Veterinary Immunology and Immunopathology 157 (2014) 97–104
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Research paper
Egg yolk IgY against RHDV capsid protein VP60 promotes rabbit defense against RHDV infection Li Zai Xin, Hu Wei Dong, Li Bing Chao, Li Tian You, Zhou Xiao Yang, Zhang Zhi ∗ Key Laboratory of Pharmaceutical Engineering Technology and Application, School of Chemical and Pharmaceutical Engineering, Sichuan University of Science and Engineering, Zigong 643000, China
a r t i c l e
i n f o
Article history: Received 16 May 2013 Received in revised form 26 September 2013 Accepted 8 October 2013 Keywords: Rabbit hemorrhagic disease virus (RHDV) Egg yolk antibody (IgY) VP60 capsid protein
a b s t r a c t VP60 capsid protein is the major structural and immunogenicity protein of RHDV (Rabbit hemorrhagic disease virus, RHDV), and has been implicated as a main protein antigen in RHDV diagnosis and vaccine design. In this report, egg yolk antibody (IgY) against Nterminal of VP60 was evaluated and developed as a new strategy for RHDV therapy. Briefly, N-terminal of VP60 (∼250aa) fragment was cloned and inserted into pET28a expression vector, and then the resultant plasmid, pET28a/VP60-N, was transformed into E. coli BL21(DE3) for recombinant VP60-N protein (rVP60-N) expression. Next, the rVP60-N was purified by Ni+ -affinity purification chromatography and identified by Western blotting with RHDV antiserum. After immunizing the chickens with rVP60-N, the anti-rVP60-N IgY was isolated, and the activity and specificity of the IgY antibody were analyzed by ELISA and Western blotting. In our results, the rVP60-N could be expressed in E. coli as soluble fraction, and the isolated anti-rVP60-N IgY demonstrated a high specificity and titer (1:22,000) against rVP60-N antigen. For further evaluation of the IgY efficacy in vivo, rabbits were grouped randomly and challenged with RHDV, and the results showed that anti-rVP60-N IgY could significantly protect rabbits from virus infection and promote the host survival after a sustained treatment with anti-rVP60-N IgY for 5 days. Taken together, our study demonstrates evidence that production of IgY against VP60 could be as a novel strategy for the RHDV therapy. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Rabbit hemorrhagic disease (RHD) is highly contagious and has been characterized as high morbidity and mortality in adult rabbits (Schirrmeier et al., 1999; Liu et al., 1984). The disease was first discovered in China in (Liu et al., 1984) and soon spread worldwide (Gregg et al., 1991; Mitro and Krauss, 1993; Toledo et al., 1995; Bouslama et al., 1996; Embury-Hyatt et al., 2012). The etiological agent is a single-stranded positive-sense RNA virus from the family of Caliciviridae named rabbit hemorrhagic disease virus (RHDV) (Parra and Prieto,
∗ Corresponding author. Tel.: +81 3 5505605; fax: +81 3 5505605. E-mail address: [email protected] (Z. Zhang). 0165-2427/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetimm.2013.10.002
1990). The virions are non-enveloped and icosahedral calicivirus, and genome of which has two open reading frames (ORFs), including ORF1 and ORF2. ORF1 encodes a polyprotein that is cleaved into non-structural components and the major structural protein, the capsid protein VP60 (Parra et al., 1993), which is the main target of the host immune defense against RHDV and plays an important role in virus diagnosis and vaccine design. In the past years, the capsid protein VP60 has been successfully expressed in several heterologous systems and shown to induce full protection of rabbits against a lethal challenge with RHDV (Bertagnoli et al., 1996a,b; Fischer et al., 1997; Castanon et al., 1999; Fernandez-Fernandez et al., 2001; Perez-Filgueira et al., 2007). And also, the antigenic structure of VP60 has been well analyzed by using anti-RHDV monoclonal antibodies (mAbs) and anti-RHDV
98
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
serum respectively, suggesting that the N-terminal of VP60 (1-250aa) is the most antigenic region (Viaplana et al., 1997; Martínez-Torrecuadrada et al., 1998). Antibody-based passive immunization is effective in prevention and treatment of infectious diseases (Keller and Stiehm, 2000), in which the availability of large amount of specific antibodies is the key. Immunoglobulin Y (IgY), the egg yolk antibodies generated as a passive immunity to embryos and baby chicks, can be a good source of such antibody. IgY can be easily produced and purified with high yields from egg yolks of immunized hens by variable methods, which has been used as a safe and inexpensive strategy to control and prevent bacterial and viral infections in domestic farm animals (Chalghoumi et al., 2009b; Vega et al., 2011). However, the possibility of using IgY to treat against RHDV infection in rabbits in vivo has not yet been studied. In present study, we generated a large amount of antiVP60 polyclonal IgY by using the recombinant N-terminal of VP60 (1–250 aa) as antigen. We successfully produced high titers of specific IgY in egg yolks from immunized chickens and showed neutralizing activity of IgY on RHDV in vivo. Our results provide solid evidence that production of IgY could be used as a novel strategy for therapeutic treatments against RHDV. 2. Material and methods 2.1. Materials The pTNTTM vector containing a full-length RHDV VP60 gene was kindly provided by Prof. Guangqing Liu (Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Shanghai, China). RHDV LQ, a virulent strain of RHDV, and antiserum against RHDV were obtained as a gift from SICHUAN HUAPAI BIO-PHARMACEUTICAL CO.,LTD. 2.2. Amplification of VP60-N The N-terminal of VP60 (VP60-N) was amplified by PCR with forward primer VP60-N-F (5 CCGGAATTCATGGAGGGCAAAGCCCGCA-3 ) and reverse primer VP60-N-R (5 - CCGCTCGAGATTGCCAACACCAGTGA3 ), which contained EcoR I and Xho I sites respectively. Next, the PCR product was cloned into the dephosphorylated EcoR I and Xho I sites of pET28a (Novagen, USA), and the resultant plasmid named pET28a/VP60-N. The recombinant plasmid was confirmed by sequence analysis. 2.3. Preparation of VP60-N antigens pET28a/VP60-N plasmid was transformed into E. coli BL21(DE3), and the recombinant VP60-N (rVP60-N) was expressed with an induction of 0.5 mM IPTG (Merch, Germany) at 25 ◦ C overnight. Next, the His-tagged rVP60N fusion proteins were purified by using Ni+ -affinity purification chromatography column according to the manufacturer’s instructions (Novagen, USA). The protein concentration was determined by using the Bradford Protein Assay, and 200 g of rVP60-N antigens in 300 L of
phosphate buffered saline (PBS) were used for i.m immunization. 2.4. Chickens and immunization Six-week old Leghorn chickens were housed in individual cages under a regimen of 12 h of light and 12 h of darkness, at room temperature (23 ± 2 ◦ C) and humidity of 75 ± 5%. Water and commercial chicken food were offered daily. The chickens were immunized intramuscularly with rVP60-N protein mixed with Freund’s adjuvant (Sigma, USA) at different sites of the breast at 21 weeks old. Three hundred microlitre of protein solution (containing 200 g rVP60-N) were emulsified with an equal volume of complete Freund’s adjuvant for the first immunization. Two booster immunizations were followed up using incomplete Freund’s adjuvant (Sigma, USA) with four weeks interval with 100 g of rVP60-N antigens. Eggs were collected daily, marked and stored at 4 ◦ C before being processed for IgY. 2.5. IgY antibody purification IgY antibody was extracted and purified from egg yolks using water-dilution method as described before (Akita and Nakai, 1993) with modifications. Briefly, 10 mL egg yolk was diluted 8-fold in deionized ultrapure water adjusted to pH 5.0–5.2 with 1N HCl and homogenized thoroughly. After vortex, the sample mixtures were centrifuged at 12,000 × g for 20 min at 4 ◦ C to remove the lipid-rich precipitate. The supernatant, consisting of lipid-free fraction, was collected and precipitated with the addition of 40% ammonium sulfate (w/v). After centrifugation (12,000 × g, 20 min, 4 ◦ C), the pellet, the IgY enriched fraction, was dissolved in 10 mL PBS. To eliminate residual salt, the isolated IgY was further purified by ultrafiltration using Millipore Amicon Ultra15 (100 kD) according to the manufacturer’s instructions (Millipore, USA). The final IgY retentate was dissolved in 10.0 mL PBS and stored at −20 ◦ C. The purity and quantity of the isolated IgY antibody were determined by SDS-PAGE and Bradford Protein Assay respectively. 2.6. Detection of rVP60-N specific IgY in yolks by enzymelinked immunosorbent assay (ELISA) Specific activity of IgY antibody against rVP60-N protein was determined by ELISA. Briefly, a 96-well microtiter plate was coated with 100 L of rVP60-N antigen (5 g/mL) at 4 ◦ C overnight. After washing three times with PBS containing 0.05% (v/v) Tween 20 (PBST), the nonspecific binding sites were blocked with 3% (w/v) BSA in PBS for 2 h at 37 ◦ C. After three times washing, 100 L of a serially diluted IgY antibody in PBST was added to the wells as the primary antibody and then incubated for 3 h at room temperature or 4 ◦ C overnight. The plate was washed again and the bound antibody was then incubated with 100 L of goat antichicken IgY–HRP (1:5000) (Sigma, USA) for 1.5 h at room temperature. Finally, the HRP activity was detected by adding 100 L of TMB substrate reagent (BEYOTIME, China) to each well for 15–30 min at room temperature, and then the reaction were stopped by adding 50 L of 2 M H2 SO4 to the wells. The optical density (OD) was read at 450 nm on
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
99
microtiter plate reader. Antigen-specific IgY antibody titers were defined as the endpoint dilution with a cut off signal intensity of OD450 value at 0.2. Pre-immunized chicken yolk IgY was used as negative control. 2.7. Characterization of IgY by Western-blot analysis assay Specificity of the purified IgY against rVP60-N protein was examined by Western-blot analysis. Briefly, the purified rVP60-N protein was separated using 12% SDS-PAGE and transferred onto a nitrocellulose (NC) membrane (Millipore, USA) using a semi-dry transfer Western blotting apparatus (Bio-Rad, USA). The membrane was blocked with 3% (w/v) BSA (Sangon, China) for 2 h and then incubated with IgY antibody (1:1000) and anti-RHDV serum (1:1000) respectively for 2 h at room temperature. After washing three times with PBST, HRP-conjugated goat-anti-chicken antibody diluted in PBST (1:5000) was added and incubated for 1 h at room temperature. The membrane was washed and detected with Western blotting detection reagents (TMB horseradish peroxidase color development solution for Blotting, BEYOTIME, China). 2.8. Dot blot analysis of anti-rVP60-N IgY For dot blot, virus infected (RHDV) and healthy rabbit liver tissues were extracted in PBS buffer, subsequent dilutions of the lysate were made in PBS buffer and blotted onto 0.22-m nitrocellulose membrane. After blocking with 3% BSA, the membrane was incubated with anti-rVP60-N IgY at 1:1000 for 2 h at room temperature. The following procedure to stain was the same as described for Western blotting. 2.9. Virulent challenge and IgY treatment 3-Month-old New Zealand White rabbits, free from anti-RHDV antibodies, were obtained from the Laboratory Animal Center of Sichuan University, China, and randomly assigned to four groups and housed in separate rooms. To test the inhibition of IgY against RHDV infection in vivo, the rabbits were challenged through subcutaneous injection with 10 times LD50 RHDV LQ strain. For pre-treated group (prophylactic group), the rabbits were pre-treated with anti-rVP60-N IgY through i.v injection at a dose of 10 mg/kg before RHDV challenge 2 h, and then received a same IgY treatment for 5 days at once a day. For posttreated group (therapeutic group), after RHDV challenge 12 h, the rabbits received a treatment with anti-rVP60N IgY through i.v injection at a dose of 10 mg/kg once a day, and the treatment continued for 5 days. As control, post RHDV infection 12 h, rabbits received PBS (PBS control group) or negative IgY (control IgY group) only through i.v injection once a day, and the treatment continued for 5 days. Rabbits were observed twice a day and any mortality was recorded. Dead rabbits were necropsied immediately, whereas the surviving rabbits in each group were euthanized. The liver tissues were collected and stored at −80 ◦ C. The experiment was repeated three times.
Fig. 1. PCR amplification of N-terminal of VP60 (named VP60-N). (A) PCR product of VP60-N fragment about 750 bp. Line M, DL2000 DNA marker; Line 1, PCR product. (B) Identification of pET28a-VP60-N reconlbinant plasmid by digestion with EcoR I and Xho I. Line M, DL2000 DNA marker; Line 1, digestion product.
2.10. Semi-quantitative RT-PCR For the detection and quantification of viral RNA in the experimental rabbits, the total RNA was extracted from the liver tissues of experimental rabbits using the TRIZOL reagent (Invitrogen, USA) according to the manufacturer’s instructions. RHDV RNA copies in the samples were detected by semi-quantitative RT-PCR. The forward primer, 5 -TGGAGGGCAAAGCCCGCA-3 , and the reverse primer 5 -GATTGCCAACACCAGTGA-3 . PCR was carried out under the conditions of 94 ◦ C for 3 min followed by 26 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 30 s, and a final elongation at 72 ◦ C for 5 min. PCR products were analyzed with 1% agarose gel electrophoresis containing ethidium bromide. Then the bands of PCR products were quantified by densitometry using Bandscan software and normalized with its -actin. 2.11. Statistical analysis To evaluate the antibody ELISA responses and the protective immune responses among the different groups, the mean values from all groups were compared with student’s t-test using SPSS v.12.0 software. P-values of 24 h
100 100 0 70
10 10 0 0
100% 100% 0 0
RHD, rabbit hemorrhagic disease.
102
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
Fig. 5. Protection against RHDV challenge with anti-rVP60-N IgY. Ten times LD50 of RHDV LQ strain was administered by subcutaneous injection and 2 mL of IgY or PBS were given i.v. at doses of 10 mg/kg for treatment as described. Rabbits were observed twice a day and any mortality was recorded. The values are the mean of 10 rabbits in each group. Mortality is expressed as % of rabbits that survived after the lethal infection (A). (B) Viral RNA in the liver tissue were detected and analyzed by semi-quantitative RT-PCR assay (above), PCR products was quantified by densitometry using Bandscan software and normalized with its -actin (below). Line 1–2, PBS control group; Line 3–4, control IgY; Line 5–6, antirVP60-N IgY therapeutic group; Line 7–8, anti-rVP60-N IgY pre-treated group. n = 4. *p < 0.05, **p < 0.01 in comparison with PBS control.
effective strategies against its etiological agent, RHDV. Unfortunately, the lack of an efficient in vitro propagation system for RHDV has hindered the production of the virus as a source of vaccine antigens. Currently, vaccines are produced by the chemical inactivation of crude virus preparations obtained from the organs of infected rabbits. This strategy raises serious concerns about biological safety, contaminant residues and animal welfare (Omar et al., 2005). The capsid protein (VP60) is the major structural and immunogenicity protein of RHDV, and has been developed as a key target of RHDV vaccine design. Therefore, with the aim of constructing a scalable recombinant vaccine, several approaches have been tried and used to produce recombinant versions of VP60, including bacteria, yeasts, plants, poxvirus-based vectors, insect cells and DNA vaccine. These studies have shown induction of a protective immune response against RHDV challenge
(Bertagnoli et al., 1996a,b; Barcena et al., 2000; Gil et al., 2006; Gromadzka et al., 2006; Cheng et al., 2013). However, these systems have problems, such as a relatively low level of expression, or have limitations related to the environmental release of genetically modified organisms. The antigenic structure of the capsid protein VP60 of RHDV has been well analyzed and showed that the N-terminal of VP60 contains the most antigenic region of VP60 (Viaplana et al., 1997; Martínez-Torrecuadrada et al., 1998). In the present study, N-terminal of VP60 (VP60-N) instead of VP60 full protein was used as antigens to immune laying hens, and the protection efficacy of anti-rVP60-N IgY were studied in vivo. In our system, rVP60-N could be mainly expressed in soluble fraction under 20 ◦ C–30 ◦ C. Also, rVP60-N could be well recognized by anti-RHDV serum and the isolated anti-rVP60-N IgY respectively (Figs. 3 and 4). After immunization with rVP60-N, we successfully produced a large amount of polyclonal IgY antibodies against rVP60-N using water-dilution method combined with ultrafiltration, and the titer of antirVP60-N IgY could reached up to 1:22,000 (Fig. 4). To further evaluate the effectiveness of anti-rVP60-N IgY against a lethal RHDV infection, the rabbits were challenged with a wild type RHDV strain, LQ in vivo. Rabbits from the control group displayed the clinical symptoms and typical lesions of the disease and died within 48–72 h, while from the IgY-treated group there was significant reduction in onset, duration and severity of the illness of RHD, and all survived from rabbits which received anti-VP60-N IgY treatment (Fig. 5). In addition, the rate of protection demonstrated a dose-dependent profile with protection rate reaching up to 100% at the 10 mg/kg IgY concentration (data not shown). And also, pre-treated RHDV with anti-VP60-N IgY could significantly protect rabbits form RHDV infection and promote the host survival. Combined with these data, our results suggested that anti-VP60-N IgY antibody-based passive immunization is effective in prevention and treatment of RHDV infectious diseases. However, there always be some potential drawbacks with using repeated injections of IgY antibodies raised in other species. Most importantly, IgY treatment could induced significant antibody response toward IgY because of immunogenicity, and the IgY activity could be attenuated by anti-IgY Abs mediated neutrolization and phagocytosis. Several groups have reported the presence of anti-IgY antibodies in sera of humans and animals (Russell et al., 1986; Walsh et al., 2000; Nguyen et al., 2010). Interestingly, it was observed that the pre-existing anti-IgY Abs did not interfere with the protective effectiveness of pathogenspecific IgY (Nguyen et al., 2010), and the half-lives of IgY could reach up to 3.0 days and effectively protects host from lethal virus challenge in vivo (Brocato et al., 2012). In this study, after RHDV challenge, the rabbits were adminstrated with anti-rVP60-N IgY once a day for 5 days. Although it is interesting to detect the level of anti-IgY Abs and the bioavailability of IgY in vivo, the fact that it is difficult to produce enough anti-IgY Abs after the first IgY injection in short times. In addition, the protection conferred by the anti-rVP60-N IgY, the mechanism possibly only contribute to the recognization of IgY and binding to the surface of RHDV, and then blocking the transmission and infection
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
of RHDV, because the majority of the Fc region of IgY is incompatible with the mammalian Fc receptors (Warr et al., 1995). In recent years, pathogen-specific IgY has attracted considerable attention as a means of controlling of infectious diseases of bacterial and viral origin. IgY possesses many advantages compared with mammalian IgG including efficacy, safety, cost-effectiveness, stablity and high yield, which making IgY an promising treatment to control infections of pathogens (Xu et al., 2011), while the usefulness of IgY is still underestimated. Recently, several studies have showed promising results on the possible prophylactic and therapeutic treatment against different viral infections, including EV71 (Liou et al., 2010), influenza A and B (Nguyen et al., 2010; Wallach et al., 2011; Wen et al., 2012), HAV (de Paula et al., 2011), NoV and RV infection (Dai et al., 2012). In present study, rabbits pre-treated with antirVP60-N IgY before RHDV challenge did not demonstrate any clinical symptoms of RHD, while others developed an obvious clinical symptoms within 24 h after RHDV challenge. Fortunately, these rabbits could be rescued when administrated with 10 mg/kg anti-rVP60-N IgY injection up to 5 days after RHDV challenge. Altogether, these studies strongly suggested that IgY technology could be used not only as a preventive strategy but also as a specific treatment against pathogens infection. Author disclosure statement No competing financial interests exist. Acknowledgments This work was supported by Sichuan Provincial Education Department Foundation of China (Nos. 08ZA086 and 12ZA266), Natural Science Foundation of Sichuan University of Science and Engineering (No. 2011RC16), National Innovation Foundation for college students (No. 201210622002) and Innovative Foundation Project for Students of Sichuan University of Science and Engineering. References Akita, E.M., Nakai, S., 1993. Comparation of four purification methods for the production of immunoglogulins from eggs laid by hens immunized with a enterotoxigenic Escherichia coli strain. J. Immunol. Meth. 164, 141–142. Barcena, J., Morales, M., Vazquez, B., Boga, J.A., Parra, F., Lucientes, J., PagesMantes, A., Sanchez-Vizcaino, J.M., Blasco, R.Y., Torres, J.M., 2000. Horizontal transmissible protection against myxomatosis and rabbit haemorrhagic disease by using a recombinant myxoma virus. J. Virol. 74, 1114–1123. Bouslama, A., De Mia, G.M., Hammami, S., Aouina, T., Soussi, H., Frescura, T., 1996. Identification of the rabbit haemorrhagic disease in Tunesia. Vet. Rec. 138, 108–110. Bertagnoli, S., Gelfi, J., LeGall, G., Boilletot, E., Vautherot, J.F., Rasschaert, D., Laurent, S., Petit, F., BoucrautBaralon, C., Milon, A., 1996a. Protection against myxomatosis and rabbit viral hemorrhagic disease with recombinant myxoma viruses expressing rabbit hemorrhagic disease virus capsid protein. J. Virol. 70, 5061–5066. Bertagnoli, S., Gelfi, J., Petit, F., Vautherot, J.F., Rasschaert, D., Laurent, S., LeGall, G., Boilletot, E., Chantal, J., BoucrautBaralon, C., 1996b. Protection of rabbits against rabbit viral haemorrhagic disease with a vaccinia-RHDV recombinant virus. Vaccine 14, 506–510. Brocato, R., Josleyn, M., Ballantyne, J., Vial, P., Hooper, J.W., 2012. DNA vaccine-generated duck polyclonal antibodies as a postexposure
103
prophylactic to prevent hantavirus pulmonary syndrome (HPS). PLoS ONE 7, e35996. Embury-Hyatt, C., Postey, R., Hisanaga, T., Burton, L., Hooper-McGrevy, K., McIntyre, L., Millar, K., Pasick, J., 2012. The first reported case of rabbit hemorrhagic disease in Canada. Can. Vet. J. 53, 998–1002. Castanon, S., Marin, M.S., Martin-Alonso, J.M., Boga, J.A., Casais, R., Humara, J.M., Ordas, R.J., Parra, F., 1999. Immunization with potato plants expressing VP60 protein protects against rabbit hemorrhagic disease virus. J. Virol. 73, 4452–4455. Chalghoumi, R., Marcq, C., Thewis, A., Portetelle, D., Beckers, Y., 2009b. Effects of feed supplementation with specific hen egg yolk antibody (immunoglobin Y) on Salmonella species cecal colonization and growth performances of challenged broiler chickens. Poult. Sci. 88, 2081–2092. Cheng, Y., Chen, Z., Li, C., Meng, C., Wu, R., Liu, G., 2013. Protective immune responses in rabbits induced by a suicidal DNA vaccine of the VP60 gene of rabbit hemorrhagic disease virus. Antiviral Res. 97, 227–231. Dai, Y.C., Zhang, X.F., Tan, M., Huang, P., Lei, W., Fang, H., Zhong, W., Jiang, X., 2012. A dual chicken IgY against rotavirus and norovirus. Antiviral Res. 97, 293–300. de Paula, V.S., da Silva Ados, S., de Vasconcelos, G.A., Iff, E.T., Silva, M.E., Kappel, L.A., Cruz, P.B., Pinto, M.A., 2011. Applied biotechnology for production of immunoglobulin Y specific to hepatitis A virus. J. Virol. Meth. 171, 102–106. Fernandez-Fernandez, M.R., Mourino, M., Rivera, J., Rodriguez, F., PlanaDuran, J., Garcia, J.A., 2001. Protection of rabbits against rabbit hemorrhagic disease virus by immunization with the VP60 protein expressed in plants with a potyvirusbased vector. Virology 280, 283–291. Fischer, L., Le Gros, F.X., Mason, P.W., Paoletti, E., 1997. A recombinant canarypox virus protects rabbits against a lethal rabbit hemorrhagic disease virus (RHDV) challenge. Vaccine 15, 90–96. Gil, F., Titarenko, E., Terrada, E., Arcalis, E., Escribano, J.M., 2006. Successful oral prime-immunization with VP60 from rabbit haemorrhagic disease virus produced in transgenic plants using different fusion strategies. Plant Biotechnol. 4, 135–143. Gregg, D.A., House, C., Meyer, R., Berninger, M., 1991. Viral haemorrhagic disease of rabbits in Mexico: epidemiology and viral characterization. Rev. Sci. Tech. Off. Int. Epiz. 10, 435–451. Gromadzka, B., Szewczyk, B., Konopa, G., Fitzner, A., Kesy, A., 2006. Recombinant VP60 in the form of virion-like particles as a potential vaccine against rabbit hemorrhagic disease virus. Acta Biochim. Pol. 53, 371–376. Keller, M.A., Stiehm, E.R., 2000. Passive immunity in prevention and treatment of infectious diseases. Clin. Microbiol. Rev. 13, 602–614. Liou, J.F., Chang, C.W., Tailiu, J.J., Yu, C.K., Lei, H.Y., Chen, L.R., Tai, C., 2010. Passive protection effect of chicken egg yolk immunoglobulins on enterovirus 71 infected mice. Vaccine 28, 8189–8196. Liu, S.J., Xue, H.P., Pu, B.Q., Qian, N.H., 1984. A new viral disease in rabbits. Animal Husbandry and Veterinary Medicine 16, 253–255. Martínez-Torrecuadrada, J.L., Cortés, E., Vela, C., Langeveld, J.P., Meloen, R.H., Dalsgaard, K., Hamilton, W.D., Casal, J.I., 1998. Antigenic structure of the capsid protein of rabbit haemorrhagic disease virus. J. Gen. Virol. 79 (Pt 8), 1901–1909. Mitro, S., Krauss, H., 1993. Rabbit hemorrhagic disease: a review with special reference to its epizootiology. Eur. J. Epidemiol. 9, 70–78. Nguyen, H.H., Tumpey, T.M., Park, H.J., Byun, Y.H., Tran, L.D., Nguyen, V.D., Kilgore, P.E., Czerkinsky, C., Katz, J.M., Seong, B.L., Song, J.M., Kim, Y.B., Do, H.T., Nguyen, T., Nguyen, C.V., 2010. Prophylactic and therapeutic efficacy of avian antibodies against influenza virus H5N1 and H1N1 in mice. PLoS ONE 5, e10152. Omar, F., Oscar, B., Francisco, P., Jose Manuel, M.A., Odaysa, V., Marisdania, J., Leonor, N., Paula, N., Ricardo, L., 2005. High-level expression and immunogenic properties of the recombinant rabbit hemorrhagic disease virus VP60 capsid protein obtained in Pichia pastoris. J. Biotechnol. 117, 215–224. Parra, F., Boga, J.A., Marin, M.S., Casais, R., 1993. The amino terminal sequence of VP60 fromrabbit hemorrhagic disease virus supports its putative subgenomic origin. Virus Res. 27, 219–228. Parra, F., Prieto, M., 1990. Purification of a calicivirus as the causative agent of a lethal hemorrhagic disease in rabbits. J. Virol. 64, 4013–4015. Perez-Filgueira, D.M., Resino-Talavan, P., Cubillos, C., Angulo, I., Barderas, M.G., Barcena, J., Escribano, J.M., 2007. Development of a low-cost, insect larvae derived recombinant subunit vaccine against RHDV. Virology 364, 422–430. Russell, M.W., Mestecky, J., Julian, B.A., Galla, J.H., 1986. IgA-associated renal diseases: antibodies to environmental antigens in sera and deposition of immunoglobulins and antigens in glomeruli. J. Clin. Immunol. 6, 74–86.
104
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
Schirrmeier, H., Reimann, I., llner, K., Granzow, B.H., 1999. Pathogenic, antigenic and molecular properties of rabbit haemorrhagic disease virus (RHDV) isolated from vaccinated rabbits: detection and characterization of antigenic variants. Arch. Virol. 144, 719–735. Toledo, M., Seoane, G., Serrano, E., Encinosa, A., Delgado, C., Gonza lez, S., Percedo, M.E., Cha vez, P.R., Mesejo, V., Fregel, N., Crombet, H., Dı azMulet, E., Brook, M., Cruz, E., 1995. Estudio epizootiolo gicoy control de la enfermedad hemorra gica viral del conejo en la Repu blica de Cuba. Rvta. Cub. Cienc. Vet. 24, 5–9. Vega, C., Bok, M., Chacana, P., Saif, L., Fernandez, F., Parreno, V., 2011. Egg yolk IgY: protection against rotavirus induced diarrhea and modulatory effect on the systemic and mucosal antibody responses in newborn calves. Vet. Immunol. Immunopathol. 142, 156–169. Viaplana, E., Plana, J., Villaverde, A., 1997. Antigenicity of VP60 structural protein of rabbit haemorrhagic disease virus. Arch. Virol 142, 1843–1848.
Wallach, M.G., Webby, R.J., Islam, F., Walkden-Brown, S., Emmoth, E., Feinstein, R., Gronvik, K.O., 2011. Cross-protection of chicken immunoglobulin Y antibodies against H5N1 and H1N1 viruses passively administered in mice. Clin. Vaccine Immunol. 18, 1083–1090. Walsh Jr., W.E., Anderson, B.E., Ivancic, D., Zhang, Z., Piccini, J.P., Rodgers, T.G., Pao, W., Fryer, J.P., 2000. Distribution of, and immune response to, chicken anti-alpha Gal immunoglobulin Y antibodies in wild-type and alpha Gal knockout mice. Immunology 101, 467–473. Warr, G.W., Magor, K.E., Higgins, D.A., 1995. IgY: clues to the origins of modern antibodies. Immunol. Today 16, 392–398. Wen, J., Zhao, S., He, D., Yang, Y., Li, Y., Zhu, S., 2012. Preparation and characterization of egg yolk immunoglobulin Y specific to influenza B virus. Antiviral Res. 93, 154–159. Xu, Y., Li, X., Jin, L., Zhen, Y., Lu, Y., Li, S., You, J., Wang, L., 2011. Application of chicken egg yolk immunoglobulins in the control of terrestrial and aquatic animal diseases: a review. Biotechnol. Adv. 29, 860–868.
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Research paper
Egg yolk IgY against RHDV capsid protein VP60 promotes rabbit defense against RHDV infection Li Zai Xin, Hu Wei Dong, Li Bing Chao, Li Tian You, Zhou Xiao Yang, Zhang Zhi ∗ Key Laboratory of Pharmaceutical Engineering Technology and Application, School of Chemical and Pharmaceutical Engineering, Sichuan University of Science and Engineering, Zigong 643000, China
a r t i c l e
i n f o
Article history: Received 16 May 2013 Received in revised form 26 September 2013 Accepted 8 October 2013 Keywords: Rabbit hemorrhagic disease virus (RHDV) Egg yolk antibody (IgY) VP60 capsid protein
a b s t r a c t VP60 capsid protein is the major structural and immunogenicity protein of RHDV (Rabbit hemorrhagic disease virus, RHDV), and has been implicated as a main protein antigen in RHDV diagnosis and vaccine design. In this report, egg yolk antibody (IgY) against Nterminal of VP60 was evaluated and developed as a new strategy for RHDV therapy. Briefly, N-terminal of VP60 (∼250aa) fragment was cloned and inserted into pET28a expression vector, and then the resultant plasmid, pET28a/VP60-N, was transformed into E. coli BL21(DE3) for recombinant VP60-N protein (rVP60-N) expression. Next, the rVP60-N was purified by Ni+ -affinity purification chromatography and identified by Western blotting with RHDV antiserum. After immunizing the chickens with rVP60-N, the anti-rVP60-N IgY was isolated, and the activity and specificity of the IgY antibody were analyzed by ELISA and Western blotting. In our results, the rVP60-N could be expressed in E. coli as soluble fraction, and the isolated anti-rVP60-N IgY demonstrated a high specificity and titer (1:22,000) against rVP60-N antigen. For further evaluation of the IgY efficacy in vivo, rabbits were grouped randomly and challenged with RHDV, and the results showed that anti-rVP60-N IgY could significantly protect rabbits from virus infection and promote the host survival after a sustained treatment with anti-rVP60-N IgY for 5 days. Taken together, our study demonstrates evidence that production of IgY against VP60 could be as a novel strategy for the RHDV therapy. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Rabbit hemorrhagic disease (RHD) is highly contagious and has been characterized as high morbidity and mortality in adult rabbits (Schirrmeier et al., 1999; Liu et al., 1984). The disease was first discovered in China in (Liu et al., 1984) and soon spread worldwide (Gregg et al., 1991; Mitro and Krauss, 1993; Toledo et al., 1995; Bouslama et al., 1996; Embury-Hyatt et al., 2012). The etiological agent is a single-stranded positive-sense RNA virus from the family of Caliciviridae named rabbit hemorrhagic disease virus (RHDV) (Parra and Prieto,
∗ Corresponding author. Tel.: +81 3 5505605; fax: +81 3 5505605. E-mail address: [email protected] (Z. Zhang). 0165-2427/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetimm.2013.10.002
1990). The virions are non-enveloped and icosahedral calicivirus, and genome of which has two open reading frames (ORFs), including ORF1 and ORF2. ORF1 encodes a polyprotein that is cleaved into non-structural components and the major structural protein, the capsid protein VP60 (Parra et al., 1993), which is the main target of the host immune defense against RHDV and plays an important role in virus diagnosis and vaccine design. In the past years, the capsid protein VP60 has been successfully expressed in several heterologous systems and shown to induce full protection of rabbits against a lethal challenge with RHDV (Bertagnoli et al., 1996a,b; Fischer et al., 1997; Castanon et al., 1999; Fernandez-Fernandez et al., 2001; Perez-Filgueira et al., 2007). And also, the antigenic structure of VP60 has been well analyzed by using anti-RHDV monoclonal antibodies (mAbs) and anti-RHDV
98
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
serum respectively, suggesting that the N-terminal of VP60 (1-250aa) is the most antigenic region (Viaplana et al., 1997; Martínez-Torrecuadrada et al., 1998). Antibody-based passive immunization is effective in prevention and treatment of infectious diseases (Keller and Stiehm, 2000), in which the availability of large amount of specific antibodies is the key. Immunoglobulin Y (IgY), the egg yolk antibodies generated as a passive immunity to embryos and baby chicks, can be a good source of such antibody. IgY can be easily produced and purified with high yields from egg yolks of immunized hens by variable methods, which has been used as a safe and inexpensive strategy to control and prevent bacterial and viral infections in domestic farm animals (Chalghoumi et al., 2009b; Vega et al., 2011). However, the possibility of using IgY to treat against RHDV infection in rabbits in vivo has not yet been studied. In present study, we generated a large amount of antiVP60 polyclonal IgY by using the recombinant N-terminal of VP60 (1–250 aa) as antigen. We successfully produced high titers of specific IgY in egg yolks from immunized chickens and showed neutralizing activity of IgY on RHDV in vivo. Our results provide solid evidence that production of IgY could be used as a novel strategy for therapeutic treatments against RHDV. 2. Material and methods 2.1. Materials The pTNTTM vector containing a full-length RHDV VP60 gene was kindly provided by Prof. Guangqing Liu (Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Shanghai, China). RHDV LQ, a virulent strain of RHDV, and antiserum against RHDV were obtained as a gift from SICHUAN HUAPAI BIO-PHARMACEUTICAL CO.,LTD. 2.2. Amplification of VP60-N The N-terminal of VP60 (VP60-N) was amplified by PCR with forward primer VP60-N-F (5 CCGGAATTCATGGAGGGCAAAGCCCGCA-3 ) and reverse primer VP60-N-R (5 - CCGCTCGAGATTGCCAACACCAGTGA3 ), which contained EcoR I and Xho I sites respectively. Next, the PCR product was cloned into the dephosphorylated EcoR I and Xho I sites of pET28a (Novagen, USA), and the resultant plasmid named pET28a/VP60-N. The recombinant plasmid was confirmed by sequence analysis. 2.3. Preparation of VP60-N antigens pET28a/VP60-N plasmid was transformed into E. coli BL21(DE3), and the recombinant VP60-N (rVP60-N) was expressed with an induction of 0.5 mM IPTG (Merch, Germany) at 25 ◦ C overnight. Next, the His-tagged rVP60N fusion proteins were purified by using Ni+ -affinity purification chromatography column according to the manufacturer’s instructions (Novagen, USA). The protein concentration was determined by using the Bradford Protein Assay, and 200 g of rVP60-N antigens in 300 L of
phosphate buffered saline (PBS) were used for i.m immunization. 2.4. Chickens and immunization Six-week old Leghorn chickens were housed in individual cages under a regimen of 12 h of light and 12 h of darkness, at room temperature (23 ± 2 ◦ C) and humidity of 75 ± 5%. Water and commercial chicken food were offered daily. The chickens were immunized intramuscularly with rVP60-N protein mixed with Freund’s adjuvant (Sigma, USA) at different sites of the breast at 21 weeks old. Three hundred microlitre of protein solution (containing 200 g rVP60-N) were emulsified with an equal volume of complete Freund’s adjuvant for the first immunization. Two booster immunizations were followed up using incomplete Freund’s adjuvant (Sigma, USA) with four weeks interval with 100 g of rVP60-N antigens. Eggs were collected daily, marked and stored at 4 ◦ C before being processed for IgY. 2.5. IgY antibody purification IgY antibody was extracted and purified from egg yolks using water-dilution method as described before (Akita and Nakai, 1993) with modifications. Briefly, 10 mL egg yolk was diluted 8-fold in deionized ultrapure water adjusted to pH 5.0–5.2 with 1N HCl and homogenized thoroughly. After vortex, the sample mixtures were centrifuged at 12,000 × g for 20 min at 4 ◦ C to remove the lipid-rich precipitate. The supernatant, consisting of lipid-free fraction, was collected and precipitated with the addition of 40% ammonium sulfate (w/v). After centrifugation (12,000 × g, 20 min, 4 ◦ C), the pellet, the IgY enriched fraction, was dissolved in 10 mL PBS. To eliminate residual salt, the isolated IgY was further purified by ultrafiltration using Millipore Amicon Ultra15 (100 kD) according to the manufacturer’s instructions (Millipore, USA). The final IgY retentate was dissolved in 10.0 mL PBS and stored at −20 ◦ C. The purity and quantity of the isolated IgY antibody were determined by SDS-PAGE and Bradford Protein Assay respectively. 2.6. Detection of rVP60-N specific IgY in yolks by enzymelinked immunosorbent assay (ELISA) Specific activity of IgY antibody against rVP60-N protein was determined by ELISA. Briefly, a 96-well microtiter plate was coated with 100 L of rVP60-N antigen (5 g/mL) at 4 ◦ C overnight. After washing three times with PBS containing 0.05% (v/v) Tween 20 (PBST), the nonspecific binding sites were blocked with 3% (w/v) BSA in PBS for 2 h at 37 ◦ C. After three times washing, 100 L of a serially diluted IgY antibody in PBST was added to the wells as the primary antibody and then incubated for 3 h at room temperature or 4 ◦ C overnight. The plate was washed again and the bound antibody was then incubated with 100 L of goat antichicken IgY–HRP (1:5000) (Sigma, USA) for 1.5 h at room temperature. Finally, the HRP activity was detected by adding 100 L of TMB substrate reagent (BEYOTIME, China) to each well for 15–30 min at room temperature, and then the reaction were stopped by adding 50 L of 2 M H2 SO4 to the wells. The optical density (OD) was read at 450 nm on
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
99
microtiter plate reader. Antigen-specific IgY antibody titers were defined as the endpoint dilution with a cut off signal intensity of OD450 value at 0.2. Pre-immunized chicken yolk IgY was used as negative control. 2.7. Characterization of IgY by Western-blot analysis assay Specificity of the purified IgY against rVP60-N protein was examined by Western-blot analysis. Briefly, the purified rVP60-N protein was separated using 12% SDS-PAGE and transferred onto a nitrocellulose (NC) membrane (Millipore, USA) using a semi-dry transfer Western blotting apparatus (Bio-Rad, USA). The membrane was blocked with 3% (w/v) BSA (Sangon, China) for 2 h and then incubated with IgY antibody (1:1000) and anti-RHDV serum (1:1000) respectively for 2 h at room temperature. After washing three times with PBST, HRP-conjugated goat-anti-chicken antibody diluted in PBST (1:5000) was added and incubated for 1 h at room temperature. The membrane was washed and detected with Western blotting detection reagents (TMB horseradish peroxidase color development solution for Blotting, BEYOTIME, China). 2.8. Dot blot analysis of anti-rVP60-N IgY For dot blot, virus infected (RHDV) and healthy rabbit liver tissues were extracted in PBS buffer, subsequent dilutions of the lysate were made in PBS buffer and blotted onto 0.22-m nitrocellulose membrane. After blocking with 3% BSA, the membrane was incubated with anti-rVP60-N IgY at 1:1000 for 2 h at room temperature. The following procedure to stain was the same as described for Western blotting. 2.9. Virulent challenge and IgY treatment 3-Month-old New Zealand White rabbits, free from anti-RHDV antibodies, were obtained from the Laboratory Animal Center of Sichuan University, China, and randomly assigned to four groups and housed in separate rooms. To test the inhibition of IgY against RHDV infection in vivo, the rabbits were challenged through subcutaneous injection with 10 times LD50 RHDV LQ strain. For pre-treated group (prophylactic group), the rabbits were pre-treated with anti-rVP60-N IgY through i.v injection at a dose of 10 mg/kg before RHDV challenge 2 h, and then received a same IgY treatment for 5 days at once a day. For posttreated group (therapeutic group), after RHDV challenge 12 h, the rabbits received a treatment with anti-rVP60N IgY through i.v injection at a dose of 10 mg/kg once a day, and the treatment continued for 5 days. As control, post RHDV infection 12 h, rabbits received PBS (PBS control group) or negative IgY (control IgY group) only through i.v injection once a day, and the treatment continued for 5 days. Rabbits were observed twice a day and any mortality was recorded. Dead rabbits were necropsied immediately, whereas the surviving rabbits in each group were euthanized. The liver tissues were collected and stored at −80 ◦ C. The experiment was repeated three times.
Fig. 1. PCR amplification of N-terminal of VP60 (named VP60-N). (A) PCR product of VP60-N fragment about 750 bp. Line M, DL2000 DNA marker; Line 1, PCR product. (B) Identification of pET28a-VP60-N reconlbinant plasmid by digestion with EcoR I and Xho I. Line M, DL2000 DNA marker; Line 1, digestion product.
2.10. Semi-quantitative RT-PCR For the detection and quantification of viral RNA in the experimental rabbits, the total RNA was extracted from the liver tissues of experimental rabbits using the TRIZOL reagent (Invitrogen, USA) according to the manufacturer’s instructions. RHDV RNA copies in the samples were detected by semi-quantitative RT-PCR. The forward primer, 5 -TGGAGGGCAAAGCCCGCA-3 , and the reverse primer 5 -GATTGCCAACACCAGTGA-3 . PCR was carried out under the conditions of 94 ◦ C for 3 min followed by 26 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 30 s, and a final elongation at 72 ◦ C for 5 min. PCR products were analyzed with 1% agarose gel electrophoresis containing ethidium bromide. Then the bands of PCR products were quantified by densitometry using Bandscan software and normalized with its -actin. 2.11. Statistical analysis To evaluate the antibody ELISA responses and the protective immune responses among the different groups, the mean values from all groups were compared with student’s t-test using SPSS v.12.0 software. P-values of 24 h
100 100 0 70
10 10 0 0
100% 100% 0 0
RHD, rabbit hemorrhagic disease.
102
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
Fig. 5. Protection against RHDV challenge with anti-rVP60-N IgY. Ten times LD50 of RHDV LQ strain was administered by subcutaneous injection and 2 mL of IgY or PBS were given i.v. at doses of 10 mg/kg for treatment as described. Rabbits were observed twice a day and any mortality was recorded. The values are the mean of 10 rabbits in each group. Mortality is expressed as % of rabbits that survived after the lethal infection (A). (B) Viral RNA in the liver tissue were detected and analyzed by semi-quantitative RT-PCR assay (above), PCR products was quantified by densitometry using Bandscan software and normalized with its -actin (below). Line 1–2, PBS control group; Line 3–4, control IgY; Line 5–6, antirVP60-N IgY therapeutic group; Line 7–8, anti-rVP60-N IgY pre-treated group. n = 4. *p < 0.05, **p < 0.01 in comparison with PBS control.
effective strategies against its etiological agent, RHDV. Unfortunately, the lack of an efficient in vitro propagation system for RHDV has hindered the production of the virus as a source of vaccine antigens. Currently, vaccines are produced by the chemical inactivation of crude virus preparations obtained from the organs of infected rabbits. This strategy raises serious concerns about biological safety, contaminant residues and animal welfare (Omar et al., 2005). The capsid protein (VP60) is the major structural and immunogenicity protein of RHDV, and has been developed as a key target of RHDV vaccine design. Therefore, with the aim of constructing a scalable recombinant vaccine, several approaches have been tried and used to produce recombinant versions of VP60, including bacteria, yeasts, plants, poxvirus-based vectors, insect cells and DNA vaccine. These studies have shown induction of a protective immune response against RHDV challenge
(Bertagnoli et al., 1996a,b; Barcena et al., 2000; Gil et al., 2006; Gromadzka et al., 2006; Cheng et al., 2013). However, these systems have problems, such as a relatively low level of expression, or have limitations related to the environmental release of genetically modified organisms. The antigenic structure of the capsid protein VP60 of RHDV has been well analyzed and showed that the N-terminal of VP60 contains the most antigenic region of VP60 (Viaplana et al., 1997; Martínez-Torrecuadrada et al., 1998). In the present study, N-terminal of VP60 (VP60-N) instead of VP60 full protein was used as antigens to immune laying hens, and the protection efficacy of anti-rVP60-N IgY were studied in vivo. In our system, rVP60-N could be mainly expressed in soluble fraction under 20 ◦ C–30 ◦ C. Also, rVP60-N could be well recognized by anti-RHDV serum and the isolated anti-rVP60-N IgY respectively (Figs. 3 and 4). After immunization with rVP60-N, we successfully produced a large amount of polyclonal IgY antibodies against rVP60-N using water-dilution method combined with ultrafiltration, and the titer of antirVP60-N IgY could reached up to 1:22,000 (Fig. 4). To further evaluate the effectiveness of anti-rVP60-N IgY against a lethal RHDV infection, the rabbits were challenged with a wild type RHDV strain, LQ in vivo. Rabbits from the control group displayed the clinical symptoms and typical lesions of the disease and died within 48–72 h, while from the IgY-treated group there was significant reduction in onset, duration and severity of the illness of RHD, and all survived from rabbits which received anti-VP60-N IgY treatment (Fig. 5). In addition, the rate of protection demonstrated a dose-dependent profile with protection rate reaching up to 100% at the 10 mg/kg IgY concentration (data not shown). And also, pre-treated RHDV with anti-VP60-N IgY could significantly protect rabbits form RHDV infection and promote the host survival. Combined with these data, our results suggested that anti-VP60-N IgY antibody-based passive immunization is effective in prevention and treatment of RHDV infectious diseases. However, there always be some potential drawbacks with using repeated injections of IgY antibodies raised in other species. Most importantly, IgY treatment could induced significant antibody response toward IgY because of immunogenicity, and the IgY activity could be attenuated by anti-IgY Abs mediated neutrolization and phagocytosis. Several groups have reported the presence of anti-IgY antibodies in sera of humans and animals (Russell et al., 1986; Walsh et al., 2000; Nguyen et al., 2010). Interestingly, it was observed that the pre-existing anti-IgY Abs did not interfere with the protective effectiveness of pathogenspecific IgY (Nguyen et al., 2010), and the half-lives of IgY could reach up to 3.0 days and effectively protects host from lethal virus challenge in vivo (Brocato et al., 2012). In this study, after RHDV challenge, the rabbits were adminstrated with anti-rVP60-N IgY once a day for 5 days. Although it is interesting to detect the level of anti-IgY Abs and the bioavailability of IgY in vivo, the fact that it is difficult to produce enough anti-IgY Abs after the first IgY injection in short times. In addition, the protection conferred by the anti-rVP60-N IgY, the mechanism possibly only contribute to the recognization of IgY and binding to the surface of RHDV, and then blocking the transmission and infection
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
of RHDV, because the majority of the Fc region of IgY is incompatible with the mammalian Fc receptors (Warr et al., 1995). In recent years, pathogen-specific IgY has attracted considerable attention as a means of controlling of infectious diseases of bacterial and viral origin. IgY possesses many advantages compared with mammalian IgG including efficacy, safety, cost-effectiveness, stablity and high yield, which making IgY an promising treatment to control infections of pathogens (Xu et al., 2011), while the usefulness of IgY is still underestimated. Recently, several studies have showed promising results on the possible prophylactic and therapeutic treatment against different viral infections, including EV71 (Liou et al., 2010), influenza A and B (Nguyen et al., 2010; Wallach et al., 2011; Wen et al., 2012), HAV (de Paula et al., 2011), NoV and RV infection (Dai et al., 2012). In present study, rabbits pre-treated with antirVP60-N IgY before RHDV challenge did not demonstrate any clinical symptoms of RHD, while others developed an obvious clinical symptoms within 24 h after RHDV challenge. Fortunately, these rabbits could be rescued when administrated with 10 mg/kg anti-rVP60-N IgY injection up to 5 days after RHDV challenge. Altogether, these studies strongly suggested that IgY technology could be used not only as a preventive strategy but also as a specific treatment against pathogens infection. Author disclosure statement No competing financial interests exist. Acknowledgments This work was supported by Sichuan Provincial Education Department Foundation of China (Nos. 08ZA086 and 12ZA266), Natural Science Foundation of Sichuan University of Science and Engineering (No. 2011RC16), National Innovation Foundation for college students (No. 201210622002) and Innovative Foundation Project for Students of Sichuan University of Science and Engineering. References Akita, E.M., Nakai, S., 1993. Comparation of four purification methods for the production of immunoglogulins from eggs laid by hens immunized with a enterotoxigenic Escherichia coli strain. J. Immunol. Meth. 164, 141–142. Barcena, J., Morales, M., Vazquez, B., Boga, J.A., Parra, F., Lucientes, J., PagesMantes, A., Sanchez-Vizcaino, J.M., Blasco, R.Y., Torres, J.M., 2000. Horizontal transmissible protection against myxomatosis and rabbit haemorrhagic disease by using a recombinant myxoma virus. J. Virol. 74, 1114–1123. Bouslama, A., De Mia, G.M., Hammami, S., Aouina, T., Soussi, H., Frescura, T., 1996. Identification of the rabbit haemorrhagic disease in Tunesia. Vet. Rec. 138, 108–110. Bertagnoli, S., Gelfi, J., LeGall, G., Boilletot, E., Vautherot, J.F., Rasschaert, D., Laurent, S., Petit, F., BoucrautBaralon, C., Milon, A., 1996a. Protection against myxomatosis and rabbit viral hemorrhagic disease with recombinant myxoma viruses expressing rabbit hemorrhagic disease virus capsid protein. J. Virol. 70, 5061–5066. Bertagnoli, S., Gelfi, J., Petit, F., Vautherot, J.F., Rasschaert, D., Laurent, S., LeGall, G., Boilletot, E., Chantal, J., BoucrautBaralon, C., 1996b. Protection of rabbits against rabbit viral haemorrhagic disease with a vaccinia-RHDV recombinant virus. Vaccine 14, 506–510. Brocato, R., Josleyn, M., Ballantyne, J., Vial, P., Hooper, J.W., 2012. DNA vaccine-generated duck polyclonal antibodies as a postexposure
103
prophylactic to prevent hantavirus pulmonary syndrome (HPS). PLoS ONE 7, e35996. Embury-Hyatt, C., Postey, R., Hisanaga, T., Burton, L., Hooper-McGrevy, K., McIntyre, L., Millar, K., Pasick, J., 2012. The first reported case of rabbit hemorrhagic disease in Canada. Can. Vet. J. 53, 998–1002. Castanon, S., Marin, M.S., Martin-Alonso, J.M., Boga, J.A., Casais, R., Humara, J.M., Ordas, R.J., Parra, F., 1999. Immunization with potato plants expressing VP60 protein protects against rabbit hemorrhagic disease virus. J. Virol. 73, 4452–4455. Chalghoumi, R., Marcq, C., Thewis, A., Portetelle, D., Beckers, Y., 2009b. Effects of feed supplementation with specific hen egg yolk antibody (immunoglobin Y) on Salmonella species cecal colonization and growth performances of challenged broiler chickens. Poult. Sci. 88, 2081–2092. Cheng, Y., Chen, Z., Li, C., Meng, C., Wu, R., Liu, G., 2013. Protective immune responses in rabbits induced by a suicidal DNA vaccine of the VP60 gene of rabbit hemorrhagic disease virus. Antiviral Res. 97, 227–231. Dai, Y.C., Zhang, X.F., Tan, M., Huang, P., Lei, W., Fang, H., Zhong, W., Jiang, X., 2012. A dual chicken IgY against rotavirus and norovirus. Antiviral Res. 97, 293–300. de Paula, V.S., da Silva Ados, S., de Vasconcelos, G.A., Iff, E.T., Silva, M.E., Kappel, L.A., Cruz, P.B., Pinto, M.A., 2011. Applied biotechnology for production of immunoglobulin Y specific to hepatitis A virus. J. Virol. Meth. 171, 102–106. Fernandez-Fernandez, M.R., Mourino, M., Rivera, J., Rodriguez, F., PlanaDuran, J., Garcia, J.A., 2001. Protection of rabbits against rabbit hemorrhagic disease virus by immunization with the VP60 protein expressed in plants with a potyvirusbased vector. Virology 280, 283–291. Fischer, L., Le Gros, F.X., Mason, P.W., Paoletti, E., 1997. A recombinant canarypox virus protects rabbits against a lethal rabbit hemorrhagic disease virus (RHDV) challenge. Vaccine 15, 90–96. Gil, F., Titarenko, E., Terrada, E., Arcalis, E., Escribano, J.M., 2006. Successful oral prime-immunization with VP60 from rabbit haemorrhagic disease virus produced in transgenic plants using different fusion strategies. Plant Biotechnol. 4, 135–143. Gregg, D.A., House, C., Meyer, R., Berninger, M., 1991. Viral haemorrhagic disease of rabbits in Mexico: epidemiology and viral characterization. Rev. Sci. Tech. Off. Int. Epiz. 10, 435–451. Gromadzka, B., Szewczyk, B., Konopa, G., Fitzner, A., Kesy, A., 2006. Recombinant VP60 in the form of virion-like particles as a potential vaccine against rabbit hemorrhagic disease virus. Acta Biochim. Pol. 53, 371–376. Keller, M.A., Stiehm, E.R., 2000. Passive immunity in prevention and treatment of infectious diseases. Clin. Microbiol. Rev. 13, 602–614. Liou, J.F., Chang, C.W., Tailiu, J.J., Yu, C.K., Lei, H.Y., Chen, L.R., Tai, C., 2010. Passive protection effect of chicken egg yolk immunoglobulins on enterovirus 71 infected mice. Vaccine 28, 8189–8196. Liu, S.J., Xue, H.P., Pu, B.Q., Qian, N.H., 1984. A new viral disease in rabbits. Animal Husbandry and Veterinary Medicine 16, 253–255. Martínez-Torrecuadrada, J.L., Cortés, E., Vela, C., Langeveld, J.P., Meloen, R.H., Dalsgaard, K., Hamilton, W.D., Casal, J.I., 1998. Antigenic structure of the capsid protein of rabbit haemorrhagic disease virus. J. Gen. Virol. 79 (Pt 8), 1901–1909. Mitro, S., Krauss, H., 1993. Rabbit hemorrhagic disease: a review with special reference to its epizootiology. Eur. J. Epidemiol. 9, 70–78. Nguyen, H.H., Tumpey, T.M., Park, H.J., Byun, Y.H., Tran, L.D., Nguyen, V.D., Kilgore, P.E., Czerkinsky, C., Katz, J.M., Seong, B.L., Song, J.M., Kim, Y.B., Do, H.T., Nguyen, T., Nguyen, C.V., 2010. Prophylactic and therapeutic efficacy of avian antibodies against influenza virus H5N1 and H1N1 in mice. PLoS ONE 5, e10152. Omar, F., Oscar, B., Francisco, P., Jose Manuel, M.A., Odaysa, V., Marisdania, J., Leonor, N., Paula, N., Ricardo, L., 2005. High-level expression and immunogenic properties of the recombinant rabbit hemorrhagic disease virus VP60 capsid protein obtained in Pichia pastoris. J. Biotechnol. 117, 215–224. Parra, F., Boga, J.A., Marin, M.S., Casais, R., 1993. The amino terminal sequence of VP60 fromrabbit hemorrhagic disease virus supports its putative subgenomic origin. Virus Res. 27, 219–228. Parra, F., Prieto, M., 1990. Purification of a calicivirus as the causative agent of a lethal hemorrhagic disease in rabbits. J. Virol. 64, 4013–4015. Perez-Filgueira, D.M., Resino-Talavan, P., Cubillos, C., Angulo, I., Barderas, M.G., Barcena, J., Escribano, J.M., 2007. Development of a low-cost, insect larvae derived recombinant subunit vaccine against RHDV. Virology 364, 422–430. Russell, M.W., Mestecky, J., Julian, B.A., Galla, J.H., 1986. IgA-associated renal diseases: antibodies to environmental antigens in sera and deposition of immunoglobulins and antigens in glomeruli. J. Clin. Immunol. 6, 74–86.
104
Z.X. Li et al. / Veterinary Immunology and Immunopathology 157 (2014) 97–104
Schirrmeier, H., Reimann, I., llner, K., Granzow, B.H., 1999. Pathogenic, antigenic and molecular properties of rabbit haemorrhagic disease virus (RHDV) isolated from vaccinated rabbits: detection and characterization of antigenic variants. Arch. Virol. 144, 719–735. Toledo, M., Seoane, G., Serrano, E., Encinosa, A., Delgado, C., Gonza lez, S., Percedo, M.E., Cha vez, P.R., Mesejo, V., Fregel, N., Crombet, H., Dı azMulet, E., Brook, M., Cruz, E., 1995. Estudio epizootiolo gicoy control de la enfermedad hemorra gica viral del conejo en la Repu blica de Cuba. Rvta. Cub. Cienc. Vet. 24, 5–9. Vega, C., Bok, M., Chacana, P., Saif, L., Fernandez, F., Parreno, V., 2011. Egg yolk IgY: protection against rotavirus induced diarrhea and modulatory effect on the systemic and mucosal antibody responses in newborn calves. Vet. Immunol. Immunopathol. 142, 156–169. Viaplana, E., Plana, J., Villaverde, A., 1997. Antigenicity of VP60 structural protein of rabbit haemorrhagic disease virus. Arch. Virol 142, 1843–1848.
Wallach, M.G., Webby, R.J., Islam, F., Walkden-Brown, S., Emmoth, E., Feinstein, R., Gronvik, K.O., 2011. Cross-protection of chicken immunoglobulin Y antibodies against H5N1 and H1N1 viruses passively administered in mice. Clin. Vaccine Immunol. 18, 1083–1090. Walsh Jr., W.E., Anderson, B.E., Ivancic, D., Zhang, Z., Piccini, J.P., Rodgers, T.G., Pao, W., Fryer, J.P., 2000. Distribution of, and immune response to, chicken anti-alpha Gal immunoglobulin Y antibodies in wild-type and alpha Gal knockout mice. Immunology 101, 467–473. Warr, G.W., Magor, K.E., Higgins, D.A., 1995. IgY: clues to the origins of modern antibodies. Immunol. Today 16, 392–398. Wen, J., Zhao, S., He, D., Yang, Y., Li, Y., Zhu, S., 2012. Preparation and characterization of egg yolk immunoglobulin Y specific to influenza B virus. Antiviral Res. 93, 154–159. Xu, Y., Li, X., Jin, L., Zhen, Y., Lu, Y., Li, S., You, J., Wang, L., 2011. Application of chicken egg yolk immunoglobulins in the control of terrestrial and aquatic animal diseases: a review. Biotechnol. Adv. 29, 860–868.
