Tumor Biol. DOI 10.1007/s13277-014-2022-x
RESEARCH ARTICLE
Eg5 inhibitor, a novel potent targeted therapy, induces cell apoptosis in renal cell carcinoma Sentai Ding & Zuohui Zhao & Dingqi Sun & Fei Wu & Dongbin Bi & Jiaju Lu & Naidong Xing & Liang Sun & Haihu Wu & Kejia Ding
Received: 10 January 2014 / Accepted: 27 April 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract Eg5 is critical for mitosis and overexpressed in various malignant tumors, which has now been identified as a promising target in cancer therapy. However, the anti-cancer activity of Eg5 inhibitor in renal cell carcinoma (RCC) remains an open issue. In this paper, we evaluated, for the first time, the therapeutic benefit of blocking Eg5 by S-(methoxytrityl)-L-cysteine (S(MeO)TLC) in RCC both in vitro and vivo. The expression of Eg5 was examined in clinical tissue samples and various kidney cell lines, including 293T, 786-0, and OS-RC-2. The anti-proliferative activity of Eg5 inhibitors, (S)-trityl-L-cysteine (STLC) and S(MeO)TLC, was evaluated by a cell viability assay. An apoptosis assay with Hoechst nuclear staining and flow cytometry was applied to investigate the efficacy of the S(MeO)TLC, which is more potent than STLC. Immunofluorescence was used to research the possible mechanism. Furthermore, in vivo studies were performed by using subcutaneous xenograft models, which were used to confirm its role as a potential anti-neoplastic drug. The Eg5 expression was detected in kidney cell lines and RCC tissues, which was low in normal kidney samples. STLC and S(MeO)TLC exhibited their optimal antiproliferative activity in 72 h, and cells treated with S(MeO)TLC presented characteristic monoastral spindle Sentai Ding and Zuohui Zhao contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s13277-014-2022-x) contains supplementary material, which is available to authorized users. S. Ding (*) : Z. Zhao : D. Sun : F. Wu : D. Bi : J. Lu : L. Sun : H. Wu : K. Ding Department of Urology, Shandong Provincial Hospital affiliated to Shandong University, Jinan 250021, Shandong, China e-mail: [email protected] N. Xing Department of Urology, Qilu Hospital of Shandong University, Jinan 250012, Shandong, China
phenotype in 24 h and apoptotic cells in 48 h. In vivo, S(MeO)TLC effectively suppressed tumor growth in subcutaneous xenograft models. Inhibition of Eg5 represses the proliferation of RCC in vitro and in vivo. All these findings collectively demonstrate that S(MeO)TLC, a potent Eg5 inhibitor, is a promising anti-cancer agent for the treatment of RCC. Keywords Eg5 . S(MeO)TLC . Renal cell carcinoma . Chemotherapy . Targeted therapy
Introduction Renal cell carcinoma (RCC) is the most common neoplasm of kidney among adults, which accounts for nearly 3 % of all new cancers diagnosed [1, 2]. RCC causes about 209,000 new cases and 102,000 deaths per year worldwide [3]. By far, the majority of RCCs with subtype further specified are of the clear cell type, which accounts for 70–80 % of all renal masses, followed by the papillary and chromophobe tumors. Partial and radical nephrectomies continue to be the standard treatment for patients with localized RCC [3]. However, about 25 to 30 % of RCC patients have metastasis when diagnosed, and a third of the patients who undergo nephrectomy will undergo a recurrence [4]. The prognosis for recurrent or metastatic disease is poor, with a 5-year survival rate of less than 10 % [5]. RCC has been proved resistant to chemotherapies and radiotherapy. Although several immunotherapies, including IFN-alpha-2a and interleukin-2, might improve the prognosis of the disease, the effects vary from person to person [6, 7]. Recently, targeted therapies are proved to be promising [8]. The first-line targeted agents such as sunitinib, bevacizumab, pazopanib, and temsirolimus have been used in patients with metastasis, several of which benefit from the therapy [9, 10], such as improved progression-free survival
Tumor Biol.
(PFS), overall survival (OS), or overall response rate (ORR) outcomes [11]. Since the targets of these agents were widely existent in malignant and normal tissues, the side effects were inevitable, including cardiac toxicity, fatigue, and gastrointestinal disorders [12]. In a word, all these approaches have limited effects in prognosis in spite of high costs and drug resistance. Therefore, the optimal solution for RCC patients remains to be investigated [11]. The mitotic kinesin Eg5, also known as kinesin-like spindle protein (KSP), is a member of the kinesin superfamily which travels unidirectionally along microtubule tracks to fulfill their roles in intracellular transport or cell division [13]. It plays a critical role in mitosis which mediates separation of centrosome and assembly of bipolar spindle [14]. Inhibition of Eg5 leads to arrest of cell cycle at mitosis with the formation of monoastral microtubule arrays and ultimately induces apoptosis or necrosis [15]. The expression of Eg5 has been found in most tumors, including pancreatic cancer [16], lung cancer [17], and RCC [18]. In addition, Eg5 is a predictor of unfavorable prognosis in RCC and urothelial carcinoma of bladder [18, 19] and also closely correlated with the response of chemical therapy in non-small cell lung cancer [17]. Therefore, Eg5 has been identified as a promising target for cancer therapies [20, 21]. Since the discovery of the first Eg5 inhibitor, monastrol [22], a large number of Eg5 inhibitors have been demonstrated to have anti-cancer efficacy, which can arrest proliferative cells at mitosis followed by apoptosis, without affecting interphase microtubule [23]. (S)-trityl-L-cysteine (STLC) was first identified as an effective Eg5 inhibitor in 2004 [24, 25]. It is important to note that STLC derivative, S-(methoxytrityl)-L cysteine (S(MeO)TLC), showed 10-fold more potent in anti-proliferative efficacy than STLC [26, 27]. In our previous study, S(MeO)TLC displayed its potent anti-cancer efficacy in prostate cancer and bladder cancer in vitro and in vivo [26, 27]. As Eg5 is overexpressed in clinical tumor tissues of RCC [18], we examined Eg5 expression in clear cell (cc)RCC cell lines and assessed the potent anti-cancer efficacy and possible mechanism of S(MeO)TLC both in vitro and in vivo.
Materials and methods Cells, clinical samples, and reagents Two RCC cell lines (786-0 and OS-RC-2) and a normal kidney cell line 293T (transfected with adeno and SV-40 viral DNA sequences) were purchased from cell bank of Chinese Academy of Science (Shanghai, China). The 293T, 786-0, and OS-RC-2 cells were cultured in DMEM, supplemented with 10 % fetal bovine serum. Twenty cases of pathologically confirmed ccRCC and corresponding adjacent kidney tissues were collected from
Shandong Provincial Hospital Affiliated to Shandong University from December 2011 to January 2013. There were 13 male and 7 female subjects, and according to Fuhrman nuclear grade, among the 20 cases, 4 were grade I, 9 were grade II, 4 grade III, and 3 were grade IV with TNM stages of I to III [28]. None of them had any systemic anti-tumor therapy before surgery treatment, and all samples were verified by two pathologies after the surgery. Kidney tissue samples were obtained with informed patient consent and approval of the hospital research ethics committee. The Eg5 inhibitors, STLC and S(MeO)TLC, were purchased from Bachem (Bubendorf, Switzerland) and were dissolved in dimethyl sulfoxide (DMSO). Antibody anti-Eg5 antibody (Rabbit, AKIN11) was bought from Cytoskeleton (USA), and anti-α-tubulin antibody (Mouse, 010M4813) was from Sigma-Aldrich (USA); IRDye 800CW conjugated goat anti-rabbit IgG and anti-mouse IgG were from LI-COR Biosciences (USA). PrimeScript reverse transcription (RT)PCR kit was purchased from TaKaRa (Japan). TRIzol was purchased from Invitrogen (USA). Western blotting and RT-PCR analysis Western blotting (WB) analysis was performed following standard protocols as described previously. Proteins were extracted by an extraction kit (Sangon Biotech, China) from 20 cases of ccRCC specimens matched with adjacent normal and adjacent renal tissues. Protein levels were measured by the Enhanced BCA Protein Assay Kit (Beyotime Biotechnology, China). Twenty ccRCC protein samples (100 μg each) with matched adjacent normal specimens were loaded respectively and separated by SDS-PAGE. Anti-Eg5 rabbit antibody (1:1,000) and anti-α-tubulin mouse antibody (1:10,000) were used as primary antibodies. WB was developed with florescence-conjugated secondary antibodies and visualized by LI-COR Odyssey infrared imaging system. To avoid heterogeneity, a low-grade pool sample was constructed by mixing four cases of Fuhrman grades I and II and a highgrade mixture of four cases of Fuhrman grades III and IV, respectively (two cases in each grade). Tubulin was served as loading control. Total RNA was extracted from 293T, 786-0, and OS-RC-2 cell pellets and eight clinical RCC specimens (each Fuhrman grade has two cases) with TRIzol reagents and then amplified by RT-PCR according to the manufacturer’s instructions, respectively. The RNA of a housekeeping gene, glyceraldehyde phosphate dehydrogenase (GAPDH), was used as an endogenous control. GAPDH and Eg5 primers were constructed by Primer 5 software and verified by DNA sequencing analysis. GAPDH (1,382 bp) primers were the following: forward 5-3: GATGCTGCGCCTGCGGTAGA, backward 5-3: TTGGTT GAGCACAGGGTAC; Eg5 (669 bp) primers were the following: forward 5-3: GTCGTTCCCACTCAGTTT,
Tumor Biol.
backward 3-5: TTGCAGGTCAGATTTACACT. PCR products were then electrophoresed in 1.0 % agarose gel and visualized by a transilluminator. The pixel intensity for each band was determined using the Gel Imaging System [29]. Cell viability assay Cell viability was performed with 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay following the treatment with Eg5 inhibitors [26]. Cells (2×103) were seeded in 96-well plates and incubated for 24 h. Then, STLC, S(MeO)TLC, and vehicle (DMSO) were added at the indicated concentration in triplicate wells. The cell viability was measured at 24, 48, and 72 h after treatment, respectively. The concentrations of 50 % cell growth inhibition (IC50) were calculated, and figures of inhibitors’ rates were drawn by SPSS17.0 software. Flow cytometry assay and Hoechst staining To elucidate the mechanism in which S(MeO)TLC exerts its anti-cancer activity on RCC cell line 786-0 cells, cell cycle distributions were analyzed quantitatively with flow cytometry, as previously described [26]. After administration of 0.6 μM S(MeO)TLC or vehicle for 24 to 48 h, 786-0 cells were stained by 7-amino-actinomycin D (BD Biosciences, San Diego, USA) and assessed by flow cytometry. At least 10,000 cells were harvested and assayed with a FACSCalibur flow cytometer and CellQuest software (BD Biosciences, USA). After administration with S(MeO)TLC or vector at the times above, 786-0 cells were stained with 1 mM Hoechst 33342 solution (Santa Cruz, Dallas, USA) to stain nuclei, followed by analyzing with a fluorescence microscope. The cells with typical condensation and fragmentation of nuclei were visualized and identified as apoptotic cells.
Shandong University. Six- to eight-week old female BALB/c nude mice were purchased from Vital River Company (Beijing, China) and were kept in a specific pathogen-free animal laboratory. For subcutaneous xenograft models, approximately 5 × 10 6 786-0 cells (suspended in100 μl PBS) were inoculated subcutaneously into both flanks per mouse, as described previously [30]. The tumor volume was calculated as follows: volume=width2 ×length / 2. When tumors were palpable and measurable (about 50 mm 3), 30 mice were randomly divided into three groups and treated once daily (5 days a week) by intraperitoneal injection with DMSO (vehicle control), 1 0 m g kg − 1 S ( M e O ) T LC , o r 20 mg kg−1 S(MeO)TLC for 5 days. Mice body weighs and tumor sizes were measured every other day. Twenty days after the first treatment, all mice were killed. Tumors were excised, weighed, formalin fixed, and hematoxylin and eosin (H&E) stained for histological analysis. Tumors from two mice in each group that were killed at 24 h after 5-day treatment with S(MeO)TLC or vehicle alone were also formalin fixed and analyzed histologically using H&E staining. Statistical analysis SPSS 17.0 software (SPSS Inc., Chicago, USA) was used for statistical analysis. P
RESEARCH ARTICLE
Eg5 inhibitor, a novel potent targeted therapy, induces cell apoptosis in renal cell carcinoma Sentai Ding & Zuohui Zhao & Dingqi Sun & Fei Wu & Dongbin Bi & Jiaju Lu & Naidong Xing & Liang Sun & Haihu Wu & Kejia Ding
Received: 10 January 2014 / Accepted: 27 April 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract Eg5 is critical for mitosis and overexpressed in various malignant tumors, which has now been identified as a promising target in cancer therapy. However, the anti-cancer activity of Eg5 inhibitor in renal cell carcinoma (RCC) remains an open issue. In this paper, we evaluated, for the first time, the therapeutic benefit of blocking Eg5 by S-(methoxytrityl)-L-cysteine (S(MeO)TLC) in RCC both in vitro and vivo. The expression of Eg5 was examined in clinical tissue samples and various kidney cell lines, including 293T, 786-0, and OS-RC-2. The anti-proliferative activity of Eg5 inhibitors, (S)-trityl-L-cysteine (STLC) and S(MeO)TLC, was evaluated by a cell viability assay. An apoptosis assay with Hoechst nuclear staining and flow cytometry was applied to investigate the efficacy of the S(MeO)TLC, which is more potent than STLC. Immunofluorescence was used to research the possible mechanism. Furthermore, in vivo studies were performed by using subcutaneous xenograft models, which were used to confirm its role as a potential anti-neoplastic drug. The Eg5 expression was detected in kidney cell lines and RCC tissues, which was low in normal kidney samples. STLC and S(MeO)TLC exhibited their optimal antiproliferative activity in 72 h, and cells treated with S(MeO)TLC presented characteristic monoastral spindle Sentai Ding and Zuohui Zhao contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s13277-014-2022-x) contains supplementary material, which is available to authorized users. S. Ding (*) : Z. Zhao : D. Sun : F. Wu : D. Bi : J. Lu : L. Sun : H. Wu : K. Ding Department of Urology, Shandong Provincial Hospital affiliated to Shandong University, Jinan 250021, Shandong, China e-mail: [email protected] N. Xing Department of Urology, Qilu Hospital of Shandong University, Jinan 250012, Shandong, China
phenotype in 24 h and apoptotic cells in 48 h. In vivo, S(MeO)TLC effectively suppressed tumor growth in subcutaneous xenograft models. Inhibition of Eg5 represses the proliferation of RCC in vitro and in vivo. All these findings collectively demonstrate that S(MeO)TLC, a potent Eg5 inhibitor, is a promising anti-cancer agent for the treatment of RCC. Keywords Eg5 . S(MeO)TLC . Renal cell carcinoma . Chemotherapy . Targeted therapy
Introduction Renal cell carcinoma (RCC) is the most common neoplasm of kidney among adults, which accounts for nearly 3 % of all new cancers diagnosed [1, 2]. RCC causes about 209,000 new cases and 102,000 deaths per year worldwide [3]. By far, the majority of RCCs with subtype further specified are of the clear cell type, which accounts for 70–80 % of all renal masses, followed by the papillary and chromophobe tumors. Partial and radical nephrectomies continue to be the standard treatment for patients with localized RCC [3]. However, about 25 to 30 % of RCC patients have metastasis when diagnosed, and a third of the patients who undergo nephrectomy will undergo a recurrence [4]. The prognosis for recurrent or metastatic disease is poor, with a 5-year survival rate of less than 10 % [5]. RCC has been proved resistant to chemotherapies and radiotherapy. Although several immunotherapies, including IFN-alpha-2a and interleukin-2, might improve the prognosis of the disease, the effects vary from person to person [6, 7]. Recently, targeted therapies are proved to be promising [8]. The first-line targeted agents such as sunitinib, bevacizumab, pazopanib, and temsirolimus have been used in patients with metastasis, several of which benefit from the therapy [9, 10], such as improved progression-free survival
Tumor Biol.
(PFS), overall survival (OS), or overall response rate (ORR) outcomes [11]. Since the targets of these agents were widely existent in malignant and normal tissues, the side effects were inevitable, including cardiac toxicity, fatigue, and gastrointestinal disorders [12]. In a word, all these approaches have limited effects in prognosis in spite of high costs and drug resistance. Therefore, the optimal solution for RCC patients remains to be investigated [11]. The mitotic kinesin Eg5, also known as kinesin-like spindle protein (KSP), is a member of the kinesin superfamily which travels unidirectionally along microtubule tracks to fulfill their roles in intracellular transport or cell division [13]. It plays a critical role in mitosis which mediates separation of centrosome and assembly of bipolar spindle [14]. Inhibition of Eg5 leads to arrest of cell cycle at mitosis with the formation of monoastral microtubule arrays and ultimately induces apoptosis or necrosis [15]. The expression of Eg5 has been found in most tumors, including pancreatic cancer [16], lung cancer [17], and RCC [18]. In addition, Eg5 is a predictor of unfavorable prognosis in RCC and urothelial carcinoma of bladder [18, 19] and also closely correlated with the response of chemical therapy in non-small cell lung cancer [17]. Therefore, Eg5 has been identified as a promising target for cancer therapies [20, 21]. Since the discovery of the first Eg5 inhibitor, monastrol [22], a large number of Eg5 inhibitors have been demonstrated to have anti-cancer efficacy, which can arrest proliferative cells at mitosis followed by apoptosis, without affecting interphase microtubule [23]. (S)-trityl-L-cysteine (STLC) was first identified as an effective Eg5 inhibitor in 2004 [24, 25]. It is important to note that STLC derivative, S-(methoxytrityl)-L cysteine (S(MeO)TLC), showed 10-fold more potent in anti-proliferative efficacy than STLC [26, 27]. In our previous study, S(MeO)TLC displayed its potent anti-cancer efficacy in prostate cancer and bladder cancer in vitro and in vivo [26, 27]. As Eg5 is overexpressed in clinical tumor tissues of RCC [18], we examined Eg5 expression in clear cell (cc)RCC cell lines and assessed the potent anti-cancer efficacy and possible mechanism of S(MeO)TLC both in vitro and in vivo.
Materials and methods Cells, clinical samples, and reagents Two RCC cell lines (786-0 and OS-RC-2) and a normal kidney cell line 293T (transfected with adeno and SV-40 viral DNA sequences) were purchased from cell bank of Chinese Academy of Science (Shanghai, China). The 293T, 786-0, and OS-RC-2 cells were cultured in DMEM, supplemented with 10 % fetal bovine serum. Twenty cases of pathologically confirmed ccRCC and corresponding adjacent kidney tissues were collected from
Shandong Provincial Hospital Affiliated to Shandong University from December 2011 to January 2013. There were 13 male and 7 female subjects, and according to Fuhrman nuclear grade, among the 20 cases, 4 were grade I, 9 were grade II, 4 grade III, and 3 were grade IV with TNM stages of I to III [28]. None of them had any systemic anti-tumor therapy before surgery treatment, and all samples were verified by two pathologies after the surgery. Kidney tissue samples were obtained with informed patient consent and approval of the hospital research ethics committee. The Eg5 inhibitors, STLC and S(MeO)TLC, were purchased from Bachem (Bubendorf, Switzerland) and were dissolved in dimethyl sulfoxide (DMSO). Antibody anti-Eg5 antibody (Rabbit, AKIN11) was bought from Cytoskeleton (USA), and anti-α-tubulin antibody (Mouse, 010M4813) was from Sigma-Aldrich (USA); IRDye 800CW conjugated goat anti-rabbit IgG and anti-mouse IgG were from LI-COR Biosciences (USA). PrimeScript reverse transcription (RT)PCR kit was purchased from TaKaRa (Japan). TRIzol was purchased from Invitrogen (USA). Western blotting and RT-PCR analysis Western blotting (WB) analysis was performed following standard protocols as described previously. Proteins were extracted by an extraction kit (Sangon Biotech, China) from 20 cases of ccRCC specimens matched with adjacent normal and adjacent renal tissues. Protein levels were measured by the Enhanced BCA Protein Assay Kit (Beyotime Biotechnology, China). Twenty ccRCC protein samples (100 μg each) with matched adjacent normal specimens were loaded respectively and separated by SDS-PAGE. Anti-Eg5 rabbit antibody (1:1,000) and anti-α-tubulin mouse antibody (1:10,000) were used as primary antibodies. WB was developed with florescence-conjugated secondary antibodies and visualized by LI-COR Odyssey infrared imaging system. To avoid heterogeneity, a low-grade pool sample was constructed by mixing four cases of Fuhrman grades I and II and a highgrade mixture of four cases of Fuhrman grades III and IV, respectively (two cases in each grade). Tubulin was served as loading control. Total RNA was extracted from 293T, 786-0, and OS-RC-2 cell pellets and eight clinical RCC specimens (each Fuhrman grade has two cases) with TRIzol reagents and then amplified by RT-PCR according to the manufacturer’s instructions, respectively. The RNA of a housekeeping gene, glyceraldehyde phosphate dehydrogenase (GAPDH), was used as an endogenous control. GAPDH and Eg5 primers were constructed by Primer 5 software and verified by DNA sequencing analysis. GAPDH (1,382 bp) primers were the following: forward 5-3: GATGCTGCGCCTGCGGTAGA, backward 5-3: TTGGTT GAGCACAGGGTAC; Eg5 (669 bp) primers were the following: forward 5-3: GTCGTTCCCACTCAGTTT,
Tumor Biol.
backward 3-5: TTGCAGGTCAGATTTACACT. PCR products were then electrophoresed in 1.0 % agarose gel and visualized by a transilluminator. The pixel intensity for each band was determined using the Gel Imaging System [29]. Cell viability assay Cell viability was performed with 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay following the treatment with Eg5 inhibitors [26]. Cells (2×103) were seeded in 96-well plates and incubated for 24 h. Then, STLC, S(MeO)TLC, and vehicle (DMSO) were added at the indicated concentration in triplicate wells. The cell viability was measured at 24, 48, and 72 h after treatment, respectively. The concentrations of 50 % cell growth inhibition (IC50) were calculated, and figures of inhibitors’ rates were drawn by SPSS17.0 software. Flow cytometry assay and Hoechst staining To elucidate the mechanism in which S(MeO)TLC exerts its anti-cancer activity on RCC cell line 786-0 cells, cell cycle distributions were analyzed quantitatively with flow cytometry, as previously described [26]. After administration of 0.6 μM S(MeO)TLC or vehicle for 24 to 48 h, 786-0 cells were stained by 7-amino-actinomycin D (BD Biosciences, San Diego, USA) and assessed by flow cytometry. At least 10,000 cells were harvested and assayed with a FACSCalibur flow cytometer and CellQuest software (BD Biosciences, USA). After administration with S(MeO)TLC or vector at the times above, 786-0 cells were stained with 1 mM Hoechst 33342 solution (Santa Cruz, Dallas, USA) to stain nuclei, followed by analyzing with a fluorescence microscope. The cells with typical condensation and fragmentation of nuclei were visualized and identified as apoptotic cells.
Shandong University. Six- to eight-week old female BALB/c nude mice were purchased from Vital River Company (Beijing, China) and were kept in a specific pathogen-free animal laboratory. For subcutaneous xenograft models, approximately 5 × 10 6 786-0 cells (suspended in100 μl PBS) were inoculated subcutaneously into both flanks per mouse, as described previously [30]. The tumor volume was calculated as follows: volume=width2 ×length / 2. When tumors were palpable and measurable (about 50 mm 3), 30 mice were randomly divided into three groups and treated once daily (5 days a week) by intraperitoneal injection with DMSO (vehicle control), 1 0 m g kg − 1 S ( M e O ) T LC , o r 20 mg kg−1 S(MeO)TLC for 5 days. Mice body weighs and tumor sizes were measured every other day. Twenty days after the first treatment, all mice were killed. Tumors were excised, weighed, formalin fixed, and hematoxylin and eosin (H&E) stained for histological analysis. Tumors from two mice in each group that were killed at 24 h after 5-day treatment with S(MeO)TLC or vehicle alone were also formalin fixed and analyzed histologically using H&E staining. Statistical analysis SPSS 17.0 software (SPSS Inc., Chicago, USA) was used for statistical analysis. P
