Journal of Neuroscience Research 92:893–903 (2014)

Electrically Induced Brain-Derived Neurotrophic Factor Release From Schwann Cells Beier Luo,1 Jinghui Huang,2 Lei Lu,3 Xueyu Hu,2 Zhuojing Luo,2* and Ming Li1 1

Institute of Orthopaedics, Changhai Hospital, The Second Military Medical University, Shanghai, China Institute of Orthopaedics, Xijing Hospital, The Fourth Military Medical University, Xi’an, China Department of Oral Anatomy and Physiology, School of Stomatology, The Fourth Military Medical University, Xi’an, China

2 3

Regulating the production of brain-derived neurotrophic factor (BDNF) in Schwann cells (SCs) is critical for their application in traumatic nerve injury, neurodegenerative disorders, and demyelination disease in both central and peripheral nervous systems. The present study investigated the possibility of using electrical stimulation (ES) to activate SCs to release BDNF. We found that short-term ES was capable of promoting BDNF production from SCs, and the maximal BDNF release was achieved by ES at 6 V (3 Hz, 30 min). We further examined the involvement of intracellular calcium ions ([Ca21]i) in the ESinduced BDNF production in SCs by pharmacological studies. We found that the ES-induced BDNF release required calcium influx through T-type voltage-gated calcium channel (VGCC) and calcium mobilization from internal calcium stores, including inositol triphosphatesensitive stores and caffeine/ryanodine-sensitive stores. In addition, calcium-calmodulin dependent protein kinase IV (CaMK IV), mitogen-activated protein kinase (MAPK), and cAMP response element-binding protein (CREB) were found to play important roles in the ES-induced BDNF release from SCs. In conclusion, ES is capable of activating SCs to secrete BDNF, which requires the involvement of calcium influx through T-type VGCC and calcium mobilization from internal calcium stores. In addition, activation of CaMK IV, MAPK, and CREB were also involved in the ES-induced BDNF release. The findings indicate that ES can improve the neurotrophic ability in SCs and raise the possibility of developing electrically stimulated SCs as a source of cell therapy for nerve injury in both peripheral and central nervous systems. VC 2014 Wiley Periodicals, Inc.

phic factors that support axonal outgrowth (Bunge, 1994). Many previous studies have shown that SCs can facilitate axonal regeneration and elicit remyelination after nerve injuries in both the central nervous system (CNS) and the PNS (Ghosh et al., 2012; Kobayashi et al., 2012). SCs transplanted into the injured adult mammalian CNS (including the optic, septohippocampus systems, and spinal cord) survive, promote axonal regeneration, and ensheathe or myelinate the regenerated axons to reestablish the impaired motor function (Montero-Menei et al., 1992; Oudega and Xu, 2006; Fang et al., 2010; Ghosh et al., 2012). Therefore, SCs have been deemed as a potential source of cell therapy for traumatic injury, neurodegenerative disorders, and demyelination disease in both CNS and PNS. Neurotrophic factors, in particular, brain-derived neurotrophic factor (BDNF), play an essential role in promoting axonal regeneration and remyelination when SCs were transplanted into nerve injury lesions (Bamber et al., 2001; Tep et al., 2012). It has been widely reported that BDNF can support the survival of sensory neurons, retinal ganglion cells, and basal forebrain cholinergic neurons as well as regulate synaptic activity of developing neuromuscular synapses (Kwon and Gurney, 1996; Ward and Hagg, 2000; Parrilla-Reverter et al., 2009; Geremia et al.,

Key words: electrical stimulation; brain-derived neurotrophic factor; calcium; calcium-calmodulin dependent protein kinase; mitogen-activated protein kinase

B. Luo, J. Huang, and L. Lu contributed equally to this work.

Schwann cells (SCs) are glial cells in peripheral nervous system (PNS). They are known to play an obligatory role in nerve regeneration by providing bioactive substrates on which axons migrate and by releasing neurotro-

Received 3 July 2013; Revised 18 December 2013; Accepted 27 December 2013

C 2014 Wiley Periodicals, Inc. V

Contract grant sponsor: National Natural Science Foundation of China; Contract grant numbers: 81201389; 30973052; 30872870; Contract grant sponsor: National Basic Research Program of China (973 Program); Contract grant number: 2014CB542206; Contract grant sponsor: Program for Changjiang Scholar and Innovative Research Team in University; Contract grant number: IRT1053.

*Correspondence to: Zhuojing Luo, Institute of Orthopaedics, Xijing Hospital, The Fourth Military Medical University, Xi’an 710032, China. E-mail: [email protected]

Published online 19 February 2014 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/jnr.23365

894

Luo et al.

2010; Wang et al., 2011). In addition, recent work has shown that BDNF is a crucial factor for SCs polarization and initiation of myelination (Tep et al., 2012). All these findings indicate that regulation of BDNF expression and secretion is important for SCs to facilitate axonal regeneration and remyelination. However, it has been recognized that the ability of SCs cultured in vitro to synthesize BDNF is at a relatively low level, which significantly limits the application of SCs in the repair of nerve injuries in both CNS and PNS. Therefore, upregulation of BDNF production in SCs might lead to new avenues for the application of SCs in traumatic injuries and demyelinating lesions in nervous system. Electrical stimulation (ES) has long been utilized to modulate cellular functions such as cell migration (Zhao et al., 2012), cell proliferation (Huang et al., 2010a; Qi et al., 2013), and DNA synthesis (Ozawa et al., 1989). Most recently, ES has been shown to enhance protein synthesis and secretion in many cell types. Thus far, secretion of interleukin-6 and interleukin-8 from fibroblasts (Shi et al., 2008), BDNF from hippocampus neurons (Balkowiec and Katz, 2002), and type II collagen from chondrocytes (Brighton et al., 2008) have been found to be significantly enhanced by ES. In addition, an electric field as small as 3 mV/mm can induce robust directional responses in SCs, indicating that SCs have a high sensitivity to electric fields (McKasson et al., 2008). In our previous study, ES has been shown to be able to promote nerve growth factor (NGF) secretion through calciumdependent mechanisms (Huang et al., 2010b). All these findings highlight the possibility of using ES to modulate BDNF secretion in SCs, which has not been investigated thus far. Therefore, the present study was designed to investigate the possibility of activating SCs to release BDNF by using ES. We found that proper ES is capable of promoting BDNF release from SCs, which requires the involvement of intracellular calcium, calcium/calmodulin-dependent protein kinase IV (CaMK IV), mitogen-activated protein kinase (MAPK), and cAMP response element-binding protein (CREB). MATERIALS AND METHODS SC Cultures The preparation and purification of primary SCs cultures followed the protocol reported previously (Huang et al., 2010b). Briefly, sciatic nerves and brachial plexus were harvested from neonatal 2-day-old SD rats (provided by Laboratory Animal Center of the Fourth Military Medical University, Xi’an, China). The nerves were digested with a mixture of 0.06% collagenase (Sigma, St. Louis, MO) and 0.25% trypsin (Sigma) at 37 C for 30 min. Suspended SCs were then incubated in Dulbecco’s modified Eagle’s medium (DMEM) into which 15% fetal calf serum (FCS; Gibco, Burlington, Ontario, Canada) and antibiotics (penicillin and streptomycin solution) were added. Twenty-four hours after seeding, the cells were treated with the antimitotic agent cytosine arabinoside (1025 M) for 48 hr to inhibit fibroblast proliferation. Cells were then incubated in DMEM supplemented with 15% FCS, 2

lM/ml forskolin (Sigma), and 20 lg/ml bovine pituitary extract (Biomedical Technologies, Stoughton, MA). After three passages, immunohistochemistry with mouse anti-rat S-100 monoclonal antibody (1:1,000; Chemicon, Temecula, CA), mouse anti-rat P0 (1:500; Sigma-Aldrich), and mouse anti-rat O4 (1:800; Chemicon) was performed to characterize the stage of SCs. Finally, the data showed that the SCs used in the present study were positive only for S-100 and not for P0 and O4, suggesting that the SCs used in the present study were immature SCs. In addition, a purity of more than 95% S-100- positive cells was obtained in the present study (see Fig. 1A–C). Electrical Stimulation of SCs The chamber used to expose SCs to electric fields has been described previously (Huang et al., 2010b). In brief, indium tin oxide (ITO) conductive silica glass (40 X/cm2; Kinoene Kogaku, Japan) was used as the electrically conductive surface for stimulation of SCs. ITO glass slides (35 3 35 mm) were placed in a petri dish (50 mm diameter). A pair of needletype platinum electrodes was fixed tightly to the conductive ITO glass by using a water-tight seal, which secured the platinum electrodes tightly to the glass surface. The electrodes were connected to an electric current generator capable of supplying sinusoidal signals. Both the petri dish and the conductive ITO glass slides were irradiated by UV light for 90 min for sterilization. SCs were then plated at a density of 3 3 104 cells/cm2 on the ITO glass slide in DMEM supplemented with 15% FCS, 100 U/ml penicillin, and 100 lg/ml streptomycin. The cells were grown for 3 days at 37 C to a final cell density of 1 3 105 cells/cm2. Then, SCs on the ITO glass slide were stimulated by sine wave of potentials at various intensities (1–10 V/cm) and frequencies (1–100 Hz) for 30 min. Twenty-four hours after stimulation, NGF secretion was qualified by ELISA. Cell Counting and Viability Assay Six, twelve, and twenty-four hours after ES, SCs were detached from the conductive glass using a 0.05% trypsin solution, washed, and resuspended in DMEM. Then, a drop of the cell suspension was placed on a hemocytometer, the total number of cells was counted, and the concentration of cells per milliliter was calculated and recorded. A Cell Counting Kit-8 (CCK-8; Dojindo, Tokyo, Japan) allows convenient assays by utilizing Dojindo’s highly watersoluble tetrazolium salt. Briefly, 6, 12, and 24 hr after ES, the membranes with cells attached were washed three times with PBS (Sigma-Aldrich), and then SCs were detached from the conductive polymer by using a 0.05% trypsin solution, washed, and resuspended in DMEM. Then, the cell suspension was inoculated (100 ll/well) in a 96-well plate, which had wells containing known numbers of viable cells. The plate was preincubated in a humidified incubator (e.g., at 37 C, 5% CO2), and the CCK-8 solution (10 ll) was then added to each well of the plate. The plate was incubated for another 4 hr in the incubator. The absorbance was measured at 450 nm by using a microplate reader (Multiscan MK3; Thermo Labsystems, Helsinki, Finland). A calibration curve was prepared using Journal of Neuroscience Research

Electricity Promotes BDNF Release From SCs

895

Fig. 1. Immunohistochemistry of primary SCs cultures and optimization of ES parameters for BDNF secretion. A: SCs marked by S-100. B: Nuclei were counterstained with 40 ,60 -diamidino-2-phenylindole dihydrochloride (DAPI; 20 lg/ml in PBS). C: Merge of A and B showing a purity of more than 95% in SCs. D: Qualification of BDNF released by SCs that had been stimulated by ES (3 Hz) at

varied intensities. E: Qualification of BDNF released by SCs stimulated by ES (6 V) at varied frequencies. *P < 0.05, **P < 0.01, oneway ANOVA compared with the control group. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary. com.]

the data obtained from the wells that contained known numbers of viable cells.

plasmid constructs, which encode the full length of CaMK IIa and CaMK IV, were prepared as reported previously (Sun et al., 1996). The following siRNAs (Santa Ctuz Biotechnology, Santa Cruz, CA) were used, CAMK IIa, CAMK IV, and CREB. The siRNA products have been proved to be able to decrease the expression of the target gene to more than 90% in our laboratory. The plasmids or siRNA duplexes were transfected according to the manufacturer’s instruction (Invitrogen, Carlsbad, CA). The transfection components were removed and replaced with complete medium lacking antibiotics.

Reagents N-type voltage-gated calcium channel (VGCC) blocker x-conotoxin GVIA, P/Q-type VGCC blocker x-agatoxin TK, and R-type VGCC blocker SNX-482 were purchased from Peptide Institute Inc. (Osaka, Japan) and used at final concentrations of 1 lM, 1 lM and 0.5 lM, respectively. Nimodipine (Sigma) was dissolved in methyl alcohol and used at final concentrations of 2 lM. U73122, U73433, dantrolene, and thapsigargin (Sigma) were dissolved in dimethyl sulfoxide (DMSO) and used at final concentrations of 25, 25, 50, and 10 lM, respectively. BAPTA-AM, caffeine, and mibefradil were purchase from Sigma, dissolved in PBS, and used at final concentrations of 10, 30, and 2 lM, respectively. Neomycin (Sigma) was dissolved in PBS and used at final concentrations of 2 and 5 mM. The final concentration of DMSO was 0.02%. KN62, U0126, and KT5720 (Sigma) were used at 10, 20, 10 lM, respectively. The wide-type CaMK IIa (the 50 oligonucleotide primer, GTGCCACCATGGCTACCATCACCTGC, the 30 oligonucleotide primer, GAATTCGGGCCCTCAATGGGGCAGGACGGAG) and CaMK IV (the 50 oligonucleotide primer, CGGCGACCATGGTCAAAGTCACGGTGC, the 30 oligonucleotide primer, GGCCTGGGGCCCTAAAGGAAG) Journal of Neuroscience Research

ELISA for BDNF Release Twenty-four hours after ES, the number of SCs was counted, and the culture supernatants were collected to determine the amount of BDNF secreted by the cultured SCs. Cell culture supernatants were centrifuged and assayed by using an ELISA kit, following the manufacturer’s instructions (catalog No. RAB0026; Sigma-Aldrich). In brief, the 96-well ELISA plates were kept for 1 hr at room temperature (37 C) before use. The cell culture supernatants (100 ll) were added to appropriate wells, which were coated with anti-BDNF antibodies. In the meantime, lyophilized recombinant BDNF protein standards provided with the ELISA kit were used to generate the standard curves in the same plate as the culture supernatants. The plate was covered and incubated for 2.5 hr at

896

Luo et al.

room temperature with gentle shaking. After that, the solutions in the wells were discarded and washed four times with 13 washing solution, and biotinylated BDNF detection antibody was applied, followed by subsequent steps according to the protocol of the manufacturer. Absorbance values were then immediately read at 450 nm in a plate reader (Multiscan MK3; Thermo Labsystems). In the present study, the amount of BDNF secreted by SCs was normalized to the cell number in each group. Calcium Imaging The Ca21-sensitive fluorescent dye Fluo-3 acetoxymethylester (Molecular Probes, Eugene, OR) was dissolved in DMSO to make a 1 mM stock solution and then dissolved at a final concentration of 5 lM in Hank’s balanced salt solution (HBSS). Cells were loaded with Fluo-3 for 45 min in the dark at room temperature. Cells were then washed twice with HBSS and examined immediately with a qualitative confocal laser microscope (FV1000; Olympus, Tokyo, Japan). Ca21-free conditions were confirmed by washing and incubating cells in modified HBSS containing 0 mM CaCl2, 2 mM MgCl2, and 1 mM EGTA. Fluorescence images of SCs loaded with Fluo-3 were recorded in real time before and during ES. In brief, 10 cells were identified in a visual field, and changes in fluorescence intensity in each of the cells were monitored simultaneously. Cell boundaries were drawn in the image processor, and fluorescence intensity was integrated over all pixels within the boundary of each individual cell. The fluorescence intensities were normalized to those from a reference image recorded before ES application to minimize the effects of variation in Fluo-3 dye loading, cell size, and cell shape. Intracellular calcium level ([Ca21]i) was estimated from the fluorescence intensity of Fluo-3 by using the equation

½Ca21 i 5Kd ðF2Fmin Þ=ðFmax 2FÞ; where Kd is 400 nM, and Fmax and Fmin are the maximum and minimum fluorescence intensities determined in the present study. The peak intracellular calcium level (p[Ca21]) in each set of experiments was recorded. The estimated [Ca21]i in resting SCs was 42 6 5 nM. Western Blotting Twenty-four hours after ES, SCs were harvested and washed with PBS and lysed with lysis buffer containing protease inhibitors (Promega, Madison, WI). The total protein concentration was determined by BCA assay. Protein extracts were heat denatured at 100 C for 5 min, electrophoretically separated on a 12% SDS-PAGE, and then transferred to a PVDF membrane. The membrane was blocked with 5% nonfat dry milk in TBST buffer (50 mM Tris-HCl, 100 mM NaCl, and 0.1% Tween-20, pH 7.4) and incubated with rabbit anti-rat CREB and p-CREB antibody (1:800; Chemicon) in 5% nonfat dry milk in TBST buffer at 4 C overnight. The membranes were washed with TBST buffer (3 3 5 min), and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (1:200; Santa Cruz Biotechnology) or HRP-conjugated

goat anti-mouse IgG (1:200; Santa Cruz Biotechnology) at room temperature for 2 hr. The membrane was then washed with PBS, and the HRP activity was determined using an ECL kit (USCNLIFE). The image was scanned with a GS 800 densitometer scanner (Bio-Rad, Hercules, CA), and the optical density was determined in PDQuest 7.2.0 software (Bio-Rad). Rabbit anti-rat b-actin polyclonal antibody (1:500; Santa Cruz Biotechnology) was used as an internal control. Statistical Analysis All tests were performed at least eight times. All data presented here are mean 6 standard error of mean (SEM). A repeated-measures analysis of variance and one-way analysis of variance (ANOVA) were used to compare mean values in SPSS 11.0 for Windows (SPSS, Chicago, IL). P < 0.05 was considered statistically significant.

RESULTS ES Promotes BDNF Release From SCs Short-term ES (30 min) was capable of promoting BDNF release from cultured SCs (Fig. 1). To optimize the parameters of ES that can induce the maximum BDNF release, ES at a series of intensities (3Hz, 30 min) was applied to SCs. We found that BDNF release from electrically stimulated SCs (ES at 1–10 V, but not 15 V) was significantly increased compared with that from nonstimulated cells (P < 0.05; Fig. 1D). The amount of BDNF release from electrically stimulated cells was 1.46fold (1 V), 2.71-fold (4 V), 3.17-fold (6 V), 1.82-fold (10 V), and 1.24-fold (15 V) compared with that from the nonstimulated control cells (Fig. 1D). Therefore, the maximal BDNF release was achieved by ES (3 Hz, 30 min) at 6 V. To optimize the frequency at which ES showed its maximal beneficial effect on BDNF release, ES (6 V) at a series of frequencies (1–300 Hz) was applied to SCs. We found that ES at lower frequencies (1 and 3 Hz) showed better performance than that at higher frequencies (10– 300 Hz) in promoting BDNF release from SCs. The amount of BDNF release from electrically stimulated cells was 3.09-fold (1 Hz), 3.26-fold (3 Hz), 1.95-fold (10 Hz), 1.47-fold (100 Hz), and 1.41-fold (300 Hz) compared with that from the nonstimulated control cells (Fig. 1E). Therefore, the optimal ES parameter for promoting BDNF release was 3 Hz (6 V, 30 min), which was used for the remainder of these experiments. ES Promotes Proliferation of SCs Our previous study showed that ES affected proliferation of SCs (Huang et al., 2010b). Therefore, we investigated the proliferation and cell viability at 6, 12, and 24 hr after ES (3 Hz, 6 V, 30 min). It was found that ES significantly increased cell number and viability of SCs at 12 hr and 24 hr but not at 6 hr. A significantly higher number of visible SCs was observed after ES, with increases of 22.3% at 12 hr and 34.6% at 24 hr compared with the unstimulated control cells (P < 0.05; Fig. 2A,B). Journal of Neuroscience Research

Electricity Promotes BDNF Release From SCs

Fig. 2. Beneficial effect of ES on cell number and viability of SCs and the involvement of intracellular calcium ions ([Ca21]i) in the ESinduced BDNF production in SCs. A: Fluorescence images of S-100, positive SCs at 6, 12, and 24 hr after ES or sham stimulation (control). B,C: The cell number count (B) and CCK-8 values (C) in each group were obtained by averaging the results of eight samples for each group. *P < 0.05, one-way ANOVA compared with the paired

Journal of Neuroscience Research

897

control group at each time point. D: Kinetics of intracellular calcium increase in cultured SCs during ES. E: The increase in [Ca21]i induced by ES was not affected by the presence of CaMK inhibitor KN62. *P < 0.05, one-way ANOVA compared with control group. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

898

Luo et al.

Fig. 3. ES-induced BDNF from SCs requires both calcium influx across plasma membrane and calcium mobilization from internal calcium stores. A: The ES-induced BDNF was significantly inhibited by CoCl2 (5 mM) or removal of extracellular calcium. The inhibitory effect induced by removal of extracellular calcium was reversed by increasing calcium concentration from 0 to 5 nM. B: The ESinduced BDNF was significantly inhibited by GdCl2 (100 lM, a nonspecific SGCC blocker) and mibefradi (2 lM, a T-type VGCC blocker) but not by nomodipine (2 lM, a L-type VGCC blocker), xconotoxin GVIA (1 lM, N-type inhibitor), x-agatoxin TK(1 lM, P/ Q-type inhibitor), or SNX 482 (0.5 lM, R-type inhibitor). C: High potassium resulted in elevated intracellular calcium in the absence of VGCC blockers, which was abolished by mibefradi, but not by other specific VGCC subtype inhibitors. D: High potassium resulted in

increased BDNF release from SCs in the absence of VGCC blockers, which was attenuated by mibefradi, but not by other specific VGCC subtype inhibitors. E: The ES-induced BDNF was significantly inhibited by U73122 (25 lM, a specific inhibitor of PLC-b) and neomycin (5 mM, inhibition of IP3 formation), but not by U73433 (25 lM, a partially inactive structural analogue of U73122). F: The ES-induced BDNF was significantly inhibited by dantrolene (50 lM, an antagonist of ryanodine receptor), and increased by caffeine (30 lM, an agonist of ryanodine receptor) in thapsigargin (10 lM)-treated cells. #P < 0.05 compared with control group, *P < 0.05 compared with ES group (A,B,E); #P < 0.05 compared with control group, *P < 0.05 compared with high-potassium group (C,D). #P < 0.05 compared with control group, *P < 0.05 compared with thapsigargin-treated cells (F).

In addition, The CCK-8 values for the electrically stimulated cells were 42.8% (12 hr) and 34.3% (24 hr) higher than those in the control groups at the predefined time points (P < 0.05; Fig. 2A,C). The CCK-8 values were not significantly different between the ES and the control groups at 6 hr after stimulation (P > 0.05; Fig. 2A,C). Given the effect of ES on cell number and viability, the BDNF secretion was normalized to cell number to exclude the effect of cell proliferation in the present study.

the electrically stimulated SCs by exogenous ES, with a 7.2-fold increase in amplitude compared with the control group (Fig. 2D). To examine whether the surge in intracellular calcium following ES was CaMK dependent, the intracellular calcium concentration after ES was measured in the presence or absence of the CaMK inhibitor KN62 (10 lM). We found that the increase in [Ca21]i induced by ES was not affected by the presence of CaMK inhibitor KN62 (Fig. 2E), suggesting that the surge in intracellular calcium following ES is independent of CaMK.

Involvement of [Ca21]i in the ES-Induced BDNF Release Calcium ions are ubiquitous and pluripotent intracellular messengers that regulate numerous intracellular events, including BDNF gene expression in SCs. Therefore, the role of [Ca21]i in the ES-induced BDNF release was examined in the present study. We firstly investigated the effect of ES on the level of cytoplasmic [Ca21]i in SCs. We found that [Ca21]i was significantly increased in

Role of Extracellular Calcium in the ES-Induced BDNF Release The ES-induced BDNF release requires the presence of extracellular calcium ions. We found that removal of extracellular calcium significantly decreased the ESinduced BDNF release, which was reversed by increasing extracellular calcium concentration from 0 to 5 mM (Fig. 3A). In addition, application of the nonspecific calcium channel antagonist CoCl2 (5 mM) partially abolished the Journal of Neuroscience Research

Electricity Promotes BDNF Release From SCs

Fig. 4. The ES-induced BDNF from SCs requires the involvement of CaMK IV, MAPK, and CREB. The ES-induced BDNF from SCs was significantly inhibited by the CaMKs inhibitor (KN62, 10 lM; A) or MAPK inhibitor (U0126, 20 lM; B) but not by PKA inhibitor (KT5720, 10 lM; C). The ES-induced BDNF production was significantly inhibited by CREB silencing (D). Overexpression or silencing

Journal of Neuroscience Research

899

CaMK II had little effect on BDNF release in the absence or presence of ES (E,F). Overexpression of CaMK IV significantly potentiated the ES induced-BDNF release from SCs (G). In addition, silencing CaMK IV significantly inhibited the amount of BDNF production induced by ES (H). *P < 0.05, **P < 0.01, one-way ANOVA compared with paired control groups.

900

Luo et al.

beneficial effect of ES on BDNF release from SCs, suggesting that the ES-induced BDNF release requires extracellular calcium influx through calcium channels on the plasma membrane. We next examined the role of VGCCs in the ESinduced BDNF release from SCs. We found that application of GdCl2 (100 lM), a nonspecific VGCCs inhibitor, significantly decreased the amount of BDNF in the electrically stimulated cells, indicating the involvement of calcium influx through VGCCs in the ES-induced BDNF release. Further studies showed that treatment of SCs with mibefradi (2 lM, a T-type VGCC blocker) significantly inhibited the beneficial effect of ES on BDNF release from SCs (P < 0.05; Fig. 3B), whereas nimodipine (2 lM, a L-type VGCC blocker), x-conotoxin GVIA (1 lM, N-type inhibitor), x-agatoxin TK (1 lM, P/Q-type inhibitor), and SNX 482 (0.5 lM, R-type inhibitor) had little effect on the ES-induced BDNF release (P > 0.05; Fig. 3B) These findings suggest that the ES-induced BDNF release requires calcium influx through T-type VGCC. To confirm the role of T-type VGCC in the section of BDNF induced by depolarization, SCs were treated with high potassium (50 mM KCl). We found that high potassium resulted in elevated intracellular calcium in the absence of VGCC blockers. The elevated intracellular calcium by high potassium was abolished by mibefradi but not by other specific VGCC subtype inhibitors, suggesting a critical role of T-type VGCC in the depolarization-induced intracellular calcium increase (Fig. 3C). In addition, the BDNF secretion was examined for cells depolarized with high potassium in the absence or presence of different VGCC subtype inhibitors. We found that high potassium was capable of increasing BDNF section in the absence of VGCC inhibitors, which was abolished by mibefradi (P < 0.05; Fig. 3D). In contrast, nimodipine (2 lM), x-conotoxin GVIA (1 lM), x-agatoxin (1 lM), and SNX 482 (0.5 lM) had little effect on the BDNF release induced by high potassium (P > 0.05; Fig. 3D), confirming a critical role of T-type VGCC in the depolarization-induced BDNF release. Role of Calcium Mobilization From Internal Stores in the ES-Induced BDNF Release PLC-b activation is capable of promoting inositol triphosphate (IP3) formation, which can mobilize calcium from IP3-sensitive stores. To investigate the possible role of calcium mobilization from IP3-sensitive stores, SCs were incubated with U73122 (25 lM), a specific inhibitor of PLC-b. We found that U73122 significantly inhibited the ES-induced BDNF release (P < 0.05; Fig. 3E). In contrast, incubation with U73433 (25 lM, a partially inactive structural analogue of U73122) had no effect on the ES-induced BDNF release (P > 0.05; Fig. 3E), suggesting the involvement of PLC-b activation in the ESinduced BDNF release. In addition, SCs were then incubated with neomycin before ES application, which has been shown to reduce IP3 formation. We found that neomycin significantly inhibited the ES-induced BDNF

release from SCs (P < 0.05; Fig. 3E), confirming that the ES-induced BDNF release requires calcium mobilization form IP3-sensitive stores in SCs. Previous studies have shown that secretion of neurotrophic factors requires calcium release from intracellular caffeine-ryanodine-sensitive stores (Griesbeck et al., 1999; Canossa et al., 2001). In addition, ES has been shown to be able to mobilize calcium from caffeineryanodine-sensitive stores in hippocampal neurons and SCs (Balkowiec and Katz, 2002; Huang et al., 2010b). Therefore, the present study also investigated whether caffeine-ryanodine-sensitive stores were involved in the ES-induced BDNF release from SCs. We first treated SCs with thapsigargin (10 lM) to delete IP3-sensitive stores by selectively blocking Ca21-ATPase located in the smooth endoplasmic reticulum. Then, the cells were treated with 30 lM caffeine, which is an agonist of ryanodine receptors, or 50 lM dantrolene, a ryanodine receptor antagonist (Bl€ ochl and Thoenen, 1995) for 30 min. ES was then applied to these SCs to examine the involvement of caffeine-ryanodine-sensitive stores in the ESinduced BDNF release from SCs. We found that treatment with caffeine significantly increased the ES-induced BDNF release in the thapsigargin-treated cells, whereas dantrolene significantly inhibited the beneficial effect of ES on BDNF release in the thapsigargin-treated cells (P < 0.05; Fig. 3F), suggesting the involvement of calcium mobilization from internal caffeine/ryanodine-sensitive stores in the ES-induced BDNF release from SCs. Involvement of CaMKs and MAPK in the ES-Induced BDNF Release The principal signaling molecules activated by calcium are the calcium/calmodulin-dependent protein kinases (CaMK II and CaMK IV), mitogen-activated protein kinases (MAPK), and protein kinase A (PKA). Without ES, inhibiting CaMKs or MAPK, but not PKA, significantly attenuated the BDNF release from SCs (Fig. 4). To determine whether these molecules were involved in mediating the ES-induced BDNF release from SCs, SCs were electrically stimulated in the absence or presence of inhibitors of CaMKs (KN62, 10 lM) or MAPK (U0126, 20 lM) or PKA (KT5720, 10 lM). The electrically stimulated BDNF release was significantly inhibited by KN62 (P < 0.05; Fig. 4A) and U0126 (P < 0.05; Fig. 4B) but not by KT5720 (P > 0.05; Fig. 4C), suggesting the involvement of CaMKs and MAPK in the ESinduced BDNF release in SCs. To examine further the role of CaMK II and CaMK IV in the ES-induced BDNF release in SCs, these two molecules were overexpressed or silenced in SCs. Overexpression or silencing CaMK IIa had little effect on BDNF release in the absence or presence of ES (P > 0.05; Fig. 4E,F). In contrast, overexpression of CaMK IV significantly potentiated the ES-induced BDNF release from SCs (P < 0.05; Fig. 4G). In addition, silencing CaMK IV significantly decreased the amount of BDNF production induced by ES (P < 0.05; Fig. 4H). These findings suggest Journal of Neuroscience Research

Electricity Promotes BDNF Release From SCs

901

Fig. 5. Expression of CREB and p-CREB in SCs under different conditions. A: Band of CREB and p-CREB in SCs in different groups. B: Protein levels of CREB and p-CREB in SCs in different groups. The expression of p-CREB was significantly upregulated by ES (6 V, 3 Hz), which was attenuated by inhibition of MAPK with

U0126 or silencing CaMK IV and was further increased by CaMK IV overexpression. In contrast, Overexpression or silencing CaMK II showed little effect on p-CREB expression in the electrically stimulated SCs. *P < 0.05 when comparisons were made between the indexed groups.

that CaMK IV, not CaMK II, is a major mediator in the ES-induced BDNF release in SCs.

is a downstream mediator of both CaMK IV and MAPK. To determine further whether CREB function was required for the ES-induced BDNF release in SCs, we investigated the consequences of silencing CREB in SCs. As shown in Figure 4D, the ES-induced BDNF production was significantly inhibited by silencing CREB by specific siRNA, suggesting an important role of CREB in the ES-induced BDNF release in SCs.

Involvement of CREB in the ES-Induced BDNF Release The best characterized transcriptional factor mediated by both CaMK IV and MAPK is cAMP response element-binding protein (CREB; Shaywitz and Greenberg, 1999; Dolmetsch et al., 2001). CaMK IV and MAPK induced CREB-mediated transcription by phosphorylation of CREB (p-CREB) at Ser133, which is required for the interaction of CREB with its coactivator. To examine whether CREB was involved in the ESinduced BDNF release in SCs, we first examined the expression of CREB and p-CREB under different conditions. Overexpression of CaMK IV significantly upregulated the p-CREB levels, whereas silencing CaMK IV significantly downregulated the p-CREB levels in SCs (Fig. 5A,B). In addition, inhibition of MAPK by U0126 significantly downregulated the p-CREB levels in SCs (Fig. 5A,B). In contrast, overexpression or silencing CAMK IIa showed little effect on the expression level of p-CREB (Fig. 5A,B). These findings indicate that CREB Journal of Neuroscience Research

DISCUSSION The present study investigated the possibility of using ES to activate SCs to secrete BDNF. We found that shortterm ES was capable of dramatically increasing BDNF release from SCs. The beneficial effect of ES on BDNF release could be modulated by both stimulation intensity and frequency, and the maximal BDNF release was achieved by ES at 6V (30 Hz, 30 min). The ES-induced BDNF release required calcium influx through T-type VGCC and calcium mobilization from internal calcium stores. In addition, activation of CaMK IV-, MAPK-, and CREB-mediated gene expression was also involved in the ES-induced BDNF release. SCs have been considered as “processing factories” for neurotrophic factors. SCs can be activated to expand

902

Luo et al.

BDNF production in response to various stimuli. In primary SC cultures, BDNF production can be activated by chemical factors, including fibroblast growth factor (Meyer et al., 1992) and bioactive compounds extracted from a Chinese medical herb Panax ginseng, such as panaxydol (He et al., 2009) and ginsenosides (Liang et al., 2010), which have been shown to promote BDNF release from SCs in previous studies (He et al., 2009; Liang et al., 2010). In addition, the adenoviral gene transfer technique has been tried to overexpress BDNF to high concentrations in SCs (Gravel et al., 1997). However, the safety of such an artificial system is still controversial. In the present study, we found that short-term ES was capable of promoting BDNF release from SCs, and a maximal BDNF release was achieved by ES at 6 V (3 Hz, 30 min). Exogenous ES has been shown to induce a cellular response through increasing [Ca21]i in many cell types, including hippocampus neurons (Balkowiec and Katz, 2002), human hepatoma cells (Song et al., 2008), and fibroblasts (Cho et al., 2002; Shi et al., 2008). However, the pathways through which ES increasing [Ca21]i varied greatly in different cell types. In hippocampal neurons, the ES-increased [Ca21]i was achieved mainly by calcium influx through N-type calcium channels and calcium mobilization from intracellular calcium stores (Balkowiec and Katz, 2002). In human hepatoma cells, the increase in [Ca21]i induced by ES depends mainly on calcium influx through stretch-activated calcium channels (SACCs; Song et al., 2008). In human osteoblasts, ES-induced calcium increase was mediated mainly via calcium influx through SACCs and calcium mobilization from internal calcium stores (Cho et al., 2002). In comparison, the ES-induced BDNF release required calcium influx through T-type VGCC and calcium mobilization from internal calcium stores in SCs. All these findings indicate that the electrocoupling mechanism varies greatly in different cell types, which may depend on the parameters of ES selected as well as on the structural properties of the different cell types. Therefore, optimal parameters of ES should be identified for each cell type. Our previous study showed that ES is capable of promoting NGF release by calcium influx through T-type VGCC and calcium mobilization from internal calcium stores (Huang et al., 2010b), which are also involved in the ES-induced BDNF release in the present study. In addition, it was found that inhibition of CaMK IV and MAPK resulted in decreased production of BDNF in electrically stimulated SCs, suggesting that both CaMK IV and MAPK are required for ES-induced calciumdependent BDNF release from SCs. Inhibition of CaMK IV and MAPK also was found to lead to decreased phosphorylation of CREB in electrically stimulated SCs, indicating that the roles of CaMK IV and MAPK in the ESinduced BDNF release are related to their ability to activate CREB-dependent transcription in SCs. The present study shows that ES was able to stimulate SCs to release BDNF, which is of great significance for the treatment of nerve injury and neurodegenerative disease. Many studies have shown that nerve conduits seeded with SCs show better performance in promoting nerve

Fig. 6. Intracellular pathways involved in the ES-induced BDNF release in SCs. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

regeneration and functional recovery after their implantation in a lengthy peripheral nerve defect (McGrath et al., 2010; Penna et al., 2012). In addition, SCs have been tried in treating spinal cord injury and neurodegenerative disorders such as Parkinson’s disease (Collier and Martin, 1993; Zhang et al., 1994; Oudega and Xu, 2006) in the CNS. However, the application of SCs in vivo was limited by limited availability, immunogenicity, and poor migration ability. The present study shows that ES could promote BDNF release from SCs. All these findings offer opportunities to develop electrically stimulated SCs as a source of cell therapy for traumatic and degenerative injuries in PNS and CNS. Despite the potential application of electrically stimulated SCs listed above, further investigations still are needed to investigate the fate of electrically stimulated SCs after their implantation in vivo and to examine their efficacy in the treatment of nerve injury in animals. Also, SCs are nonexcitable cells, for which ES showed beneficial effects on BDNF and NGF production. We propose that ES might also modulate other nonexcitable cells, including stem cells, which might be more suitable for tissue injury repair. These topics are interesting and await investigation in the future. CONCLUSIONS The present study shows that ES can activate SCs to secrete BDNF, which requires the involvement of calcium influx through T-type VGCC and calcium mobilization from internal calcium stores. In addition, activation of CaMK IV, MAPK, and CREB was also involved in the ESinduced BDNF release (summarized in Fig. 6). These findings indicate that ES can improve the neurotrophic ability in SCs and raise the possibility of developing electrically stimulated SCs as a source of cell therapy for nerve injury in both peripheral and central nervous systems. ACKNOWLEDGMENTS We thank technicians Lifeng Lan and Haifeng Zhang for their excellent technical assistance. The authors have no conflicts of interest. Journal of Neuroscience Research

Electricity Promotes BDNF Release From SCs

REFERENCES Balkowiec A, Katz DM. 2002. Cellular mechanisms regulating activitydependent release of native brain-derived neurotrophic factor from hippocampal neurons. J Neurosci 22:10399–10407. Bamber NI, Li H, Lu X, Oudega M, Aebischer P, Xu XM. 2001. Neurotrophins BDNF and NT-3 promote axonal re-entry into the distal host spinal cord through Schwann cell-seeded mini-channels. Eur J Neurosci 13:257–268. Bl€ ochl A, Thoenen H. 1995. Characterization of nerve growth factor (NGF) release from hippocampal neurons: evidence for a constitutive and an unconventional sodium-dependent regulated pathway. Eur J Neurosci 7:1220–1228. Brighton CT, Wang W, Clark CC. 2008. The effect of electrical fields on gene and protein expression in human osteoarthritic cartilage explants. J Bone Joint Surg Am 90:833–848. Bunge RP. 1994. The role of the Schwann cell in trophic support and regeneration. J Neurol 242:S19–S21. Canossa M, G€artner A, Campana G, Inagaki N, Thoenen H. 2001. Regulated secretion of neurotrophins by metabotropic glutamate group I (mGluRI) and Trk receptor activation is mediated via phospholipase C signalling pathways. EMBO J 20:1640–1650. Cho MR, Marler JP, Thatte HS, Golan DE. 2002. Control of calcium entry in human fibroblasts by frequency-dependent electrical stimulation. Front Biosci 7:a1–a8. Collier TJ, Martin PN. 1993. Schwann cells as a source of neurotrophic activity for dopamine neurons. Exp Neurol 124:129–133. Dolmetsch RE, Pajvani U, Fife K, Spotts JM, Greenberg ME. 2001. Signaling to the nucleus by an L-type calcium channel-calmodulin complex through the MAP kinase pathway. Science 294:333–339. .Fang Y, Mo X, Guo W, Zhang M, Zhang P, Wang Y, Rong X, Tian J, Sun X. 2010. A new type of Schwann cell graft transplantation to promote optic nerve regeneration in adult rats. J Tissue Eng Regen Med 4:581–589. Geremia NM, Pettersson LM, Hasmatali JC, Hryciw T, Danielsen N, Schreyer DJ, Verge VM. 2010. Endogenous BDNF regulates induction of intrinsic neuronal growth programs in injured sensory neurons. Exp Neurol 223:128–142. Ghosh M, Tuesta LM, Puentes R, Patel S, Melendez K, El Maarouf A, Rutishauser U, Pearse DD. 2012. Extensive cell migration, axon regeneration, and improved function with polysialic acid-modified Schwann cells after spinal cord injury. Glia 60:979–992. Griesbeck O, Canossa M, Campana G, G€artner A, Hoener MC, Nawa H, Kolbeck R, Thoenen H. 1999. Are there differences between the secretion characteristics of NGF and BDNF? Implications for the modulatory role of neurotrophins in activity-dependent neuronal plasticity. Microsc Res Techniq 45:262–275. Gravel C, G€ otz R, Lorrain A, Sendtner M. 1997. Adenoviral gene transfer of ciliary neurotrophic factor and brain-derived neurotrophic factor leads to long-term survival of axotomized motor neurons. Nat Med 3:765–770. He J, Ding WL, Li F, Xia R, Wang WJ, Zhu H. 2009. Panaxydol treatment enhances the biological properties of Schwann cells in vitro. Chem Biol Interact 177:34–39. Huang J, Hu X, Lu L, Ye Z, Zhang Q, Luo Z. 2010a. Electrical regulation of Schwann cells using conductive polypyrrole/chitosan polymers. J Biomed Mater Res A 93:164–174. Huang J, Ye Z, Hu X, Lu L, Luo Z. 2010b. Electrical stimulation induces calcium-dependent release of NGF from cultured Schwann cells. Glia 58:622–631. Kobayashi M, Ishibashi S, Tomimitsu H, Yokota T, Mizusawa H. 2012. Proliferating immature Schwann cells contribute to nerve regeneration after ischemic peripheral nerve injury. J Neuropathol Exp Neurol 71:511–519. Kwon YW, Gurney ME. 1996. Brain-derived neurotrophic factor transiently stabilizes silent synapses on developing neuromuscular junctions. J Neurobiol 29:503–516. Journal of Neuroscience Research

903

Liang W, Ge S, Yang L, Yang M, Ye Z, Yan M, Du J, Luo Z. 2010. Ginsenosides Rb1 and Rg1 promote proliferation and expression of neurotrophic factors in primary Schwann cell cultures. Brain Res 1357:19–25. McGrath AM, Novikova LN, Novikov LN, Wiberg M. 2010. BD PuraMatrix peptide hydrogel seeded with Schwann cells for peripheral nerve regeneration. Brain Res Bull 83:207–213. McKasson MJ, Huang L, Robinson KR. 2008. Chick embryonic Schwann cells migrate anodally in small electrical fields. Exp Neurol 211:585–587. Meyer M, Matsuoka I, Wetmore C, Olson L, Thoenen H. 1992. Enhanced synthesis of brain-derived neurotrophic factor in the lesioned peripheral nerve: different mechanisms are responsible for the regulation of BDNF and NGF mRNA. J Cell Biol 119:45–54. Montero-Menei CN, Pouplard-Barthelaix A, Gumpel M, Baron-Van Evercooren A. 1992. Pure Schwann cell suspension grafts promote regeneration of the lesioned septo-hippocampal cholinergic pathway. Brain Res 570:198–208. Oudega M, Xu XM. 2006. Schwann cell transplantation for repair of the adult spinal cord. J Neurotrauma 23:453–467. Ozawa H, Abe E, Shibasaki Y, Fukuhara T, Suda T. 1989. Electric fields stimulate DNA synthesis of mouse osteoblast-like cells (MC3T3-E1) by a mechanism involving calcium ions. J Cell Physiol 138:477–483. Parrilla-Reverter G, Agudo M, Sobrado-Calvo P, Salinas-Navarro M, Villegas-Perez MP, Vidal-Sanz M. 2009. Effects of different neurotrophic factors on the survival of retinal ganglion cells after a complete intraorbital nerve crush injury: a quantitative in vivo study. Exp Eye Res 89:32–41. Penna V, Stark GB, Wewetzer K, Radtke C, Lang EM. 2012. Comparison of Schwann cells and olfactory ensheathing cells for peripheral nerve gap bridging. Cells Tissues Organs 196:534–542. Qi F, Wang Y, Ma T, Zhu S, Zeng W, Hu X, Liu Z, Huang J, Luo Z. 2013. Electrical regulation of olfactory ensheathing cells using conductive polypyrrole/chitosan polymers. Biomaterials 34:1799–809. Shaywitz AJ, Greenberg ME. 1999. CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu Rev Biochem 68:821–861. Shi G, Zhang Z, Rouabhia M. 2008. The regulation of cell functions electrically using biodegradable polypyrrole-polylactide conductors. Biomaterials 29:3792–3798. Song G, Qin J, Yao C, Ju Y. 2008. Effect of steep pulsed electric field on proliferation, viscoelasticity and adhesion of human hepatoma SMMC-7721 cells. Anticancer Res 28:2245–2251. Sun P, Lou L, Maurer RA. 1996. Regulation of activating transcription factor-1 and the cAMP response element-binding protein by Ca21/calmodulin-dependent protein kinases type I, II, and IV. J Biol Chem 271:3066–3073. Tep C, Kim ML, Opincariu LI, Limpert AS, Chan JR, Appel B, Carter BD, Yoon SO. 2012. Brain-derived neurotrophic factor (BDNF) induces polarized signaling of small GTPase (Rac1) protein at the onset of Schwann cell myelination through partitioning-defective 3 (Par3) protein. J Biol Chem 287:1600–1608. Wang T, Cong R, Yang H, Wu MM, Luo N, Kuang F, You SW. 2011. Neutralization of BDNF attenuates the in vitro protective effects of olfactory ensheathing cell-conditioned medium on scratch-insulted retinal ganglion cells. Cell Mol Neurobiol 31:357–364. Ward NL, Hagg T. 2000. BDNF is needed for postnatal maturation of basal forebrain and neostriatum cholinergic neurons in vivo. Exp Neurol 162:297–310. Zhang WC, Ding YJ, Cao JK, Du JX, Zhang GF, Liu YJ. 1994. Intracerebral co-grafting of Schwann’s cells and fetal adrenal medulla in the treatment of Parkinson’s disease. Chin Med J (Engl) 107:583–588. Zhao Z, Qin L, Reid B, Pu J, Hara T, Zhao M. 2012. Directing migration of endothelial progenitor cells with applied DC electric fields. Stem Cell Res 8:38–48.