MIMET-04386; No of Pages 6 Journal of Microbiological Methods xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
3Q1
Sha Xu a,b, Zhengxiong Zhou a, Guocheng Du a,b, Jingwen Zhou a,b,⁎, Jian Chen a,b
O
4 5
a
6
a r t i c l e
7 8 9 10 11
Article history: Received 7 April 2014 Received in revised form 23 May 2014 Accepted 24 May 2014 Available online xxxx
12 13 14 15 16 17 18 30
Keywords: Fungi Transformation Rhizopus oryzae Fumaric acid Lactic acid Colony formation
i n f o
R O
School of Biotechnology and Key Laboratory of Industrial Biotechnology, Ministry of Education, Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China Synergetic Innovation Center of Food Safety and Nutrition, 1800 Lihu Road, Wuxi, Jiangsu 214122, China
a b s t r a c t
E
D
P
High efficient transformation of mycelial fungi is essential to both metabolic engineering and physiological analysis of these industrially important microorganisms. However, transformation efficiencies for mycelial fungi are highly restricted by difficulties in colony formation and competent cell preparation. In this work, an innovative transformation procedure that could significantly improve the efficiency of colony formation and transformation process has been established for a typical mycelial fungus, Rhizopus delemar. Single colonies of R. delemar were obtained with the addition of sodium deoxycholate. Fresh germinated spores of R. delemar were successfully transformed by electroporation. In addition, by pretreatment of the germinated spores with 0.05 M lithium acetate (LiAc) and 20 mM dithiothreitol (DTT) before electroporation, the transformation efficiency was further improved by 9.5-fold. The final transformation efficiency at optimal conditions reached 1239 transformants/μg DNA. The method described here would facilitate more efficient metabolic engineering and investigation of physiological functions in R. delemar or other similar mycelial fungi. © 2014 Published by Elsevier B.V.
T
b
C
34 32 31 33
1. Introduction
36
Mycelial fungi are a large group of eukaryotic microorganisms. They can be used for the production of many kinds of important products, such as citric acid (Ali, 2006), fumaric acid (Zhou et al., 2011), enzymes (Ike et al., 2010), vitamins (Park et al., 2011), and other useful platform chemicals (Meussen et al., 2012). Metabolic engineering of these mycelial fungi is one of the most promising routes to further expand their industrial applications (de Oliveira and de Graaff, 2011; Poma et al., 2006). High efficient transformation of mycelial fungi is essential for both metabolic engineering and physiological analysis of these industrially important microorganisms (Park and Lee, 2013). However, transformation efficiencies for mycelial fungi are highly restricted by difficulties in colony formation and competent cell preparation. Fumaric acid is an important building block organic acid and also plays an important role as an acidulant and additive in food (Ding et al., 2011; Lewandrowski et al., 2000). Production of fumaric acid has recently attracted increasing attention since increasing worries on the climatic change and the depletion of petroleum resources (Song et al., 2013). Among all of the potential microorganisms that could achieve the industrial scale production of fumaric acid, Rhizopus delemar (previously identified as Rhizopus oryzae) is generally believed to be the best candidate (Engel et al., 2008).
43 44 45 46 47 48 49 50 51 52 53 54 55 56
R
R
N C O
41 42
U
39 40
E
35
37 38
F
2
Efficient transformation of Rhizopus delemar by electroporation of germinated spores
1
⁎ Corresponding author at: School of Biotechnology, Jiangnan University, 1800 Lihu Road, Wuxi 214122, China. Tel./fax: +86 510 85918309. E-mail address: [email protected] (J. Zhou).
19 20 21 22 23 24 25 26 27 28 29
Production of fumaric acid by R. delemar mainly suffers from several problems, i.e., lack of highly active extracellular cellulases (Xu et al., 2010), accumulation of byproducts (Fu et al., 2010), instable morphology (Zhou et al., 2011), and relatively low yield of fumaric acid on substrates. It is believed that these issues could be solved by metabolic engineering strategies (Zhang et al., 2012; Zhang and Yang, 2012). However, the shortage of high efficient transformation procedure has hindered the efficient metabolic engineering of R. delemar. Therefore, an efficient and reliable method for the transformation of R. delemar with lower cost is extremely important. In this study, a protocol was developed that employed colony formation and electroporation with the R. delemar NRRL 1526 strain, which is one of the best strains for fumaric acid production. With fresh germinated R. delemar spores, combined with pretreatment with lithium acetate (LiAc) and dithiothreitol (DTT) before electroporation, the transformation efficiency was significantly improved. The method described here presents a promising strategy for the efficient metabolic engineering and investigation of physiological functions in R. delemar or other similar mycelial fungi.
57
2. Materials and methods
76
2.1. Strains and plasmids
77
58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75
R. delemar NRRL 1526 was obtained from the National Center for 78 Agricultural Utilization Research (Peoria, IL) (Zhou, 2011). pBC-Hygro 79 Q3 is a gift from Prof. Philippe Silar (Université Paris Diderot-Paris 7), and 80
http://dx.doi.org/10.1016/j.mimet.2014.05.016 0167-7012/© 2014 Published by Elsevier B.V.
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
99
2.3. Preparation of germinated spores
100
120 121
The strain was first cultured on sporulation medium slants, and further propagated on sporulation medium in 90 mm dishes to form spores at 30 °C. The spores were washed from the agar with sterile distilled water. The spore concentration of the suspension was controlled to 108 spores/mL by centrifugation and suitable dilution. The washed spores (1 mL) were inoculated into 250 mL Erlenmeyer flasks containing 50 mL of spore-germination medium. Cultivation was performed at 30 °C, 200 rpm in rotary shakers. Spores germinated at different times were collected and observed with a Nikon Eclipse 50i fluorescence microscope under phase contract mode (Nikon, Tokyo, Japan). Spores were washed with sterile ice-cold distilled water three times to remove the remaining culture medium. The pellets were then resuspended in 100 μL of sterile ice-cold 1.2 M sorbitol for electroporation. Besides, in order to further improve the transformation efficiency, the germinated spores were collected and concentrated to 1 mL, then pre-treated with LiAc and DTT. The concentrations of LiAc and DTT were optimized from a range of 0–100 mM and 0–30 mM, respectively. The treatment was performed at room temperature in 1.5 mL Eppendorf tubes for 30 min. The tubes were gently inverted for two to three times during the treatment. The pellets were then washed with 10 mL sterile ice-cold 1.2 M sorbitol for three times and resuspended in 100 μL of the same solution for electroporation.
122
2.4. Vector construction
123 124 125
The promoter (PpdcA) and the terminator (TpdcA) of the pdcA gene was PCR-amplifed from R. oryzae NRRL 395 by primer pairs PpdcA-F/ PpdcA-R and TpdcA-F/TpdcA-R, respectively (Mertens et al., 2006)
t1:1 t1:2
Table 1 Primers used in this study.
107 108 109 110 111 112 113 114 115 116 117 118 119
C
105 106
E
103 104
R
101 102
R
95 96
O
93 94
C
91 92
N
89 90
U
87 88
2.5. Electroporation
133
The 100 μL of electroporation-competent cells was mixed with 1 μg of pBC-Hygro (or pBC-Hygro-EGFP) in 10 μL of water, transferred to a 0.2-cm gap cuvette (BioRad, Hercules, CA), and incubated for 5 min on ice. The electroporation pulse was applied at different voltages for 5 ms using a GenPulser Xcell™ electroporation system (BioRad). The electroporated cells were immediately diluted with 1 mL of icecold YPD culture medium and then kept on ice for 15 min. The cells were then cultured in a 15 ml BD Falcon tubes at 30 °C, and by rotation at 150 r/min for 90 min. The transformed cells were then spread on YPD media containing 100 mg/L of hygromycin and different concentration of sodium deoxycholate. The plates were then cultured at 30 °C for 4– 5 days to form single colonies. The single colonies were then streaked on plates containing 100 mg/L of hygromycin and different concentration of sodium deoxycholate for further purification and validation of the stability of the transformation. For strain confirmation, transformants cultured in YPD for 16 h were collected and digested with lyticase for 1 h (Sigma, St. Louis, MO). The digested pellets were sonicated for DNA purification with a DNA purification kit (Takara, Dalian, China). For empty pBC-Hygro transformation, the transformants were validated by the primer pair Hyg-F/Hyg-R (Table 1). For pBC-Hygro-EGFP transformation, the transformants were validated by the primer pairs Hyg-F/Hyg-R and EGFP-F/EGFP-R (Table 1).
134
2.6. Microscopy methods
157
The spores of the transformant with pBC-Hygro-EGFP were cultured in spore germination medium for 10 h. The mycelia were taken from the culture, and were observed with a Nikon Eclipse 50i fluorescent microscope connected to a DXM1200C camera and ACT-1 Nikon software (Nikon, Tokyo, Japan). The expression of EGFP was examined using the same microscope under both phase contract and fluorescence mode (Nikon).
158 159
3. Results
165
3.1. Formation of single colonies
166
The obtaining of transformants from colonies is the essential step for successful transformation. Unlike bacteria, yeasts or some other fungi, Rhizopus sp. cannot form regular colonies on plates with commonly used culture media. Therefore, in order to obtain potential transformants, it is crucial to obtain single colonies by changing the components of the culture media. To achieve this goal, sodium deoxycholate, nystatin, amphotercin B and bleomycin are added to the plates at different concentrations, respectively. Only the addition of sodium deoxycholate could significantly affect the formation of mycelial filaments on the plate. On plates without sodium deoxycholate, mycelial filaments could spread and cover the entire surface of the plate without any identifiable single colonies (Fig. 1A). By adding 0.3 g/L (Fig. 1B) to 0.5 g/L (Fig. 1C) of sodium deoxycholate, single colonies could be formed on the plates. The best concentration for colony formation was 0.7 g/L (Fig. 1D). More than 0.8 g/L of sodium deoxycholate could severely impair the growth of R. delemar on plates with a synergy effect of hygromycin (Fig. 1F).
167
F
97 98
Sporulation medium was used for R. delemar to form spores. It consisted of (g/L): glucose, 4.0; lactose, 6.0; glycerol, 10.0; corn steep liquor powder (Shandong Fufeng Fermentation Co. Ltd., Lunan, China), 1.0; urea, 0.6; tryptone (Difco, Detroit, MI), 1.6; MgSO4.7H2O, 0.3; ZnSO4.7H2O, 0.088; FeSO4.7H2O, 0.25; CuSO4, 0.005; KH2PO4, 0.4; MnSO4.4H2O, 0.05; KCl, 0.4; NaCl, 40; agarose, 20. In the sporegermination experiments, soybean glucose medium was used, and consisted of (g/L): glucose, 20; soybean, 6; CaCO3, 6. In the electroporation processes, yeast extract and peptone dextrose (YPD) medium was used, and consisted of (g/L): yeast extract Bacto-yeast extract (Difco), 10; peptone (Difco), 20; dextrose, 20. All the media were sterilized at 121 °C for 15 min before use. All of the inorganic salts and dextrose are purchased from Sinopharm Group Co. Ltd. (Shanghai, China).
O
86
R O
2.2. Culture media
126 127
P
85
(Table 1). The enhanced green fluorescence protein (EGFP) gene was PCR-amplified from pQE60-EGFP with the primer pair EGFP-F/EGFP-R (Zhou et al., 2008). The PpdcA-EGFP-TpdcA fragment was obtained by fusion PCR with equimolar of the above three DNA fragments with the primer pair PpdcA-F/TpdcA-R (Table 1), then purified, digested and inserted into the NotI/SalI site of pBC-Hygro, resulted in pBC-HygroEGFP.
T
83 84
was derived from the plasmid pBluescript SK+ (Stratagene, La Jolla, CA) carrying the hygromycin B resistance cassette from plasmid pMOcosX (Gangavaram et al., 2009). Escherichia coli JM109 was used for plasmid propagation and vector construction.
D
81 82
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
E
2
t1:3
No.
Name
Primer sequence (5′–3′)a
t1:4 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10 t1:11
1 2 3 4 5 6 7 8
PpdcA-F PpdcA-R EGFP-F EGFP-R TpdcA-F TpdcA-R Hyg-F Hyg-R
GCGGCCGGGCTAAAGTTTATCAGCTTCAATCCAT a AGTTCTTCTCCCTTACCCATTTTTAAATTTGTTTTGTAGAG ATGGGTAAGGGAGAAGAAC TTATTTGTATAGTTCATCCATG TGGATGAACTATACAAATAAAATCTTAGAATTCATCTTTTTTTGTATCAT GTCGACACTCTACCGTCTGCTCTTTTGTCT GGCTTGGCTGGAGCTAGTGGAGGTCAA AACCCGCGGTCGGCATCTACTCTATTC
t1:12
a
Sequences of restriction enzyme cutting site and overlapping sequences required for the fusion PCR are underlined.
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
128 129 130 131 132
135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156
160 161 162 163 164
168 169 170 171 172 173 174 175 176 177 178 179 180 181 182
3
C
T
E
D
P
R O
O
F
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
R
R
E
Fig. 1. The effect of sodium deoxycholate on colony formation by R. delemar 1526. A: Plates without the addition of sodium deoxycholate; B–F: plates with 0.3, 0.5, 0.7, 0.8 and 1.0 g/L of sodium deoxycholate, respectively.
3.2. Germination of R. delemar spores
184
192
Fresh spores of R. delemar were collected from slants. About 108 of spores were collected for each transformation. Preliminary experiments showed that the time of germination played a crucial role in the transformation efficiency. Spores germinated on suitable culture conditions could form regular mycelial filaments after 8 h. Spores began to geminate after about 2 h of culture. From 3–5 h, spores gradually formed short mycelial filaments. Because the synchronous germination of the spores is difficult to achieve, the germination process could only be controlled according to the majority of spores.
193
3.3. Effect of germination time on the transformation efficiency
194 195
Along with the germination process, the cell wall of R. delemar undergoes changes that could benefit the transformation process. The cell walls of both fresh spores and mature mycelial filaments could significantly inhibit the successful transformation of heterologous DNA into the fungi. The transformation results showed that 4 h of spore germination is the optimum time (Fig. 2C). In addition, by changing the culture conditions, such as decreasing the culture temperature or reducing the supply of nitrogen, the spore morphology in Fig. 2C had the highest transformation efficiency (Fig. 3). Extra assays showed that the most
187 188 189 190 191
196 197 198 199 200 201 202
U
185 186
N C O
183
Fig. 2. Morphology of spores and of the germination process. A. Fresh spores. B–F: spores germinated for 2, 3, 4, 5 and 6 h, respectively. After 6 h of culture without the addition of sodium deoxycholate, spores could form tight pellets (Zhou, 2011). Q2
important factor for transformation was the morphology of germinated spores rather than germination time. The appearance of the optimum morphology of the germinated spores (Fig. 2C) varied in the different culture conditions and the spore formation conditions.
203 204
3.4. Optimization of transformation efficiency of electroporation
207
Germination temperature is an important factor for the transformation efficiency. Under the optimum morphology of 25, 28, 30 and 32 °C, the transformation efficiencies were 32 ± 9 transformants/μg DNA, 47 ± 3 transformants/μg DNA, 118 ± 12 transformants/μg DNA and 87 ± 3 transformants/μg DNA, respectively, with an electroporation pulse of 5 kV/cm for 5 ms. Thus, the optimum temperature for germination was 30 °C. With the optimum temperature for spore germination, the electroporation voltage was further tested. At an electroporation voltage of 5.5 kV/cm, the highest transformation efficiency of 130 ± 17 transformants/μg DNA could be achieved.
