This article was downloaded by: [New York University] On: 10 July 2015, At: 01:30 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: 5 Howick Place, London, SW1P 1WG
Journal of Toxicology and Environmental Health, Part A: Current Issues Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/uteh20
Effects of Tributyltin and Other Retinoid Receptor Agonists in Reproductive-Related Endpoints in the Zebrafish (Danio rerio) ab
ad
a
a
ac
Daniela Lima , L. Filipe C. Castro , Inês Coelho , Ricardo Lacerda , Manuel Gesto , Joana a
ab
a
a
ad
Soares , Ana André , Ricardo Capela , Tiago Torres , António Paulo Carvalho Santos
& Miguel M.
ad
a
Interdisciplinary Centre for Marine and Environmental Research (CIIMAR), CIMAR Associate Laboratory, University of Porto Porto, Portugal b
Click for updates
ICBAS–Institute of Biomedical Sciences Abel Salazar, University of Porto, Porto, Portugal
c
Laboratory of Animal and Comparative Physiology, Faculty of Biology, University of Vigo, Campus As Lagoas-Marcosende, Vigo, Spain d
FCUP–Department of Biology, Faculty of Sciences, University of Porto, Porto, Portugal Published online: 19 Jun 2015.
To cite this article: Daniela Lima, L. Filipe C. Castro, Inês Coelho, Ricardo Lacerda, Manuel Gesto, Joana Soares, Ana André, Ricardo Capela, Tiago Torres, António Paulo Carvalho & Miguel M. Santos (2015) Effects of Tributyltin and Other Retinoid Receptor Agonists in Reproductive-Related Endpoints in the Zebrafish (Danio rerio), Journal of Toxicology and Environmental Health, Part A: Current Issues, 78:12, 747-760, DOI: 10.1080/15287394.2015.1028301 To link to this article: http://dx.doi.org/10.1080/15287394.2015.1028301
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Journal of Toxicology and Environmental Health, Part A, 78:747–760, 2015 Copyright © Taylor & Francis Group, LLC ISSN: 1528-7394 print / 1087-2620 online DOI: 10.1080/15287394.2015.1028301
EFFECTS OF TRIBUTYLTIN AND OTHER RETINOID RECEPTOR AGONISTS IN REPRODUCTIVE-RELATED ENDPOINTS IN THE ZEBRAFISH (Danio rerio) Daniela Lima1,2, L. Filipe C. Castro1,4, Inês Coelho1, Ricardo Lacerda1, Manuel Gesto1,3, Joana Soares1, Ana André1,2, Ricardo Capela1, Tiago Torres1, António Paulo Carvalho1,4, Miguel M. Santos1,4
Downloaded by [New York University] at 01:30 10 July 2015
1 Interdisciplinary Centre for Marine and Environmental Research (CIIMAR), CIMAR Associate Laboratory, University of Porto Porto, Portugal 2 ICBAS–Institute of Biomedical Sciences Abel Salazar, University of Porto, Porto, Portugal 3 Laboratory of Animal and Comparative Physiology, Faculty of Biology, University of Vigo, Campus As Lagoas-Marcosende, Vigo, Spain 4 FCUP–Department of Biology, Faculty of Sciences, University of Porto, Porto, Portugal
Both field and experimental data examined the influence of exposure to environmental contaminant tributyltin (TBT) on marine organisms. Although most attention focused on the imposex phenomenon in gastropods, adverse effects were also observed in other taxonomic groups. It has been shown that imposex induction involves modulation of retinoid signaling in gastropods. Whether TBT influences similar pathways in fish is yet to be addressed. In this study, larvae of the model teleost Danio rerio were exposed to natural retinoids, all-trans-retinoic acid, 9-cis-retinoic acid, and all-trans-retinol, as well as to the RXR synthetic pan-agonist methoprene acid (MA) and to TBT. Larvae were exposed to TBT from 5 days post fertilization (dpf) to adulthood, and reproductive capacity was assessed and correlated with mode of action. TBT significantly decreased fecundity at environmentally relevant levels at 1 µg TBT Sn/g in diet. Interestingly, in contrast to previous reports, TBT altered zebrafish sex ratio toward females, whereas MA exposure biased sex toward males. Since fecundity was significantly altered in the TBT-exposed group with up to 62% decrease, the potentially affected pathways were investigated. Significant downregulation was observed in brain mRNA levels of aromatase b (CYP19a1b) in females and peroxisome proliferator activated receptor gamma (PPARg) in both males and females, suggesting an involvement of these pathways in reproductive impairment associated with TBT.
of estrogenic compounds, perhaps because they are responsible for numerous feminization events observed (Jobling et al., 2002; Rodrigues et al., 2006; Soares et al., 2009). The effects of EDCs such as androgenic compounds have been less studied in fish (Goksoyr, 2006). Imposex in marine snails is the best characterized example of endocrine disruption in aquatic animals (Santos et al., 2000; 2005; Rotchell and Ostrander, 2003). Imposex consists in the development of male reproductive structures (penis and vas deferens) in female
In recent years, numerous studies have focused on adverse effects produced by compounds that interfere with the endocrine systems and that are generically referred to as endocrine-disrupting chemicals (EDCs) (Choi et al., 2004; Sumpter, 2005; Yoon et al., 2014). Some of these investigations involve species living in aquatic ecosystems, as aquatic ecosystems are traditionally the ultimate fate for anthropogenic substances (Sumpter, 2005; Sarria et al., 2011). Studies on EDC in fish have predominantly focused on the effects
Received 28 October 2014; accepted 9 March 2015. Address correspondence to L. Filipe C. Castro or Miguel M. Santos, CIIMAR, Rua dos Bragas, 289, 4050-123 Porto, Portugal. E-mail: [email protected] , [email protected] 747
Downloaded by [New York University] at 01:30 10 July 2015
748
D. LIMA ET AL.
FIGURE 1. Overview of the experimental design.
gastropods, mainly as a result of the exposure to tributyltin (TBT), a biocide used in the past as a component of antifouling paints in ships hulls. Although its use in antifouling paints was prohibited in 2008 (Santos et al., 2009; Barroso et al., 2011), it is still used in industrial processing such as of wood and paper, and ecologically relevant levels in water, sediments, and biota are still detected (Santos et al., 2009; Castro and Fillmann, 2012; Sousa et al., 2012; Abidli et al., 2013). In fish, other adverse outcomes have been attributed to TBT, such as alterations in male sexual behavior (Nakayama et al., 2004), decreased sperm quality and quantity (Haubruge et al., 2000; McAllister and Kime, 2003; Zhang et al., 2009b), male biased populations (McAllister and Kime, 2003; Santos et al., 2006), decreased hatchability rates (Nakayama et al., 2005; Shimasaki et al., 2006), and morphological abnormalities in larvae (Nakayama et al., 2005; Zhang et al., 2011). Surprisingly, the impact of chronic life-cycle TBT exposure on ecologically relevant endpoints such as reproductive output has seldom been addressed in fish. It was suggested that TBT masculinizing effects are a result of its potential to modulate CYP19 (aromatase),
responsible for converting androgens to estrogens (Rotchell and Ostrander, 2003). Indeed, downregulation of CYP19, at either the gene and/or protein level, is associated with increased levels of testosterone in mammals (O’Donnell et al., 2001) and development of testes in female chicken (Elbrecht and Smith, 1992) and turtles (Richard-Mercier et al., 1995). Aromatase inhibition in fish was also reported to induce the transformation of genetically female fish into phenotypic males (Fensk and Segner, 2004; Uchida et al., 2004). In gastropods, inhibition of aromatase by TBT was suggested to mediate imposex induction; however, investigators demonstrated that imposex induction involves modulation of retinoid X receptor (RXR) by TBT (Nishikawa et al., 2004; Castro et al., 2007; Lima et al., 2011). In mammals, RXR is an obligate heterodimeric partner for other nuclear receptors, such as the retinoic acid receptor (RAR), peroxisome proliferator activated receptor (PPAR), and vitamin D receptor (VDR), among others (Dawson and Xia, 2012). The mammalian RAR/RXR complex mediates the biological effects of retinoids (André et al., 2014; Castro and Santos, 2014) and is involved in (1) regulation of reproductive processes, essential
Downloaded by [New York University] at 01:30 10 July 2015
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
for gonad function and (2) control of the timing for meiosis initiation (Bowles et al., 2006). Retinoid-deficient diets interfere with reproductive capability in rodents, chickens, and fish (Livera et al., 2002; Alsop et al., 2008), whereas enhanced retinoid signaling induces developmental abnormalities (McCaffery et al., 2003). In Danio rerio (zebrafish), exposure to a retinoic acid synthesis inhibitor produced a 95% decrease in number of spawned eggs (Alsop et al., 2008), but the mechanisms involved remain unknown. In the fish Sebasticus marmoratus (cuvier), suppression of spermatogenesis by TBT was accompanied by alterations in RXR, PPAR, and estrogen receptor (ESR) mRNA levels in gonads (Zhang et al., 2009a). Considering the high RXR sequence and structural homology throughout bilaterians, one may postulate that the reported influence of TBT in fish might operate through alterations in RXR signaling, as it is known to occur in gastropods (Gesto et al., 2013; Castro and Santos, 2014). The aim of this study was to address these questions by exposing zebrafish from 5 days post fertilization (dpf) up to adulthood, 120 dpf, to TBT, to the RXR agonist methoprene acid (MA), to retinoic acid alltrans (all-trans-RA) and 9-cis-(9-cis-RA) isomers, and to all-trans-retinol, following a conceptual approach similar to that of our previous studies on gastropods (Castro et al., 2007; Lima et al., 2011). At 116 dpf, reproduction was induced and fecundity, egg viability, and hatchability rates were determined. In order to understand the molecular pathways associated with disruption of these reproductive endpoints, and to contrast the findings with our data on gastropods, qualitative polymerase chain reaction (qPCR) analysis of gene transcripts was also conducted. Since reproduction in fish is controlled through the hypothalamus– pituitary–gonad axis, our study focused on target genes in adult brain and gonad. The potentially affected genes investigated are involved in retinoid signaling, including RXR and PPARg, and in reproduction ESR, CYP19, and vitellogenin (VTG). Zebrafish was the animal model selected for this study due to its sensitivity
749
to both androgenic and estrogenic chemicals (Santos et al., 2006), as well as to chemicals disrupting the retinoid signaling pathways (Alsop et al., 2008). This species is easy to maintain and reproduce in the lab, and the full genome sequence is available. Hence, the assessment of D. rerio reproductive fitness may thus be used to provide clues and new data in order to estimate the ecological relevance and population impacts resulting from exposure to EDC, while at the same time the affected molecular pathways can be addressed.
EXPERIMENTAL Chemicals and Concentrations Used TBTCl (96%), 9-cis-RA, all-trans-RA, alltrans-retinol, and MA were obtained from Sigma-Aldrich. These compounds were dissolved in acetone and incorporated in the diet at the following nominal concentrations, per wet mass: 1 μg TBT Sn/g (i.e., 2.74 μg TBTCl/g), 5 μg/g (for both 9-cis-RA and all-trans-RA), 250,000 IU/kg (retinol), and 25 μg/g (MA). The selection of these concentrations was based on previous studies with gastropods (Castro et al., 2007) and fish (Shimasaki et al., 2003; Santos et al., 2006; Alsop et al., 2008). Previous studies showed that full-lifecycle exposure to TBT through the diet at concentrations of 25–100 ng TBTSn/g in zebrafish and 0.1–1 μg TBTSn/g in the Japanese flounder (Shimasaki et al., 2003; Santos et al., 2006) induced a bias of sex toward male. Based on these early findings, a TBT concentration in the diet of 1 μg TBT Sn/g was selected. This TBT level in the diet is of environmental relevance since fish preys with TBT tissue levels of the same order were detected worldwide (Santos et al., 2009). Considering that the aim was to compare TBT effects with that of compounds expected to act on the same signaling pathways (i.e., retinoid signaling), we selected MA, RA, and retinol doses in the same range as the TBT dose and with the same conceptual approach that our previous studies with gastropods followed (Castro et al., 2007; Coelho et al., 2013). Further, normal retinol requirements in fish
750
D. LIMA ET AL.
range from 20,000 to 50,000 IU/kg (Alsop et al., 2008), and our control diet contained 20,000 IU/kg of retinol. Therefore, our treatment diet containing 250,000 IU/kg of retinol aimed at studying the effects of excess retinoid administration throughout the life cycle.
Downloaded by [New York University] at 01:30 10 July 2015
Diet Formulation Fish diet was formulated as described elsewhere (Santos et al., 2006). The diet contained the following composition (% of dry matter): fish flour (61%), CPSP, a fish protein concentrate used as appetizer (5%), vitamin complex (1%), mineral complex (1%), choline chloride at 60% (0.5%), cod liver oil (3%), dextrin (27.5%), and ligand (1%); retinyl acetate (SIGMA) was added to 20,000 IU/kg. Overall, the diet displayed 50% crude protein and 10% crude fat. After formulation of the diets, chemicals were incorporated using acetone as vehicle, and placed in an oven at 37◦ C to allow full evaporation of acetone (Gesto et al., 2012a). This procedure was performed in the dark to minimize photodegradation. Chemical Analysis In order to confirm the adequacy of the methodology used to spike the diet, the actual concentrations of the retinoids in the diets were confirmed by high-performance liquid chromatography (HPLC) as described by Gesto et al. (2012a, 2012b). Concentrations of retinoids (9-cis-RA, all-trans-RA, all-trans-retinol) were within 80–90% of the nominal levels. A solution of TBT of 1 mg TBT Sn/ml in acetone was used as stock to spike the diet. Actual concentration of this stock solution was confirmed according to the methodology described in detail by Carvalho et al. (2009), and actual TBT concentration in the diet was 600 ngTBTSn/g, with recovery rates of approximately 50%. Parental Generation and Larvae Production In this experiment, D. rerio larvae were exposed to different treatments at 5 dpf. Our
breeding stock, wild-type zebrafish obtained from local suppliers in Singapore, was maintained in a 250-L aquarium equipped with biological and mechanical filters, at 28 ± 1◦ C, under a photoperiod of 14:10 h (light:dark), and fed twice per day ad libitum with commercial fish food Tetramin to ensure maximum fertility (Soares et al., 2009). The day before reproduction, 6–8 males were housed with 8–10 females in a reproduction cage, with a net bottom with marbles, suspended in a 30L aquarium at 28 ± 1◦ C. The next morning, 1.5 h after lights were turned on, animals were removed, eggs collected, cleaned, and fertilized eggs were placed in 5-L aquaria up to 5 dpf. By that time, larvae were randomly distributed among experimental treatments.
Exposure Conditions For the present study, a flow-through system consisting of 13 tanks was used, consisting of 3 replicates for the control and 2 for each of the other treatments: TBT, 9-cis-RA, all-transRA, MA, and retinol. From 5 dpf up to 21 dpf, larvae were kept in 5-L aquaria, and were transferred to 30-L aquaria after 21 dpf. The flow-throw system was designed to allow daily full renewal of water, which was previously dechlorinated and filtrated (40 L/d). Water temperature was maintained around 28 ± 1◦ C. Other water parameters (pH, oxygen concentration, and ammonia) were checked every week to ensure consistency among replicates and adequate levels for zebrafish development. Fish were kept under a 14:10 h photoperiod (light:dark) and continuous aeration. The experiment started at 5 dpf with 330 larvae per replicate, and fish density was adjusted throughout the test, to 115 and 32 fish at 25 and 60 dpf, respectively. Tanks were cleaned every other day by siphoning the bottom to prevent accumulation of feces and deterioration of water quality. Mortality was registered daily and dead animals were removed. Fish were exposed from 5 dpf up to 120 dpf to different treatments via food. Animals were fed this diet three times per day. Every other day, animals
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
received a supplement of brine shrimp (Artemia spp.), freshly hatched for 24 h/48 h.
Downloaded by [New York University] at 01:30 10 July 2015
Assessment of Reproductive Capacity Reproductive tests were performed for 5 consecutive days between 116 and 120 dpf. Experimental aquaria were divided in two by a polypropylene plate, and in each division a suspended reproduction cage was placed (Soares et al., 2009). Animals were randomly assigned to each cage, but sex ratio was maintained as much as possible. Thus, for each treatment there were four replicates (six in the case of the control). Reproduction was induced as described in the Parental Generation and Larvae Production section, during 5 consecutive days. At 11/2 h after initiation of the light phase, eggs were collected, nonfertilized eggs discharged, and the remaining eggs were stored in 96% ethanol at –20◦ C for posterior quantification. In addition, 80 fertilized eggs were collected per replicate and incubated for 5 d to determine percent hatched larvae. Egg viability rate was calculated as percent ratio between fertilized eggs and total egg number, fecundity as the average number of eggs per female per day, and hatchability as percent of hatched larvae. At the end of the experiment, animals were anesthetized with ethyl 3-aminobenzoate methanesulfonate salt (MS-222), at a concentration of 300 mg/L. Fish size was measured to the nearest millimeter, weight was determined, and each body was dissected under a stereomicroscope. Brain, liver, and gonads were excised and stored in RNAlater (Ambion). Condition factor of the fish was determined using the formula weight/length3 × 100 (Pauly, 1983). Gene Transcription Analysis Based on the morphometric data and reproductive endpoints, control and TBTexposed animals underwent additional gene transcription studies. RNA extraction was performed from adult brain, liver, and gonads. RNA was extracted using the animal tissues protocol of the illustra RNAspin Mini
751
RNA Isolation Kit (GE), with on-column DNAse digestion. RNA was quantified using a Nanodrop spectrophotometer by measuring sample absorbance at 260 nm. The cDNA synthesis was performed with the iScriptTMcDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions using 150 ng of total RNA to produce 20 μl cDNA. For qPCR quantifications a 200-nM final primer concentration was used and cDNA sample dilution was optimized for each gene. Samples were run in duplicate and in every plate were included a no-template control and a standard curve. The qPCR primers and annealing temperatures used in this study are detailed in Table 1. Primers were designed using the software Beacon Designer 5. For each gene, qPCR annealing temperatures were optimized and reaction efficiencies determined using standard curves, with serial dilutions of experimental samples cDNA. For all genes, reaction efficiencies ranged from 90 to 105%. Amplification cycles consisted of 15 min denaturation at 95◦ C, followed by 35 cycles of 10 s of denaturation at 95◦ C, 30 s of hybridization (temperature depending on the primers; see Table 2), and 30 s of extension at 72◦ C. The expression of each gene in different tissues was normalized to the reference gene mRNA levels and calculated using the formula 2−Ct (Livak and Schmittgen, 2001). An elongation factor 1α (ef1a) was used as the reference gene in brain and gonad, but it was not stable in liver. Therefore, β-actin was used to normalize liver VTG1 qPCR results. Transcription levels of CYP19a1b, CYP19a1a, ESR2a, and ESR2b were also quantified. The mRNA transcripts of VTG1, an important gene for oogenesis that encodes the egg yolk precursor vitellogenin (VTG), was quantified in liver. As TBT is a mammalian and molluskan RXR agonist, zebrafish RXR gonadal levels were determined. Zebrafish rxrba was the isoform analyzed, since it was affected by TBT exposure in S. marmoratus (Zhang et al., 2009a). Finally, PPARg mRNA levels were also investigated as a possible target of TBT exposure, given TBT’s agonistic potential toward human PPARγ (Kanayama et al., 2005;
752
D. LIMA ET AL.
TABLE 1. Primer Sequences and Annealing Temperatures Used in qPCR Determinations Primer
Primer sequence
Annealing temperature (◦ C)
actb2
F: 5 ACTGTATTGTCTGGTGGTAC 3 R: 5 TACTCCTGCTTGCTAATCC 3 F: 5 GGACACAGAGACTTCATCAAGAAC 3 R: 5 ACCAACACCAGCAGCAACG 3 F: 5 CTCCAAACCCAATCAGTTCA 3 R: 5 GACAGCAGAGCCACCAGAATA 3 F: 5 AGATACAGTCTCAGATAGG 3 R: 5 CCAATGTTCAGGATTAGG 3 F: 5 TGCTGGACTCGGTGACTG 3 R: 5 GAGGAACCATCTTCTTCATCT 3 F: 5 CCCAGAAAACCTTCACACATC 3 R: 5 TGTCTTGTTCACCGTCTCCTC 3 F: 5 GGTTTCATTACGGCGTTCAC 3 R: 5 TGGTTCACGTCACTGGAGAA 3 F: 5 CTTACGACACAGGATTCAG 3 R: 5 GTCTTCATAGGTCTCAATGG 3
60
ef1a cyp19a1a cyp19a1b esr2a esr2b pparg
Downloaded by [New York University] at 01:30 10 July 2015
vtg1
54 60 55 58 58 60 58
TABLE 2. Morphometric Parameters at the End of the Exposure Experiment
Control TBT 9-cis-RA All-trans-RA MA Retinol
Total Length (mm)
Total weight (mg)
Female
Male
Female
41.4 ± 2.2a 39.1 ± 2.4b 41.6 ± 2.9a 41.4 ± 2.9a 42.5 ± 1.9a 41.8 ± 1.6a
39.4 ± 1.9 40.5 ± 3.2 39.3 ± 2.6 40.5 ± 1.4 40.8 ± 1.7 40.0 ± 1.6
828.5 ± 158.5a 727.8 ± 198.5b 889.3 ± 194.4a 887.7 ± 203.7a 945.9 ± 161.2a 833.1 ± 116.6a
Gonad weight (mg)
Condition factor
Male
Female
Female
Male
606.8 ± 73.1 639.6 ± 106.1 589.3 ± 92.1 660.9 ± 75.5 665.7 ± 74.0 630.5 ± 83.4
122.3 ± 64.3 110.4 ± 75.2 169.6 ± 84.6 136.6 ± 57.8 142.6 ± 53.2 129.7 ± 52.2
1.2 ± 0.2 1.2 ± 0.2 1.2 ± 0.1 1.2 ± 0.1 1.2 ± 0.1 1.1 ± 0.2
1.0 ± 0.1 1.0 ± 0.2 1.0 ± 0.1 1.0 ± 0.1 1.0 ± 0.1 1.0 ± 0.1
Male 6.8 ± 1.6a 8.6 ± 2.3b 7.1 ± 2.3a 7.6 ± 1.4a 7.6 ± 1.8a 7.3 ± 1.7a
Note. For each parameter and sex, different letters correspond to significant differences (p < .05). Values presented as mean ± standard error (n = 18–35). A one-way ANOVA, followed by Newman–Keuls multiple comparison test, was used for female and male total weight, male gonad weight, and total length. For the other parameters, a Kruskal–Wallis nonparametric ANOVA was performed, followed by a multiple comparison test.
Zhang et al., 2009a), and the presence of PPAR-responsive elements in the promoter zone of zebrafish CYP19 (Kazeto et al., 2001; Kanayama et al., 2005). Statistical Analysis In order to examine treatment effects on the biological parameters studied, a one-way analysis of variance (ANOVA) was used, followed by the Newman–Keuls multiple comparison test (confidence level of 95%). When data did not fit the ANOVA assumptions for normality (Kolmogorov–Smirnov/Shapiro–Wilks) and homogeneity of variance (Levene), the Kruskal– Wallis nonparametric ANOVA was used, followed by multiple comparisons of mean ranks for all groups. A chi-squared test, using the
control as expected values, was used to compare the sex ratio between control and other treatments. For the qPCR results, data were compared to the corresponding control, for each tissue and sex, by a Mann–Whitney Utest. These analyses were performed using Statistica Software 7.0. The criterion for significance was set at p < .05.
RESULTS AND DISCUSSION Biological Parameters Mortality Mortality was recorded throughout the experiment and no marked differences were observed among treatments (data not shown). From 5 to 25 dpf (critical period), mortality rates were all below 20%,
Downloaded by [New York University] at 01:30 10 July 2015
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
which is similar to the levels observed in other studies during this period (Santos et al., 2006). From 25 dpf to the end of exposure, mortalities were similar between treatments and did not exceed 6%. Morphometric Data and Condition Factor TBT was the only treatment that significantly altered the morphometric endpoints examined in females (Table 2). However, the effects on females were different from those observed in males. In comparison to the control, TBT-exposed females were significantly smaller and weighed less, while no marked changes in total length and weight were found in males. For gonad weight, TBT treatment resulted in males with heavier testes but it did not markedly affect female ovary size. To our knowledge, sex-specific alterations of weight and length in fish have apparently not been reported previously with TBT exposure. In a recent study with juvenile salmon, Salmo salar, a 55-d exposure to low TBT levels (0.06 to 0.55 nmol/g of TBT in diet) increased total length and body weight, whereas an opposite pattern was observed at the highest doses (Meador et al., 2011). A similar effect was noted in male mice (Cooke et al., 2008; Si et al., 2011), but data from other vertebrates are scarce and mechanisms involved are yet to be fully elucidated (Santos et al., 2012). Interestingly, immature males of rockfish exposed to 100 ng/L TBT (as Sn) for 48 d showed increased total lipids and lipid droplets in the testis (Zang et al., 2009a). Hence, it is of interest to determine in future studies whether the rise in male testis weight in TBT-exposed group observed may also be related to fat accumulation. Reproductive Endpoints The overall results of reproductive endpoints are displayed in Table 3. The average number of eggs per female was significantly lower in TBT-exposed fish, which corresponds to a reduction of 62% in fecundity in comparison to control. Despite the fall in fecundity in TBT-exposed animals, no significant differences were observed for egg viability and hatchability in any of the experimental groups.
753
The changes in total length and weight of TBT-exposed females might be associated with decrease in fecundity noted in TBT-exposed zebrafish. This is consistent with the observation in several fish species where larger females tend to display higher breeding capacity. Several previous reports demonstrated that TBT, at environmentally relevant doses, affects male and female fish gonad development and population sex ratio (McAllister and Kime, 2003; Santos et al., 2006; Zhang et al., 2007, 2009a). However, alterations in the chronic life cycle impacting fecundity, a key ecologically relevant endpoint, have seldom been demonstrated. Although inhibition of RA synthesis was reported to reduce egg production in zebrafish (Alsop et al., 2008), the effects of excess retinoid signaling on fish reproduction have apparently not previously been studied. In the present investigation, only TBT significantly altered female fecundity, decreasing egg production by 62% in comparison to the control. In addition to the influence on fecundity, in a previous study parental TBT exposure also decreased egg viability and larvae hatchability (Nakayama et al., 2005). In our study, TBT exposure did not significantly affect egg viability and larvae hatchability. Sex Ratio The overall sex ratios per treatment group are displayed in Table 3. With the exception of TBT and MA, treatments did not induce significant changes in the male:female ratio with respect to the control. The TBT group, however, demonstrated a female proportion significantly higher in comparison to control. Conversely, MA displayed a significant increase in the percentage of males in comparison to control. Interestingly, previous studies reported a masculinizing effect of TBT in zebrafish when exposed during the sex differentiation period (McAllister and Kime, 2003; Santos et al., 2006). In contrast to these two studies, an rise in the percentage of females in the TBTexposed groups was found. Danio rerio is a gonochoristic species, with undifferentiated juvenile gonads that present immature oocytes
754
D. LIMA ET AL.
TABLE 3. Sex Ratio and Reproductive Parameters From the Breeding Trials Performed at the End of the Experimental Period
Treatment
Fecundity (eggs/female/day)
Viability (%)
Hatchability (%)
Female %
Control TBT 9-cis-RA All-trans-RA MA Retinol
113.6 ± 27.7a 43.0 ± 19.5b 111.0 ± 47.8a 134.0 ± 38.3a 112.6 ± 6.3a 80.8 ± 24.3ab
94.9 ± 1.6 84.1 ± 15.9 94.0 ± 4.9 92.1 ± 2.6 95.3 ± 3.2 96.3 ± 2.0
92.4 ± 4.3 80.6 ± 7.7 95.8 ± 3.4 84.5 ± 14.4 91.9 ± 4.3 89.5 ± 9.4
51.6 63.8∗ 49.2 47.2 40.4∗ 50.7
Downloaded by [New York University] at 01:30 10 July 2015
Note. For each parameter, different letters correspond to significant differences (p < .05). Values presented as mean ± standard error (n = 45–70 for sex ratio; n = 4 independent reproduction trials). Egg viability and hatchability were analyzed using a nonparametric ANOVA. For female fecundity a parametric ANOVA was performed, followed by a Newman–Keuls multiple comparison test. Asterisk indicates significant differences in sex ratio in comparison with the control group (chi-squared test).
that either mature and grow into an ovary, or enter into apoptosis and originate testes (Segner, 2009). In zebrafish, as in other fish species, sex determination is a labile process that may be influenced by environmental factors, but also by exposure to hormones and EDC (Rotchell and Ostrander, 2003; Andersen et al., 2003; Goksoyr, 2006). Although TBT was reported to disrupt sex ratio toward males, recent studies indicated the complex nature of endocrine disruption by this compound (McGinnis and Crivello, 2011; Zhang et al., 2013). In an attempt to elucidate the mechanisms of endocrine disruption induced by TBT in zebrafish, McGinnis and Crivello (2011) screened the transcription of genes typically associated with female and male sex differentiation and concluded that exposure to TBT in adulthood induced an overall masculinizing effect tempered by feminizing effects in both gonads and brain. Interestingly, the masculinizing effects of TBT in fish were not observed throughout all teleost groups. Life-cycle exposure of medaka to a range of TBT concentrations failed to induce a sex ratio bias toward males (Kuhl and Brower, 2006). Further, a recent study with several zebrafish strains indicated that not all strains respond similarly to several EDC (Brown el al., 2012). In addition, TBT and some other EDC were found to display an inverted U-shape response for several endpoints, depending on the concentration. A good example is the impact of TBT on body weight in fish and mammals (Cooke et al., 2008; Meador et al., 2011; