may be obtained on oligopeptide and small protein sample concentrations of 1 to 100/zM with better performance obtainable in favorable cases. The use of electric fields in the droplet nebulization (i.e., without a nebulizing gas flow) results in the optimum deposition of charge on the droplet affording the most efficient production of analyte ions. However, this leads to some practical restrictions on the range of solution conductivity and dielectric constant properties for stable operation at useful flow rates. Solution conductivities of ---10-5 mI~, corresponding to an aqueous electrolyte solution of -5 x 10 -5 torr for a quadrupole mass filter). The oldest and simplest method (available as a commercial instrument from Sciex, Thornhill, Ontario, Canada) utilizes a single laser-drilled pinhole orifice (I00 to 130/.~m) entering directly into the high-vacuum region of the mass spectrometer and cryopumping capable of very high pumping speeds. In this arrangement (relevant voltages as indicated in parentheses), positive ions produced at atmospheric pressure in an electrospray ion source ( - 4 kV) drift toward the plate on which the pinhole sampling aperture (35 V) is mounted. This is against a countercurrent flow of dry gas directed through an axial plenum (650 V). This curtain of dry nitrogen serves to exclude large droplets and particles and to dry the droplets and decluster the ions. As the ions pass through the orifice into the vacuum, further declustering is accomplished by acceleration of the ions into the first radio frequency (rf)-only focusing quadrupole (30 V) of a tandem quadrupole mass spectrometer. Alternatively, instruments may be based on differentially pumped vacuum technology. Such a system which employs a capillary inlet-skimmer 16j. A. Loo, H. R. Udseth, and R. D. Smith, Rapid Commun. Mass Spectrom. 2(10), 207 (1988).

418

PEPTIDES AND PROTEINS

[22]

inlet system has been described by Fenn and co-workers. 5 In this arrangement the electrospray needle, maintained at a few kilovolts with respect to the surrounding cylindrical electrode, affords the electrospray plume which encounters a countercurrent flow of bath gas (typically nitrogen at slightly above atmospheric pressure, 450-75 °, 100 ml/sec) which sweeps away uncharged material and solvent vapor from the mass spectrometer inlet. As droplets drift toward the end wall, ions are formed and some are entrained in the flow of gas entering the glass capillary at the end of this chamber, emerging as a free jet expansion in the first stage of differential pumping. Ions are then transmitted through a skimmer into the inlet optics of a (quadrupole) mass analyzer. The electrically insulating nature of the connecting capillary is an advantage in providing a flexible choice of operating voltages in the system. For example, in contrast to the conventional experiment employing fused-silica capillary tubing to deliver sample to the electrospray ion source at high potential, this approach allows the outlet of a liquid chromatographic apparatus in an LC/ESI-MS experiment to be at ground potential. In that case, the electrode and cylinder end plate may be floated at high voltage and hydrodynamic flow through the glass capillary serves to efficiently deliver ions to the skimmer region. Ion mobilities at atmospheric pressure are sufficiently low that the viscous drag may be sufficient to deliver ions from (or back to) ground potential across gradients of as much as 15 kV, allowing vOltages appropriate for injection of ions into a magnetic sector instrument.17 Typical voltages for use with a quadrupole instrument are indicated in parentheses: electrospray needle (ground), cylindrical electrode (13.5 kV), capillary entrance ( - 4.5 kV), capillary exit (40 V), skimmer ( - 20 V), and quadrupole entrance (ground). The two ESI-MS instruments developed at our laboratory utilize a stage of differential (mechanical) pumping, as well as cryopumping, to increase the ion current sampled from atmospheric pressure. One of these is a modified TAGA 6000E (Sciex, Thornhill, Ontario, Canada). As with other electrospray interface arrangements, a countercurrent flow of nitrogen gas (200-70 °) at a rate of 4-6 liter/min, passing through a plenum between the ESI source and the nozzle, aids the desolvation process of the electrospray-produced charged droplets, prevents solvent introduction to the vacuum system, and minimizes clustering during expansion into the mass spectrometer. The exit of this plenum (5 mm id) held at 650 V (with ESI source at 4 kV for positive ion production) defines the first focusing 17C. M. Whitehouse, M. Yamashita, C. K. Meng, and J. B. Fenn, in "Proceedings of the 14th International Symposium on Rarefied Gas Dynamics" (H. Oguchi, ed.), p. 857. Univ. of Tokyo Press, Tokyo, 1985.

[22]

ELECTROSPRAY IONIZATION MASS SPECTROMETRY

419

aperture of the ion optical system. The ESI source is mounted 1-2 cm from the entrance of the quadrupole mass spectrometer. Ions are sampled from atmospheric pressure through a 1-mm nozzle orifice to a 2-mm diameter beam skimmer (Beam Dynamics, Inc., Minneapolis, MN) in front of a if-only quadrupole. Nozzle voltages (In) range between 100 and 400 V for positive ion studies, while the skimmer is held at 70 V and the offset of the rf-only entrance quadrupole is maintained at 60 V. The nozzle-skimmer region is pumped using a 50 liter/sec single-stage Roots blower maintaining this region at 1 to 10 torr. The cryopumped tandem quadrupole chamber typically reaches 5 x 10-5 torr in normal operation. The ability to "collisionally heat" ions by the application of electric fields in the differentially pumped regions is useful for both desolvation and, at higher voltages, collisional activation and collision-induced dissociation (CID) of analyte ions, as discussed in the final section of this chapter. The operation of the ESI source in combination with the atmosphere-vacuum interface (of whatever design) requires the empirical adjustment of a number of parameters according to the details of the particular apparatus, the species being analyzed, and the object of the experiment. For example, if the counter flow of desolvating gas is too high, analyte ions may be swept away from the entrance of the interface with an unacceptable decrease in sensitivity. Conversely, if this flow is too low analyte solvation may be excessive, with broadened peaks and decreased signal. Similarly, the selection of voltages on the nozzle and skimmer elements vary the collision energy in this high-pressure region and affect the extent of analyte solvation observed and also ion focusing. A certain amount of optimization by trial and error is advisable for these and other important parameters.

Electrospray Ionization--Mass Spectrometry Operation in Positive Ion Mode

For peptides such as bradykinin and glucagon shown in Fig. 2, only singly or multiply protonated, and in a few cases multiply sodiated ions (depending on solution buffer) are observed in ESI, with a general absence of fragment ions. 12,~8,19 The number of possible protonation sites is the principal factor affecting the multiple charging observed in ESI mass spectra. As the analyte oligopeptide increases in relative molecular mass (Mr) the typical bell-shaped distribution of multiply charged molecular is j. A. Loo, H. R. Udseth, and R. D. Smith, Rapid Commun. Mass Spectrom. 2, 207 (1988). t9 C. J. Barinaga, C. G. Edmonds, H. R. Udseth, and R. D. Smith, Rapid Commun. Mass Spectrom. 3, 160 (1989).

420

PEPTIDES AND PROTEINS

[22:]

100, (M+2H)2+

Bradykinin (Mr 1060) Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg .m

¢¢.,

x135 F

Q)

'~

t (M+H)+

(M+3H)3+

0 .~P~..,,~.~...... I,q,,.,.:,~.,

2O0

600

400

800

1000

1200

m/z

100 (M+4H) 4+

Glucagon (Mr 3483)

872

HIs-Ser-GIn-Gty-Thr-Phe-Thr-SerAsp-Thr-Ser-Lys-Tyr-Leu-Asp-SerArg.Arg-Ala-GIn-Asp-Pho-VaI-GInTrp-Leu-Met-Asn-Thr

.m ¢} e-

>

.m

(M+5H)S* 698

o 400

, 600

(M+3H)3* 1162

c.... !.

L.., 800

1000

f

I. I

1200

m/z

FIG. 2. ESI mass spectra of bradyldnin (upper) and glucagon (lower). The additional ion at m/z 996 is attributed to a contaminating oligopeptide.

[22]

ELECTROSPRAY IONIZATION MASS SPECTROMETRY

421

ions appears with the multiple charging having the effect of extending the mass range of the mass spectrometer by a factor equal to the number of charges. For most of the compounds so far examined (prepared in aqueous solution, pH Pl) that i s j peaks away from pl (e.g.,j = 1 for two adjacent peaks) is given by P2(Zl - J3 = Mr + 1.0079(zl - J)

(2)

Equations (1) and (2) can be solved for the charge of pl: Zl = J(P2 -

1.0079)/(p2 - Pl)

(3)

The molecular weight is obtained by taking z~ as the nearest integer value, and thus the charge of each peak in the multiple charge distribution. This approach can easily be generalized to determine the mass of the charged adduct species M a (e.g., H + , Na +, K+). Pl = (Mr~z1) + Ma

(4)

Calculation of Mr for each of the observed m/z values provides enhanced precision. Thus for the data shown in Fig. 3, a standard deviation of -+ 1.7 Da is observed for 12 m/z measurements from one spectrum. In this example, the error in the determination, i.e., [ ( M r the°retical - Mrmeasured)/ Mrthe°r~tic~a] X 100, is 0.007%. Molecular weights have now been demonstrated to be measurable to better than 0.005% with quadrupole mass spectrometers. Typical results are summarized in Table I. Such measurements are generally two to three orders of magnitude more accurate than obtainable using electrophoretic methods, and perhaps an order of magnitude better than time-of-flight (TOF)-based laser desorption or plasma desorption methods. Operation in Negative Ion M o d e

Preliminary experiments have demonstrated the successful application of ESI mass spectrometry to oligonucleotides, t1,2° The negative ion ESI mass spectra of small oligodeoxyribonucleotides are characterized by multiply charged molecular anions of the form (M - nil) n- . Small oligonucleotides (n = 3-8) afford molecular ions at near the maximum possible charge state (ionization of the internal phosphodiester and/or terminal phosphate moieties). As the Mr of larger oligomers increases, the extent of such multiple charging compensates, which maintains the m/z of members of the distribution of molecular anions in the range of our quadrupole mass analyzer. In addition, with the increase in level of polymerization and with decreasing charge state for a given molecular anion, we observe an increased contribution of species arising from the substitution of sodium 2o C. G. Edmonds, C. J. Barinaga, J. A. Loo, H. R. Udseth, and R. D. Smith, Proc. 37th ASMS Conf. Mass Spectrom. Allied Topics, Miami Beach, FL p. 844 (1989).

424

PEPTIDESAND PROTEINS

[22]

TABLE I CALCULATED AND MEASURED RELATIVE MOLECULARMASSES BY ELECTROSPRAY IONIZATION---QUADRUPOLEMASS SPECTROMETRY FOR A REPRESENTATIVEGROUP OF OLIGOPEPTIDE AND SMALL PROTEIN STANDARDS

Relative molecular mass (Mr) Sample LHRH (luteinizing hormone

releasing hormone Bovine insulin Porcine insulin Porcine lactobinoylinsulin Porcine dilactobinoylinsulin Equine heart cytochrome c Bovine ribonuclease A Bovine ~x-lactalbumin Carboxymethylated bovine a-lactalbumin Chicken egg white lysozyme Human lysozyme Soybean trypsin inhibitor Bovine trypsin Bovine chymotrypsin Bovine carbonate dehydratase

Mass measurement error (%)

Calculated

Measured

1182.3

1182.0

- 0.02

5733.6 5777.6 6232.8 6688.0 12,360.1 13,682.2 14,175.0 14,647.4

5733.9 5776.5 6234.5 6688.4 12,358.7 13,681.3 14,173.3 14,645.9

+0.01 - 0.02 + 0.03 + 0.01 -0.01 -0.01 - 0.01 - 0.01

14,306.2 14,692.8 20,090.6 23,290.2 25,233.5 29,024.6

14,304.6 14,695.2 20,097.6 23,291.9 25,226.6 29,021.6

-0.01 + 0.02 + 0.03 +0.01 - 0.03 -0.01

for the proton on the un-ionized phosphates. This substitution of Na for H among the increasing number of possible phosphate moieties (which accompanies increasing polymerization level and/or decreasing charge state) reduces the measurable current for any given ion and thus the sensitivity of the analysis. Where resolution permits, the separation of the members of these suites of molecular anions appear as shown in Fig. 4 for a synthetic deoxyribonucleotide 21-mer. In these circumstances the Mr of the parent molecule may be determined with the same precision and accuracy as observed for proteins under positive ionization conditions. For larger synthetic deoxyribonucleotides, we observe multiply charged molecular anions with broadened peaks apparently due to this alkali attachment. Measurement of Mr of oligonucleotides is significantly affected by alkali metal association when resolution is insufficient for distinction among the sodium-associated peaks. In such cases, determinations based on the maximum or centroid of a broadened, sodium-associated peak will tend to overestimate the M r . With our present experimental regime for synthetic oligodeoxyribonucleotides n = 20-60 we have observed an

[22]

E L E C T R O S P R A Y I O N I Z A T I O N MASS S P E C T R O M E T R Y

425

638 12-

580

10-

10A

712

0

,r-

8

532 o ,m

E

801

4

E

400

500

600

700

800

900

1000

m/z

FIG. 4. Negative ion ESI mass spectrum of the synthetic deoxyribonucleotide21-mer, d(AAATTGTGCACATCCTGCAGC)(Mrc~aculatcd6390.3). Peak multiplicityclue to sodium association is particularly noticeable in the lower charge states of the molecularanion, e.g., ions grouped around at m/z 712 (M - 10H + Na)9-, and m/z 801 (M - IlH + Na)1°-. MrMeasured6390.6, A = + 0.005%.

error of the order of 1% for such measurements. Presently, the largest nucleotides so far successfully ionized are natural small oligoribonucleotide 76-mer tRNAs. Sample solutions of oligonucleotides are prepared in deionized water at concentrations of 1 to 2/zg//.d. Sample delivery to the electrospray ion source optimizes at approximately 0.5/zl/min and the mass spectrometer is scanned with best integration and signal/noise to cover the full mass range in 2.2 min. Thus, a typical experiment might consume 1/~g (i.e., 3 nmol or 0.3 OD260 for a deoxyoligonucleotide 10-mer), although much smaller sample sizes are accommodated. The spectrum shown in Fig. 4 is the average of five such consecutively acquired scans. For this direct infusion of microliter volumes, the typical minimum sample must be increased by approximately tenfold to accommodate the volume holdup of connecting fused-silica tubing and the microliter syringe. This excess is

426

PEPTIDES AND PROTEINS

[22]

recoverable at the end of the experiment as the uncontaminated analyte in aqueous solution. Alternatively, a reversible syringe pump may be used to minimize sample consumption by drawing a much smaller volume from a sample container and delivering this to the ion source. Electro-osmotic sampling methods offer prospects for very efficient sample manipulation with minimum sample consumption and loss. Presently, for samples available in the minimum amount of 10 /xg (i.e., 30 nmol or 3 OD260 for a deoxyoligonucleotide 10-mer), this arrangement permits practical analysis of oligonucleotide samples with sensitivities of a factor 3-5 superior to those typically required for FAB and PD experiments. However, with these techniques the unconsumed portion of the analyte may also be recovered (with some difficulty) from FAB matrix or the PD Mylar foil sample stage.

Tandem Mass Spectrometry of Doubly Charged Tryptic Fragments The major characteristic of ESI mass spectra for oligopeptides is the predominance of multiply charged molecular ions and the lack of fragmentation. While this allows accurate molecular weight determinations, little information regarding molecular structure is obtained. This characteristic is shared by the other desorption ionization techniques and extensive MS/MS studies of peptides have been reported; their scope and utility are highlighted elsewhere in this volume. However, to date tandem mass spectrometry of singly charged ions generated by these methods has not been fruitful beyond about m/z 3000 due, in part, to the decreased primary ion signal as molecular weight increases and the decreasing efficiency for CID with increasing Mr.21'22 Large multiply charged oligopeptide and protein ions can be efficiently dissociated by collision with a neutral gas, 16'19'23'24 but interpretation presents special difficulties due to the fact that mass spectrometry does not directly provide information on charge state. This complication is largely avoided for doubly charged ions. In the case of the majority of tryptic peptides, the two charges are expected to reside on opposite ends of the molecule, at the N terminus and on the arginine or lysine residues at the C terminus. The obvious exception is the fragment containing the C terminus of the original molecule which is protonated only at the N terminus. Additional variations occur when a 2t M. L. Gross, K. B. Tomer, R. L. Cerny, and D. E. Giblin, in "Mass Spectrometry in the Analysis of Large Molecules" (C. J. McNeal, ed.), p. 171. Wiley, New York, 1986. 22 G. M. Neumann and P. J. Derrick, Org. Mass Spectrom. 19, 165 (1984). 23 R. D. Smith, C. J. Barinaga, and H. R. Udseth, J. Phys. Chem. 93, 5019 (1989). u R. D. Smith, J. A. Loo, C. J. Barinaga, C. G. Edmonds, and H. R. Udseth, J. Am. Soc. Mass Spectrom. 1, 53 (1990).

[22]

427

ELECTROSPRAY IONIZATION MASS SPECTROMETRY

2 pmol

IQQ- M S / M S of [ M + 2 H ] 2 + 30 ev 0.7 mtorr Ar

1 pmol/pl

520

2 pl/mln

B0O

Phe-Ser-Trp-Oly-Ala-Glu-Gly-Glu-Arg

m "O C "-z 6 0 -

y

>

891 804 618 581 490 361

A

120 207 393

B

235 421

2+

~4gm

Z

~

A3

Ye

Y7 va-.2o

2~ A2,B2 I

AI

Y

400

600

80~

10~Q

m/z FIG. 5. Product ion spectrum for the doubly protonated molecular ion (m/z 520) for the small peptide Phe-Ser-Trp-Gly-Ala-Glu-Gly-Glu-Arg (M r 1037.5). (Reproduced from Ref. 25 with permission of the author and publisher.)

h/st/dine residue is present which has the effect of increasing the charge state of the molecule by one. In the CID of such doubly charged molecules, primarily singly charged product ions result. This typical result is illustrated in Fig. 5 for the small peptide Phe-Ser-Trp-Gly-Ala-Glu-Gly-GluArg (Mr 1037.5). 25 In related studies, nearly complete sequence information was obtained from the MS/MS analysis of a doubly charged tryptic peptide (Mr 2315) of the protein, a-casein, generated by FAB 26 with a triple quadrupole mass spectrometer and ionspray LC/MS/MS experiments have been performed from doubly charged tryptic fragments of large proteins. 27'28 I. Jardine, in "Current Research in Protein Chemistry" (J. Villafranca, ed.). Academic Press, San Diego, CA, in press. D. F. Hunt, N.-Z. Zhu, and J. Shabanowitz, Rapid Commun. Mass Spectrom. 3, 122 (1989). 27 E. D. Lee, J. D. Hen/on, and T. R. Covey, J. Microcolumn Sep. 1, 14 (1989). 28 A. Treston, P. Kasprzyk, F. Cuttitta, T. Covey, and J. Mulshine, Proc. 37th ASMS Conf. Mass Spectrom. Allied Topics, Miami Beach, FL p. 889 (1989).

428

PEPTIDES AND PROTEINS

[22]

Developing Techniques

High-Precision Mr Determination at High Mass Up to the present, ESI has been widely applied only with quadrupole mass analysis, although workers have demonstrated the method with magnetic sector 6,29and Fourier transform ion cyclotron resonance instruments (FT-ICR). 3° It is reasonable to project improvements in the precision of measurement of Mr using ESI: quadrupole mass spectrometers under favorable conditions are capable of mass precision measurements of -0.0006%, 31 and conventional double-focusing mass spectrometers or FT mass spectrometers routinely achieve 1 ppm (0.0001%) precision.

Qualitative Investigations of Larger Oligopeptides and Proteins by the Collision-Induced Dissociation (CID) of Multiply Charged Molecular Ions It is our original observation that the voltage applied between the nozzle and skimmer (nozzle-skimmer voltage bias, Vn) in the atmosphere-vacuum interface to the mass spectrometer greatly influences the maximum number of charges observed for a particular molecule. For large molecules, the more highly charged ions are more susceptible to dissociation. This observation, together with its converse, i.e., that the more highly charged species (at lower m/z) are favored at lower Vn (less energetic collisions), is consistent with a CID process. It is generally observed that as parent ion m/z values increase, the efficiency of CID processes decreases. Since collision energy is proportional to the number of charges at a given m/z (i.e., Err = qV), it is reasonable to assume that the greater translational energies for ions with a greater number of charges is the primary reason for this increased CID efficiency. In addition, it is clear that significant collisional heating of the molecular ion may occur in the nozzle-skimmer region of the atmosphere-vacuum interface. We have demonstrated the production of sequence-specific fragment ions from the multiply charged molecular ions of oligopeptides larger than might be efficiently dissociated as singly charged species 19and that unique multiply charged product ions are observed in such experiments on proteins. 23'24 Experiments by CID on the (M + 3H) 3+ to (M + 6H) 6÷ molecular ions of melittin (M r 2845) from ESI yields multiply charged daughter 29 C. K. Meng, B. S. Larsen, C. N. McEwen, C. M. Whitehouse, and J. B. Fenn, Proc. 2nd Int. Symp. Mass Spectrom. Health Life Sci., San Francisco, August (1989). 30 K. D. Henry, E. R. Williams, B. H. Wang, F. W. McLafferty, J. Shabanowitz, and D. F. Hunt, Proc. Natl. Acad. Sci. U.S.A. 86, 9075 (1989). 3t j. Roboz, J. F. Holland, M. A. McDowall, and M. J. Hillmer, J. Rapid Commun. Mass Spectrom. 2, 64 (1988).

[22]

E L E C T R O S P R AIONIZATION Y MASS SPECTROMETRY

429

ions (to 4 +) that can be readily ascribed to the known sequence of the polypeptide. ~9 Dramatic differences among the spectra of the various charge states and the large number of fragment ions in various charge were observed. Although CID of multiply charged ions from larger peptides yield product ions that can be readily correlated to the sequence, complete sequence assignments are generally lacking. Studies to date indicate that a progressively smaller portion of the molecule is susceptible to CID with increasing analyte size. For example, human parathyroid hormone (1-44, Mr 5064) yields multiply charged molecular ions from 4 + to 9 +. Collisional analysis of these parent ions, producing primarily singly charged b and y sequence ions (see end of this volume, Appendix 5) from both C and N termini, affords sequence information for approximately one-third of the molecule. For still larger protein molecules [e.g., bovine pancreatic ribonuclease A (Mr 13,682), composed of 124 amino acids and 4 disulfide bridges], only small portions of the molecule are directly probed by CID using the present quadrupole instrumentation. Nonetheless, this CID can be efficient for such multiply charged species and product ion spectra may be interpreted on the basis of known sequence and modes of fragmentation. 32 In addition, differences in the product ion spectra of the same charge state for the native and reduced forms of cystinyl-bridged proteins suggest that higher-order (secondary and tertiary) structure of these ions in the gas phase may influence the activation and dissociation processes. 32 The use of such differences to probe higher-order protein structure is an important possibility. In proteins where fragmentation is particularly diverse and abundant, but not necessarily fully interpretable, CID spectra may provide a qualitatively unique "fingerprinting." The CID mass spectra for the (M + 15H) ~5+ molecular ion of cytochrome c proteins from nine different species (cow, chicken, dog, horse, pigeon, rabbit, rat, tuna, yeast) with a moderate Mr range have been obtained and compared. 24 Strong differences in the spectra are observed, even between species differing by as little as 4 amino acid residues (of over I00). Although presently requiring 10-100 pmol of material, such results suggest the possibility of applying CID mass spectral patterns for rapid characterization of unknown proteins or for comparison among related molecular species (e.g., mutations and posttranslational modifications). While conventional CID is normally performed in the collision quadrupole chamber (if-only quadrupole, Q2), collisional processes in the differentially pumped atmosphere-vacuum interface can also occur prior to mass analysis. Collisional product ions thus become available for MS/MS analysis (i.e., CID/MS/CID/MS) permitting the confirmation of their structure or the probing of regions not 32 j. A. Loo, C. G. Edmonds, and R. D. Smith, Science 248, 201 (1990).

430

PEPTIDES AND PROTEINS

[22]

susceptible to fragmentation in initial CID. Confirmation of the product assignments can be obtained by further dissociation of the fragment ions formed using the ESI interface. 24 The possibilities of MS/MS of multiply charged ions have only begun to be exploited. New instrumentation and methods addressing, among other challenges, the assignment of charge state or mass of multiply charged product ions will be essential. Higher-energy CID or alternative activation methods, such as photo- and surface-induced dissociation or sequential "tandem" MS methods ( M S n, with n -> 3) should generate more sequence information from larger species.

Interface with Capillary Separation Schemes Liquid chromatography is a mainstay of biochemical analysis. As already mentioned, the now commonplace method of "microbore" (1-2 mm id columns with flow rates of 10 to 100/.d/min) liquid chromatography is particularly well adapted to ESI practiced with pneumatic-assisted nebulization, i.e., ionspray. The examination of tryptic digests of proteins is a straightforward application of ESI methods with facile and immediate prospects. The practice of liquid chromatography in very narrow-bore columns and capillary tubes (id - 250/zm and flow rates of 0.1 to 1/zl/ min) is a more demanding variation which a few laboratories have pursued. Capillary electrophoresis (CE) in its various manifestations (free solution, isotachophoresis, isoelectric focusing, polyacrylamide gel, micellar electrokinetic "chromatography") is attacting attention as a method for rapid high-resolution separations of very small sample volumes of complex mixtures. Combination with the inherent sensitivity and selectivity of mass spectrometry, makes CE-MS a potentially powerful bioanalytical technique. The correspondence between capillary zone electrophoresis (CZE) and ESI flow rates and the fact that both are primarily used for ionic species in solution provide the basis for facile combination. Small peptides are easily amenable to CZE/ESI-MS analysis with good reproducibility. For example, high-efficiency separations of biologically active peptides, [e.g., dynorphin and enkephalin peptides with over 250,000 theoretical plate s, 33and oftryptic digests (as discussed above)] have been demonstrated. High-efficiency CZE with detection by ESI-MS at the picomole level has been demonstrated. 34 Capillary isotachophoresis (CITP) based on ESI-MS has been de-

33 E. D. Lee, W. MOck, J. D. Henion, and T. R. Covey, J. Chromatogr. 458, 313 (1988). 34 j. A. Loo, H. K. Jones, H. R. Udseth, and R. D. Smith, J. Microcolumn Sep. 1, 223 (1989).

[22]

ELECTROSPRAY IONIZATION MASS SPECTROMETRY

431

scribed. 35,36CITP is an attractive complement to CZE, and is ideally suited for combination with mass spectrometry. CITP is well suited to low-concentration samples where the amount of solution is relatively large, whereas CZE is ideal for the analysis of minute quantities of solution. Sample sizes which can be addressed by CITP are much greater (> 100-fold) than CZE. CITP results in concentration of analyte bands, which is in contrast to the inherent dilution with CZE. Electromigration injection allows effective sample volumes to be much larger still due to enrichment during migration into the capillary from low ionic strength samples .36Detection limits of approximately 10-11 M have been demonstrated for quaternary phosphonium salts and substantial improvements appear feasible. 36 Analytes elute in CITP as bands where the length of the analyte band provides information regarding concentration. Most important, however, is that CITP provides a relative pure analyte band to the ESI sour,ce, without the large concentration of a supporting electrolyte demanded by CZE. This latter characteristic circumvents the principal research challenge in the development of CZE/ESIMS, the disadvantageous effect of constituents of the supporting electrolyte on ESI. Thus, CITP/MS has the potentialofallowing much greater sensitivities (and analyte ion currents) than feasible with CZE/MS due to more efficient analyte ionization. The relatively wide and concentrated separated bands in CITP facilitate MS/MS experiments (which often require more concentrated samples than provided by CZE). These characteristics make CITP/MS/MS potentially well suited for characterization of enzymatic digests ofproteins.37'3s Significant research effort in all areas of the separation of biopolymers and their constituents by capillary electrophoresis in all its several modes is required to capitalize on the potential which their combination with ESI mass spectrometry embodies. Acknowledgment The authors are pleased to acknowledge the important contributions of our colleagues Drs. J. A. Loo, C. J. Barinaga, and H. R. Udseth, and the kind donation of oligonucleotide samples by Dr. T. Keough, Proctor and Gamble, Inc., Cincinnati, OH. This work was supported by the U.S. Department of Energy (Contract DE-AC06-76RLO 1830), the National Institute of General Medical Sciences (GM 42940), and the National Science Foundation (DIR 8908096). Pacific Northwest Laboratory is operated by Battelle Memorial Institute. 35 R. D. Smith, J. A. Loo, C. J. Barinaga, C. G. Edmonds, and H. R. Udseth, J. Chromatogr. 4811, 211 (1989). 36 H. R. Udseth, J. A. Loo, and R. D. Smith, Anal. Chem. 61, 228 (1989). 37 C. G. Edmonds, J. A. Loo, S. M. Fields, C. J. Barinaga, H. R. Udseth, and R. D. Smith, in "Biological Mass Spectrometry" (A. L. Burlingame and J. A. McCloskey, eds.). Elsevier, Amsterdam, in press. 38 R. D. Smith, S. M. Fields, J. A. Loo, C. J. Barinaga, and H. R. Udseth, Electrophoresis, in press.