208 209
3.5. Optimization of the buffer for pretreatment
218
The transformation efficiency still seemed to be low after optimization of the culture media and culture temperature. Inspired by the method of the lithium acetate- and dithiothreitol-aided high efficiency electroporation of yeast strains (Zhou et al., 2009), the process of
219
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
205 206
210 211 212 213 214 215 216 217
220 221 222
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
R O
O
F
4
3.6. Overexpression of EGFP in R. delemar
231 232
To further confirm the successful transformation of the procedure described above, an EGFP containing vector, pBC-Hygro-EGFP was transformed into R. delemar NRRL 1526. A single transformant was
C E
Fig. 5. Expression of EGFP in R. delemar NRRL 1526. (A) Phase contrast image of R. delemar NRRL 1526 with pBC-Hygro-EGFP. (B) The corresponding fluorescence image. The mycelial filaments were collected from a liquid culture that had been incubated for 10 h. With a constitutive promoter PpdcA, the EGFP gene could be expressed in most part of the mycelial filaments.
R
R O C N U
233
D
230
226 227
T
228 229
preparation of the germinated spores was further optimized. By optimizing the DTT and LiAc concentrations, the final transformation efficiency could be increased to 1239 ± 22 transformants/μg DNA, with pretreatment of the germinated spores with 0.05 M LiAc and 20 mM DTT before electroporation. The transformation efficiency was improved by 9.5 times compared to that of the non-treated germinated spores (Fig. 4).
224 225
E
223
P
Fig. 3. The role of germination time on the transformation efficiency. The germination time of spores had a significant impact on the transformation efficiency. Too early or too late to collect spores could result in the failure of the transformation procedure.
Fig. 4. The role of germination time on the transformation efficiency with additional LiAc and DTT treatment. The germination time of spores had a significant impact on the transformation efficiency. Treatment of the germinated spores with LiAc and DTT significantly improved the final transformation efficiency.
obtained and was further streaked on hygromycin plates with 0.7 g/L of sodium deoxycholate for 3 generations. To test the stability of the transformation, 200 of the transformants were further streaked on non-resistant plates for 3 generations. All the transformants on nonselective plates could further grow well on selective plates, indicating the high stability of the transformants. Fluorescence microscopy showed the successful expression of the heterologous EGFP gene (Fig. 5B).
234 235
4. Discussion
242
Germinated spores were used for the electroporation-mediated transformation of R. delemar. Following the optimization of the pretreatment and transformation conditions, R. delemar NRRL 1526 was successfully transformed. Furthermore, an EGFP gene was successfully expressed in the fungi. The results showed that the electroporation transformation of germinated spores is an ideal method for the genetic engineering of R. delemar. Compared to other common methods for the transformation of fungi, the current method had several advantages, such as high efficiency, shorter time, and reliable reproducibility. Additional results obtained in our laboratory showed that the method could also be applied to other R. delemar and R. oryzae strains with ideal transformation efficiency (data not shown).
243
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
236 237 238 239 240 241
244 245 246 247 248 249 250 251 252 253 254
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304
308 309 310 311 312 313 314 315 316 317
C
274 275
E
272 273
R
References
328
F
270 271
R
268 269
N C O
266 267
U
264 265
319 320
Ali, S., 2006. Application of kaolin to improve citric acid production by a thermophilic Aspergillus niger. Appl. Microbiol. Biotechnol. 73, 755–762. Chang, P.K., 2008. A highly efficient gene-targeting system for Aspergillus parasiticus. Lett. Appl. Microbiol. 46, 587–592. de Oliveira, J., de Graaff, L.H., 2011. Proteomics of industrial fungi: trends and insights for biotechnology. Appl. Microbiol. Biotechnol. 89, 225–237. Ding, Y.Y., Li, S., Dou, C., Yu, Y., Huang, H., 2011. Production of fumaric acid by Rhizopus oryzae: role of carbon–nitrogen ratio. Appl. Biochem. Biotechnol. 164, 1461–1467. Engel, C.A.R., Straathof, A.J.J., Zijlmans, T.W., van Gulik, W.M., van der Wielen, L.A.M., 2008. Fumaric acid production by fermentation. Appl. Microbiol. Biotechnol. 78, 379–389. Fu, Y.Q., Xu, Q., Li, S., Chen, Y., Huang, H., 2010. Strain improvement of Rhizopus oryzae for over-production of fumaric acid by reducing ethanol synthesis pathway. Korean J. Chem. Eng. 27, 183–186. Gangavaram, L.P., McHunu, N., Ramakrishnan, P., Singh, S., Permaul, K., 2009. Improved electroporation-mediated non-integrative transformation of Thermomyces lanuginosus. J. Microbiol. Methods 77, 159–164. Gietz, R.D., Schiestl, R.H., 2007. Quick and easy yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2, 35–37. Gouka, R.J., Gerk, C., Hooykaas, P.J.J., Bundock, P., Musters, W., Verrips, C.T., de Groot, M.J.A., 1999. Transformation of Aspergillus awamori by Agrobacterium tumefaciens-mediated homologous recombination. Nat. Biotechnol. 17, 598–601. Ike, M., Park, J., Tabuse, M., Tokuyasu, K., 2010. Cellulase production on glucose-based media by the UV-irradiated mutants of Trichoderma reesei. Appl. Microbiol. Biotechnol. 87, 2059–2066. Lewandrowski, K.U., Gresser, J.D., Bondre, S.P., Silva, A.E., Wise, D.L., Trantolo, D.J., 2000. Developing porosity of poly(propylene glycol-co-fumaric acid) bone graft substitutes and the effect on osteointegration: a preliminary histology study in rats. J. Biomater. Sci. Polym. Ed. 11, 879–889. Mertens, J.A., Skory, C.D., Ibrahim, A.S., 2006. Plasmids for expression of heterologous proteins in Rhizopus oryzae. Arch. Microbiol. 186, 41–50. Meussen, B., de Graaff, L., Sanders, J., Weusthuis, R., 2012. Metabolic engineering of Rhizopus oryzae for the production of platform chemicals. Appl. Microbiol. Biotechnol. 94, 875–886. Meyer, V., Mueller, D., Strowig, T., Stahl, U., 2003. Comparison of different transformation methods for Aspergillus giganteus. Curr. Genet. 43, 371–377. Monfort, A., Cordero, L., Maicas, S., Polaina, J., 2003. Transformation of Mucor miehei results in plasmid deletion and phenotypic instability. FEMS Microbiol. Lett. 224, 101–106. Nyilasi, I., Acs, K., Papp, T., Nagy, E., Vagvolgyi, C., 2005. Agrobacterium tumefaciensmediated transformation of Mucor circinelloides. Folia Microbiol. (Praha) 50, 415–420. Park, J., Lee, Y.-H., 2013. Bidirectional-genetics platform, a dual-purpose mutagenesis strategy for filamentous fungi. Eukaryot. Cell 12, 1547–1553. Park, E.Y., Ito, Y., Nariyama, M., Sugimoto, T., Lies, D., Kato, T., 2011. The improvement of riboflavin production in Ashbya gossypii via disparity mutagenesis and DNA microarray analysis. Appl. Microbiol. Biotechnol. 91, 1315–1326. Poma, A., Limongi, T., Pacioni, G., 2006. Current state and perspectives of truffle genetics and sustainable biotechnology. Appl. Microbiol. Biotechnol. 72, 437–441. Robinson, H.L., Deacon, J.W., 2001. Protoplast preparation and transient transformation of Rhizoctonia solani. Mycol. Res. 105, 1295–1303. Ruiz-Diez, B., 2002. Strategies for the transformation of filamentous fungi. J. Appl. Microbiol. 92, 189–195. Shimizu, T., Ito, T., Kanematsu, S., 2012. Transient and multivariate system for transformation of a fungal plant pathogen, using autonomously replicating vectors. Curr. Genet. 58, 129–138. Snoek, I.S.I., van der Krog, Z.A., Touw, H., Kerkman, R., Pronk, J.T., Bovenberg, R.A.L., van den Berg, M.A., Daran, J.M., 2009. Construction of an hdfA Penicillium chrysogenum strain impaired in non-homologous end-joining and analysis of its potential for functional analysis studies. Fungal Genet. Biol. 46, 418–426. Song, C.W., Kim, D.I., Choi, S., Jang, J.W., Lee, S.Y., 2013. Metabolic engineering of Escherichia coli for the production of fumaric acid. Biotechnol. Bioeng. 110, 2025–2034. Takahashi, T., Jin, F.J., Koyama, Y., 2009. Nonhomologous end-joining deficiency allows large chromosomal deletions to be produced by replacement-type recombination in Aspergillus oryzae. Fungal Genet. Biol. 46, 815–824. Windhofer, F., Catcheside, D.E.A., Kempken, F., 2000. Methylation of the foreign transposon Restless in vegetative mycelia of Neurospora crassa. Curr. Genet. 37, 194–199. Xu, Q., Li, S., Fu, Y.Q., Tai, C., Huang, H., 2010. Two-stage utilization of corn straw by Rhizopus oryzae for fumaric acid production. Bioresour. Technol. 101, 6262–6264.
O
A transformation procedure that significantly improved the colony formation and electroporation process has been established for a typical mycelial fungus, R. delemar. By optimization of the concentration of sodium deoxycholate in the plates, single colonies of R. delemar were obtained. By pretreatment of the germinated spores in the optimum morphology with 0.05 M LiAc and 20 mM DTT before the electroporation, the final transformation efficiency at optimal conditions reached 1239 ± 22 transformants/μg DNA. The improved transformation efficiency could significantly facilitate both metabolic engineering and physiological analysis of R. delemar or similar filamentous fungi.
262 263
This work was supported by grants from the National Natural Science Foundation of China (31370130), the Natural Science Foundation of Jiangsu Province (BK2011004), the Open Project Program of the Key Laboratory of Industrial Biotechnology, Ministry of Education, China (KLIBKF201006, KLIB-KF201106), the Author of National Excellent Doctoral Dissertation of PR China (FANEDD, 201256), the Program for New Century Excellent Talents in University (NCET-12-0876), the Fundamental Research Funds for the Central Universities (JUSRP51307A, JUSRP211A25) and the 111 Project (111-2-06).
R O
307
261
318
P
5. Conclusions
259 260
Acknowledgment
D
306
257 258
T
305
Because of the existence of the non-homologous end-joining (NHEJ) system, which is a pathway that repairs double-strand breaks in DNA, the circular vectors or DNA fragments could not always be integrated into a specific locus on the chromosome of fungi (Takahashi et al., 2009). To achieve the precise transformation of the mycelial fungi, two methods could be used: (1) disrupting the enzymes involved in the NHEJ system (Snoek et al., 2009); and (2) employing extensive screening of the transformants for the intended integrated locus. One of the most important problems in disruption of the NHEJ system is the precise knockout of those enzymes involved in the NHEJ process, which could be achieved by screening NHEJ-deficient mutants (Chang, 2008). That is to say, a large amount of transformants should be obtained to achieve the precise genetic operation of mycelial fungi. The commonly used transformation methods for fungi include LiAc mediated transformation, Agrobacterium mediated transformation, polyethylene glycol (PEG) mediated protoplast transformation, protoplast electroporation, and particle gun mediated transformation. Among these methods, the PEG mediated protoplast transformation and Agrobacterium-mediated transformation are the two most widely used methods. The LiAc-mediated transformation procedure was developed in yeast, and could only be successfully performed in a few fungi, such as Ustilago violacea (Gietz and Schiestl, 2007). Because of the structure of mycelial fungi, preparation of the protoplast needs complicated steps to remove the cell wall (Robinson and Deacon, 2001; Windhofer et al., 2000). Maintenance of protoplast integrity during the preparation, transformation and cell wall regeneration made the entire process highly tricky (Shimizu et al., 2012). The Agrobacterium-mediated transformation was the most commonly used method and could be successfully applied in the transformation of many common fungi species, such as Mucor sp. (Monfort et al., 2003; Nyilasi et al., 2005), Aspergillus sp. (Gouka et al., 1999) and Trichoderma sp. (Yao et al., 2007; Zeilinger, 2004). However, this method needs multi-step transformation, which required more than one week to perform one batch of transformation. Besides, because the vectors should be maintained in both E. coli and Agrobacterium strains, introduction of unnecessary genes for replication in bacteria could not be avoided. This could not only bring unknown impact to the fungi strains but also hinder the second time transformation with the same procedure. Particle gun mediated transformation (or biolistic transformation) of the fungi is also a practicable method for the genetic engineering of fungi (Ruiz-Diez, 2002). However, most of the labs working with microorganisms do not have such instruments. Even worse, the high cost of every transformation and the extra training on the use of the equipment further hindered the wide usage of this method for fungi. For some of the fungi, such as Aspergillus giganteus, the particle gun mediated transformation could achieve a very low transformation efficiency (Meyer et al., 2003). Therefore, the current procedure for the electroporation of germinated spores with pretreatment of LiAc and DTT may provide an extra choice for the efficient transformation of these fungi.
E
255 256
5
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
321 322 323 324 325 326 327
329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396
6
Zhou, J.W., Liu, L.M., Du, G.C., Chen, J., 2008. Citrate protect the growth of Torulopsis glabrata CCTCC M202019 against acidic stress as additional ATP supplier. J. Biotechnol. 136, S741. Zhou, J.W., Dong, Z.Y., Liu, L.M., Du, G.C., Chen, J., 2009. A reusable method for construction of non-marker large fragment deletion yeast auxotroph strains: a practice in Torulopsis glabrata. J. Microbiol. Methods 76, 70–74. Zhou, Z.X., Du, G.C., Hua, Z.Z., Zhou, J.W., Chen, J., 2011. Optimization of fumaric acid production by Rhizopus delemar based on the morphology formation. Bioresour. Technol. 102, 9345–9349.
N
C
O
R
R
E
C
T
E
D
P
R O
O
F
Yao, H.Z., Xiao, L.W., Tian, H.W., Qiao, J., 2007. Agrobacterium-mediated transformation (AMT) of Trichoderma reesei as an efficient tool for random insertional mutagenesis. Appl. Microbiol. Biotechnol. 73, 1348–1354. Zeilinger, S., 2004. Gene disruption in Trichoderma atroviride via Agrobacterium-mediated transformation. Curr. Genet. 45, 54–60. Zhang, B.H., Yang, S.T., 2012. Metabolic engineering of Rhizopus oryzae: effects of overexpressing fumR gene on cell growth and fumaric acid biosynthesis from glucose. Process Biochem. 47, 2159–2165. Zhang, B., Skory, C.D., Yang, S.-T., 2012. Metabolic engineering of Rhizopus oryzae: effects of overexpressing pyc and pepc genes on fumaric acid biosynthesis from glucose. Metab. Eng. 14, 512–520.
U
397 398 399 400 401 402 403 404 405 406 407
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
408 409 410 411 412 413 414 415
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
3Q1
Sha Xu a,b, Zhengxiong Zhou a, Guocheng Du a,b, Jingwen Zhou a,b,⁎, Jian Chen a,b
O
4 5
a
6
a r t i c l e
7 8 9 10 11
Article history: Received 7 April 2014 Received in revised form 23 May 2014 Accepted 24 May 2014 Available online xxxx
12 13 14 15 16 17 18 30
Keywords: Fungi Transformation Rhizopus oryzae Fumaric acid Lactic acid Colony formation
i n f o
R O
School of Biotechnology and Key Laboratory of Industrial Biotechnology, Ministry of Education, Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China Synergetic Innovation Center of Food Safety and Nutrition, 1800 Lihu Road, Wuxi, Jiangsu 214122, China
a b s t r a c t
E
D
P
High efficient transformation of mycelial fungi is essential to both metabolic engineering and physiological analysis of these industrially important microorganisms. However, transformation efficiencies for mycelial fungi are highly restricted by difficulties in colony formation and competent cell preparation. In this work, an innovative transformation procedure that could significantly improve the efficiency of colony formation and transformation process has been established for a typical mycelial fungus, Rhizopus delemar. Single colonies of R. delemar were obtained with the addition of sodium deoxycholate. Fresh germinated spores of R. delemar were successfully transformed by electroporation. In addition, by pretreatment of the germinated spores with 0.05 M lithium acetate (LiAc) and 20 mM dithiothreitol (DTT) before electroporation, the transformation efficiency was further improved by 9.5-fold. The final transformation efficiency at optimal conditions reached 1239 transformants/μg DNA. The method described here would facilitate more efficient metabolic engineering and investigation of physiological functions in R. delemar or other similar mycelial fungi. © 2014 Published by Elsevier B.V.
T
b
C
34 32 31 33
1. Introduction
36
Mycelial fungi are a large group of eukaryotic microorganisms. They can be used for the production of many kinds of important products, such as citric acid (Ali, 2006), fumaric acid (Zhou et al., 2011), enzymes (Ike et al., 2010), vitamins (Park et al., 2011), and other useful platform chemicals (Meussen et al., 2012). Metabolic engineering of these mycelial fungi is one of the most promising routes to further expand their industrial applications (de Oliveira and de Graaff, 2011; Poma et al., 2006). High efficient transformation of mycelial fungi is essential for both metabolic engineering and physiological analysis of these industrially important microorganisms (Park and Lee, 2013). However, transformation efficiencies for mycelial fungi are highly restricted by difficulties in colony formation and competent cell preparation. Fumaric acid is an important building block organic acid and also plays an important role as an acidulant and additive in food (Ding et al., 2011; Lewandrowski et al., 2000). Production of fumaric acid has recently attracted increasing attention since increasing worries on the climatic change and the depletion of petroleum resources (Song et al., 2013). Among all of the potential microorganisms that could achieve the industrial scale production of fumaric acid, Rhizopus delemar (previously identified as Rhizopus oryzae) is generally believed to be the best candidate (Engel et al., 2008).
43 44 45 46 47 48 49 50 51 52 53 54 55 56
R
R
N C O
41 42
U
39 40
E
35
37 38
F
2
Efficient transformation of Rhizopus delemar by electroporation of germinated spores
1
⁎ Corresponding author at: School of Biotechnology, Jiangnan University, 1800 Lihu Road, Wuxi 214122, China. Tel./fax: +86 510 85918309. E-mail address: [email protected] (J. Zhou).
19 20 21 22 23 24 25 26 27 28 29
Production of fumaric acid by R. delemar mainly suffers from several problems, i.e., lack of highly active extracellular cellulases (Xu et al., 2010), accumulation of byproducts (Fu et al., 2010), instable morphology (Zhou et al., 2011), and relatively low yield of fumaric acid on substrates. It is believed that these issues could be solved by metabolic engineering strategies (Zhang et al., 2012; Zhang and Yang, 2012). However, the shortage of high efficient transformation procedure has hindered the efficient metabolic engineering of R. delemar. Therefore, an efficient and reliable method for the transformation of R. delemar with lower cost is extremely important. In this study, a protocol was developed that employed colony formation and electroporation with the R. delemar NRRL 1526 strain, which is one of the best strains for fumaric acid production. With fresh germinated R. delemar spores, combined with pretreatment with lithium acetate (LiAc) and dithiothreitol (DTT) before electroporation, the transformation efficiency was significantly improved. The method described here presents a promising strategy for the efficient metabolic engineering and investigation of physiological functions in R. delemar or other similar mycelial fungi.
57
2. Materials and methods
76
2.1. Strains and plasmids
77
58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75
R. delemar NRRL 1526 was obtained from the National Center for 78 Agricultural Utilization Research (Peoria, IL) (Zhou, 2011). pBC-Hygro 79 Q3 is a gift from Prof. Philippe Silar (Université Paris Diderot-Paris 7), and 80
http://dx.doi.org/10.1016/j.mimet.2014.05.016 0167-7012/© 2014 Published by Elsevier B.V.
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
99
2.3. Preparation of germinated spores
100
120 121
The strain was first cultured on sporulation medium slants, and further propagated on sporulation medium in 90 mm dishes to form spores at 30 °C. The spores were washed from the agar with sterile distilled water. The spore concentration of the suspension was controlled to 108 spores/mL by centrifugation and suitable dilution. The washed spores (1 mL) were inoculated into 250 mL Erlenmeyer flasks containing 50 mL of spore-germination medium. Cultivation was performed at 30 °C, 200 rpm in rotary shakers. Spores germinated at different times were collected and observed with a Nikon Eclipse 50i fluorescence microscope under phase contract mode (Nikon, Tokyo, Japan). Spores were washed with sterile ice-cold distilled water three times to remove the remaining culture medium. The pellets were then resuspended in 100 μL of sterile ice-cold 1.2 M sorbitol for electroporation. Besides, in order to further improve the transformation efficiency, the germinated spores were collected and concentrated to 1 mL, then pre-treated with LiAc and DTT. The concentrations of LiAc and DTT were optimized from a range of 0–100 mM and 0–30 mM, respectively. The treatment was performed at room temperature in 1.5 mL Eppendorf tubes for 30 min. The tubes were gently inverted for two to three times during the treatment. The pellets were then washed with 10 mL sterile ice-cold 1.2 M sorbitol for three times and resuspended in 100 μL of the same solution for electroporation.
122
2.4. Vector construction
123 124 125
The promoter (PpdcA) and the terminator (TpdcA) of the pdcA gene was PCR-amplifed from R. oryzae NRRL 395 by primer pairs PpdcA-F/ PpdcA-R and TpdcA-F/TpdcA-R, respectively (Mertens et al., 2006)
t1:1 t1:2
Table 1 Primers used in this study.
107 108 109 110 111 112 113 114 115 116 117 118 119
C
105 106
E
103 104
R
101 102
R
95 96
O
93 94
C
91 92
N
89 90
U
87 88
2.5. Electroporation
133
The 100 μL of electroporation-competent cells was mixed with 1 μg of pBC-Hygro (or pBC-Hygro-EGFP) in 10 μL of water, transferred to a 0.2-cm gap cuvette (BioRad, Hercules, CA), and incubated for 5 min on ice. The electroporation pulse was applied at different voltages for 5 ms using a GenPulser Xcell™ electroporation system (BioRad). The electroporated cells were immediately diluted with 1 mL of icecold YPD culture medium and then kept on ice for 15 min. The cells were then cultured in a 15 ml BD Falcon tubes at 30 °C, and by rotation at 150 r/min for 90 min. The transformed cells were then spread on YPD media containing 100 mg/L of hygromycin and different concentration of sodium deoxycholate. The plates were then cultured at 30 °C for 4– 5 days to form single colonies. The single colonies were then streaked on plates containing 100 mg/L of hygromycin and different concentration of sodium deoxycholate for further purification and validation of the stability of the transformation. For strain confirmation, transformants cultured in YPD for 16 h were collected and digested with lyticase for 1 h (Sigma, St. Louis, MO). The digested pellets were sonicated for DNA purification with a DNA purification kit (Takara, Dalian, China). For empty pBC-Hygro transformation, the transformants were validated by the primer pair Hyg-F/Hyg-R (Table 1). For pBC-Hygro-EGFP transformation, the transformants were validated by the primer pairs Hyg-F/Hyg-R and EGFP-F/EGFP-R (Table 1).
134
2.6. Microscopy methods
157
The spores of the transformant with pBC-Hygro-EGFP were cultured in spore germination medium for 10 h. The mycelia were taken from the culture, and were observed with a Nikon Eclipse 50i fluorescent microscope connected to a DXM1200C camera and ACT-1 Nikon software (Nikon, Tokyo, Japan). The expression of EGFP was examined using the same microscope under both phase contract and fluorescence mode (Nikon).
158 159
3. Results
165
3.1. Formation of single colonies
166
The obtaining of transformants from colonies is the essential step for successful transformation. Unlike bacteria, yeasts or some other fungi, Rhizopus sp. cannot form regular colonies on plates with commonly used culture media. Therefore, in order to obtain potential transformants, it is crucial to obtain single colonies by changing the components of the culture media. To achieve this goal, sodium deoxycholate, nystatin, amphotercin B and bleomycin are added to the plates at different concentrations, respectively. Only the addition of sodium deoxycholate could significantly affect the formation of mycelial filaments on the plate. On plates without sodium deoxycholate, mycelial filaments could spread and cover the entire surface of the plate without any identifiable single colonies (Fig. 1A). By adding 0.3 g/L (Fig. 1B) to 0.5 g/L (Fig. 1C) of sodium deoxycholate, single colonies could be formed on the plates. The best concentration for colony formation was 0.7 g/L (Fig. 1D). More than 0.8 g/L of sodium deoxycholate could severely impair the growth of R. delemar on plates with a synergy effect of hygromycin (Fig. 1F).
167
F
97 98
Sporulation medium was used for R. delemar to form spores. It consisted of (g/L): glucose, 4.0; lactose, 6.0; glycerol, 10.0; corn steep liquor powder (Shandong Fufeng Fermentation Co. Ltd., Lunan, China), 1.0; urea, 0.6; tryptone (Difco, Detroit, MI), 1.6; MgSO4.7H2O, 0.3; ZnSO4.7H2O, 0.088; FeSO4.7H2O, 0.25; CuSO4, 0.005; KH2PO4, 0.4; MnSO4.4H2O, 0.05; KCl, 0.4; NaCl, 40; agarose, 20. In the sporegermination experiments, soybean glucose medium was used, and consisted of (g/L): glucose, 20; soybean, 6; CaCO3, 6. In the electroporation processes, yeast extract and peptone dextrose (YPD) medium was used, and consisted of (g/L): yeast extract Bacto-yeast extract (Difco), 10; peptone (Difco), 20; dextrose, 20. All the media were sterilized at 121 °C for 15 min before use. All of the inorganic salts and dextrose are purchased from Sinopharm Group Co. Ltd. (Shanghai, China).
O
86
R O
2.2. Culture media
126 127
P
85
(Table 1). The enhanced green fluorescence protein (EGFP) gene was PCR-amplified from pQE60-EGFP with the primer pair EGFP-F/EGFP-R (Zhou et al., 2008). The PpdcA-EGFP-TpdcA fragment was obtained by fusion PCR with equimolar of the above three DNA fragments with the primer pair PpdcA-F/TpdcA-R (Table 1), then purified, digested and inserted into the NotI/SalI site of pBC-Hygro, resulted in pBC-HygroEGFP.
T
83 84
was derived from the plasmid pBluescript SK+ (Stratagene, La Jolla, CA) carrying the hygromycin B resistance cassette from plasmid pMOcosX (Gangavaram et al., 2009). Escherichia coli JM109 was used for plasmid propagation and vector construction.
D
81 82
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
E
2
t1:3
No.
Name
Primer sequence (5′–3′)a
t1:4 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10 t1:11
1 2 3 4 5 6 7 8
PpdcA-F PpdcA-R EGFP-F EGFP-R TpdcA-F TpdcA-R Hyg-F Hyg-R
GCGGCCGGGCTAAAGTTTATCAGCTTCAATCCAT a AGTTCTTCTCCCTTACCCATTTTTAAATTTGTTTTGTAGAG ATGGGTAAGGGAGAAGAAC TTATTTGTATAGTTCATCCATG TGGATGAACTATACAAATAAAATCTTAGAATTCATCTTTTTTTGTATCAT GTCGACACTCTACCGTCTGCTCTTTTGTCT GGCTTGGCTGGAGCTAGTGGAGGTCAA AACCCGCGGTCGGCATCTACTCTATTC
t1:12
a
Sequences of restriction enzyme cutting site and overlapping sequences required for the fusion PCR are underlined.
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
128 129 130 131 132
135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156
160 161 162 163 164
168 169 170 171 172 173 174 175 176 177 178 179 180 181 182
3
C
T
E
D
P
R O
O
F
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
R
R
E
Fig. 1. The effect of sodium deoxycholate on colony formation by R. delemar 1526. A: Plates without the addition of sodium deoxycholate; B–F: plates with 0.3, 0.5, 0.7, 0.8 and 1.0 g/L of sodium deoxycholate, respectively.
3.2. Germination of R. delemar spores
184
192
Fresh spores of R. delemar were collected from slants. About 108 of spores were collected for each transformation. Preliminary experiments showed that the time of germination played a crucial role in the transformation efficiency. Spores germinated on suitable culture conditions could form regular mycelial filaments after 8 h. Spores began to geminate after about 2 h of culture. From 3–5 h, spores gradually formed short mycelial filaments. Because the synchronous germination of the spores is difficult to achieve, the germination process could only be controlled according to the majority of spores.
193
3.3. Effect of germination time on the transformation efficiency
194 195
Along with the germination process, the cell wall of R. delemar undergoes changes that could benefit the transformation process. The cell walls of both fresh spores and mature mycelial filaments could significantly inhibit the successful transformation of heterologous DNA into the fungi. The transformation results showed that 4 h of spore germination is the optimum time (Fig. 2C). In addition, by changing the culture conditions, such as decreasing the culture temperature or reducing the supply of nitrogen, the spore morphology in Fig. 2C had the highest transformation efficiency (Fig. 3). Extra assays showed that the most
187 188 189 190 191
196 197 198 199 200 201 202
U
185 186
N C O
183
Fig. 2. Morphology of spores and of the germination process. A. Fresh spores. B–F: spores germinated for 2, 3, 4, 5 and 6 h, respectively. After 6 h of culture without the addition of sodium deoxycholate, spores could form tight pellets (Zhou, 2011). Q2
important factor for transformation was the morphology of germinated spores rather than germination time. The appearance of the optimum morphology of the germinated spores (Fig. 2C) varied in the different culture conditions and the spore formation conditions.
203 204
3.4. Optimization of transformation efficiency of electroporation
207
Germination temperature is an important factor for the transformation efficiency. Under the optimum morphology of 25, 28, 30 and 32 °C, the transformation efficiencies were 32 ± 9 transformants/μg DNA, 47 ± 3 transformants/μg DNA, 118 ± 12 transformants/μg DNA and 87 ± 3 transformants/μg DNA, respectively, with an electroporation pulse of 5 kV/cm for 5 ms. Thus, the optimum temperature for germination was 30 °C. With the optimum temperature for spore germination, the electroporation voltage was further tested. At an electroporation voltage of 5.5 kV/cm, the highest transformation efficiency of 130 ± 17 transformants/μg DNA could be achieved.
208 209
3.5. Optimization of the buffer for pretreatment
218
The transformation efficiency still seemed to be low after optimization of the culture media and culture temperature. Inspired by the method of the lithium acetate- and dithiothreitol-aided high efficiency electroporation of yeast strains (Zhou et al., 2009), the process of
219
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
205 206
210 211 212 213 214 215 216 217
220 221 222
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
R O
O
F
4
3.6. Overexpression of EGFP in R. delemar
231 232
To further confirm the successful transformation of the procedure described above, an EGFP containing vector, pBC-Hygro-EGFP was transformed into R. delemar NRRL 1526. A single transformant was
C E
Fig. 5. Expression of EGFP in R. delemar NRRL 1526. (A) Phase contrast image of R. delemar NRRL 1526 with pBC-Hygro-EGFP. (B) The corresponding fluorescence image. The mycelial filaments were collected from a liquid culture that had been incubated for 10 h. With a constitutive promoter PpdcA, the EGFP gene could be expressed in most part of the mycelial filaments.
R
R O C N U
233
D
230
226 227
T
228 229
preparation of the germinated spores was further optimized. By optimizing the DTT and LiAc concentrations, the final transformation efficiency could be increased to 1239 ± 22 transformants/μg DNA, with pretreatment of the germinated spores with 0.05 M LiAc and 20 mM DTT before electroporation. The transformation efficiency was improved by 9.5 times compared to that of the non-treated germinated spores (Fig. 4).
224 225
E
223
P
Fig. 3. The role of germination time on the transformation efficiency. The germination time of spores had a significant impact on the transformation efficiency. Too early or too late to collect spores could result in the failure of the transformation procedure.
Fig. 4. The role of germination time on the transformation efficiency with additional LiAc and DTT treatment. The germination time of spores had a significant impact on the transformation efficiency. Treatment of the germinated spores with LiAc and DTT significantly improved the final transformation efficiency.
obtained and was further streaked on hygromycin plates with 0.7 g/L of sodium deoxycholate for 3 generations. To test the stability of the transformation, 200 of the transformants were further streaked on non-resistant plates for 3 generations. All the transformants on nonselective plates could further grow well on selective plates, indicating the high stability of the transformants. Fluorescence microscopy showed the successful expression of the heterologous EGFP gene (Fig. 5B).
234 235
4. Discussion
242
Germinated spores were used for the electroporation-mediated transformation of R. delemar. Following the optimization of the pretreatment and transformation conditions, R. delemar NRRL 1526 was successfully transformed. Furthermore, an EGFP gene was successfully expressed in the fungi. The results showed that the electroporation transformation of germinated spores is an ideal method for the genetic engineering of R. delemar. Compared to other common methods for the transformation of fungi, the current method had several advantages, such as high efficiency, shorter time, and reliable reproducibility. Additional results obtained in our laboratory showed that the method could also be applied to other R. delemar and R. oryzae strains with ideal transformation efficiency (data not shown).
243
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
236 237 238 239 240 241
244 245 246 247 248 249 250 251 252 253 254
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304
308 309 310 311 312 313 314 315 316 317
C
274 275
E
272 273
R
References
328
F
270 271
R
268 269
N C O
266 267
U
264 265
319 320
Ali, S., 2006. Application of kaolin to improve citric acid production by a thermophilic Aspergillus niger. Appl. Microbiol. Biotechnol. 73, 755–762. Chang, P.K., 2008. A highly efficient gene-targeting system for Aspergillus parasiticus. Lett. Appl. Microbiol. 46, 587–592. de Oliveira, J., de Graaff, L.H., 2011. Proteomics of industrial fungi: trends and insights for biotechnology. Appl. Microbiol. Biotechnol. 89, 225–237. Ding, Y.Y., Li, S., Dou, C., Yu, Y., Huang, H., 2011. Production of fumaric acid by Rhizopus oryzae: role of carbon–nitrogen ratio. Appl. Biochem. Biotechnol. 164, 1461–1467. Engel, C.A.R., Straathof, A.J.J., Zijlmans, T.W., van Gulik, W.M., van der Wielen, L.A.M., 2008. Fumaric acid production by fermentation. Appl. Microbiol. Biotechnol. 78, 379–389. Fu, Y.Q., Xu, Q., Li, S., Chen, Y., Huang, H., 2010. Strain improvement of Rhizopus oryzae for over-production of fumaric acid by reducing ethanol synthesis pathway. Korean J. Chem. Eng. 27, 183–186. Gangavaram, L.P., McHunu, N., Ramakrishnan, P., Singh, S., Permaul, K., 2009. Improved electroporation-mediated non-integrative transformation of Thermomyces lanuginosus. J. Microbiol. Methods 77, 159–164. Gietz, R.D., Schiestl, R.H., 2007. Quick and easy yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2, 35–37. Gouka, R.J., Gerk, C., Hooykaas, P.J.J., Bundock, P., Musters, W., Verrips, C.T., de Groot, M.J.A., 1999. Transformation of Aspergillus awamori by Agrobacterium tumefaciens-mediated homologous recombination. Nat. Biotechnol. 17, 598–601. Ike, M., Park, J., Tabuse, M., Tokuyasu, K., 2010. Cellulase production on glucose-based media by the UV-irradiated mutants of Trichoderma reesei. Appl. Microbiol. Biotechnol. 87, 2059–2066. Lewandrowski, K.U., Gresser, J.D., Bondre, S.P., Silva, A.E., Wise, D.L., Trantolo, D.J., 2000. Developing porosity of poly(propylene glycol-co-fumaric acid) bone graft substitutes and the effect on osteointegration: a preliminary histology study in rats. J. Biomater. Sci. Polym. Ed. 11, 879–889. Mertens, J.A., Skory, C.D., Ibrahim, A.S., 2006. Plasmids for expression of heterologous proteins in Rhizopus oryzae. Arch. Microbiol. 186, 41–50. Meussen, B., de Graaff, L., Sanders, J., Weusthuis, R., 2012. Metabolic engineering of Rhizopus oryzae for the production of platform chemicals. Appl. Microbiol. Biotechnol. 94, 875–886. Meyer, V., Mueller, D., Strowig, T., Stahl, U., 2003. Comparison of different transformation methods for Aspergillus giganteus. Curr. Genet. 43, 371–377. Monfort, A., Cordero, L., Maicas, S., Polaina, J., 2003. Transformation of Mucor miehei results in plasmid deletion and phenotypic instability. FEMS Microbiol. Lett. 224, 101–106. Nyilasi, I., Acs, K., Papp, T., Nagy, E., Vagvolgyi, C., 2005. Agrobacterium tumefaciensmediated transformation of Mucor circinelloides. Folia Microbiol. (Praha) 50, 415–420. Park, J., Lee, Y.-H., 2013. Bidirectional-genetics platform, a dual-purpose mutagenesis strategy for filamentous fungi. Eukaryot. Cell 12, 1547–1553. Park, E.Y., Ito, Y., Nariyama, M., Sugimoto, T., Lies, D., Kato, T., 2011. The improvement of riboflavin production in Ashbya gossypii via disparity mutagenesis and DNA microarray analysis. Appl. Microbiol. Biotechnol. 91, 1315–1326. Poma, A., Limongi, T., Pacioni, G., 2006. Current state and perspectives of truffle genetics and sustainable biotechnology. Appl. Microbiol. Biotechnol. 72, 437–441. Robinson, H.L., Deacon, J.W., 2001. Protoplast preparation and transient transformation of Rhizoctonia solani. Mycol. Res. 105, 1295–1303. Ruiz-Diez, B., 2002. Strategies for the transformation of filamentous fungi. J. Appl. Microbiol. 92, 189–195. Shimizu, T., Ito, T., Kanematsu, S., 2012. Transient and multivariate system for transformation of a fungal plant pathogen, using autonomously replicating vectors. Curr. Genet. 58, 129–138. Snoek, I.S.I., van der Krog, Z.A., Touw, H., Kerkman, R., Pronk, J.T., Bovenberg, R.A.L., van den Berg, M.A., Daran, J.M., 2009. Construction of an hdfA Penicillium chrysogenum strain impaired in non-homologous end-joining and analysis of its potential for functional analysis studies. Fungal Genet. Biol. 46, 418–426. Song, C.W., Kim, D.I., Choi, S., Jang, J.W., Lee, S.Y., 2013. Metabolic engineering of Escherichia coli for the production of fumaric acid. Biotechnol. Bioeng. 110, 2025–2034. Takahashi, T., Jin, F.J., Koyama, Y., 2009. Nonhomologous end-joining deficiency allows large chromosomal deletions to be produced by replacement-type recombination in Aspergillus oryzae. Fungal Genet. Biol. 46, 815–824. Windhofer, F., Catcheside, D.E.A., Kempken, F., 2000. Methylation of the foreign transposon Restless in vegetative mycelia of Neurospora crassa. Curr. Genet. 37, 194–199. Xu, Q., Li, S., Fu, Y.Q., Tai, C., Huang, H., 2010. Two-stage utilization of corn straw by Rhizopus oryzae for fumaric acid production. Bioresour. Technol. 101, 6262–6264.
O
A transformation procedure that significantly improved the colony formation and electroporation process has been established for a typical mycelial fungus, R. delemar. By optimization of the concentration of sodium deoxycholate in the plates, single colonies of R. delemar were obtained. By pretreatment of the germinated spores in the optimum morphology with 0.05 M LiAc and 20 mM DTT before the electroporation, the final transformation efficiency at optimal conditions reached 1239 ± 22 transformants/μg DNA. The improved transformation efficiency could significantly facilitate both metabolic engineering and physiological analysis of R. delemar or similar filamentous fungi.
262 263
This work was supported by grants from the National Natural Science Foundation of China (31370130), the Natural Science Foundation of Jiangsu Province (BK2011004), the Open Project Program of the Key Laboratory of Industrial Biotechnology, Ministry of Education, China (KLIBKF201006, KLIB-KF201106), the Author of National Excellent Doctoral Dissertation of PR China (FANEDD, 201256), the Program for New Century Excellent Talents in University (NCET-12-0876), the Fundamental Research Funds for the Central Universities (JUSRP51307A, JUSRP211A25) and the 111 Project (111-2-06).
R O
307
261
318
P
5. Conclusions
259 260
Acknowledgment
D
306
257 258
T
305
Because of the existence of the non-homologous end-joining (NHEJ) system, which is a pathway that repairs double-strand breaks in DNA, the circular vectors or DNA fragments could not always be integrated into a specific locus on the chromosome of fungi (Takahashi et al., 2009). To achieve the precise transformation of the mycelial fungi, two methods could be used: (1) disrupting the enzymes involved in the NHEJ system (Snoek et al., 2009); and (2) employing extensive screening of the transformants for the intended integrated locus. One of the most important problems in disruption of the NHEJ system is the precise knockout of those enzymes involved in the NHEJ process, which could be achieved by screening NHEJ-deficient mutants (Chang, 2008). That is to say, a large amount of transformants should be obtained to achieve the precise genetic operation of mycelial fungi. The commonly used transformation methods for fungi include LiAc mediated transformation, Agrobacterium mediated transformation, polyethylene glycol (PEG) mediated protoplast transformation, protoplast electroporation, and particle gun mediated transformation. Among these methods, the PEG mediated protoplast transformation and Agrobacterium-mediated transformation are the two most widely used methods. The LiAc-mediated transformation procedure was developed in yeast, and could only be successfully performed in a few fungi, such as Ustilago violacea (Gietz and Schiestl, 2007). Because of the structure of mycelial fungi, preparation of the protoplast needs complicated steps to remove the cell wall (Robinson and Deacon, 2001; Windhofer et al., 2000). Maintenance of protoplast integrity during the preparation, transformation and cell wall regeneration made the entire process highly tricky (Shimizu et al., 2012). The Agrobacterium-mediated transformation was the most commonly used method and could be successfully applied in the transformation of many common fungi species, such as Mucor sp. (Monfort et al., 2003; Nyilasi et al., 2005), Aspergillus sp. (Gouka et al., 1999) and Trichoderma sp. (Yao et al., 2007; Zeilinger, 2004). However, this method needs multi-step transformation, which required more than one week to perform one batch of transformation. Besides, because the vectors should be maintained in both E. coli and Agrobacterium strains, introduction of unnecessary genes for replication in bacteria could not be avoided. This could not only bring unknown impact to the fungi strains but also hinder the second time transformation with the same procedure. Particle gun mediated transformation (or biolistic transformation) of the fungi is also a practicable method for the genetic engineering of fungi (Ruiz-Diez, 2002). However, most of the labs working with microorganisms do not have such instruments. Even worse, the high cost of every transformation and the extra training on the use of the equipment further hindered the wide usage of this method for fungi. For some of the fungi, such as Aspergillus giganteus, the particle gun mediated transformation could achieve a very low transformation efficiency (Meyer et al., 2003). Therefore, the current procedure for the electroporation of germinated spores with pretreatment of LiAc and DTT may provide an extra choice for the efficient transformation of these fungi.
E
255 256
5
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
321 322 323 324 325 326 327
329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396
6
Zhou, J.W., Liu, L.M., Du, G.C., Chen, J., 2008. Citrate protect the growth of Torulopsis glabrata CCTCC M202019 against acidic stress as additional ATP supplier. J. Biotechnol. 136, S741. Zhou, J.W., Dong, Z.Y., Liu, L.M., Du, G.C., Chen, J., 2009. A reusable method for construction of non-marker large fragment deletion yeast auxotroph strains: a practice in Torulopsis glabrata. J. Microbiol. Methods 76, 70–74. Zhou, Z.X., Du, G.C., Hua, Z.Z., Zhou, J.W., Chen, J., 2011. Optimization of fumaric acid production by Rhizopus delemar based on the morphology formation. Bioresour. Technol. 102, 9345–9349.
N
C
O
R
R
E
C
T
E
D
P
R O
O
F
Yao, H.Z., Xiao, L.W., Tian, H.W., Qiao, J., 2007. Agrobacterium-mediated transformation (AMT) of Trichoderma reesei as an efficient tool for random insertional mutagenesis. Appl. Microbiol. Biotechnol. 73, 1348–1354. Zeilinger, S., 2004. Gene disruption in Trichoderma atroviride via Agrobacterium-mediated transformation. Curr. Genet. 45, 54–60. Zhang, B.H., Yang, S.T., 2012. Metabolic engineering of Rhizopus oryzae: effects of overexpressing fumR gene on cell growth and fumaric acid biosynthesis from glucose. Process Biochem. 47, 2159–2165. Zhang, B., Skory, C.D., Yang, S.-T., 2012. Metabolic engineering of Rhizopus oryzae: effects of overexpressing pyc and pepc genes on fumaric acid biosynthesis from glucose. Metab. Eng. 14, 512–520.
U
397 398 399 400 401 402 403 404 405 406 407
S. Xu et al. / Journal of Microbiological Methods xxx (2014) xxx–xxx
Please cite this article as: Xu, S., et al., Efficient transformation of Rhizopus delemar by electroporation of germinated spores, J. Microbiol. Methods (2014), http://dx.doi.org/10.1016/j.mimet.2014.05.016
408 409 410 411 412 413 414 415
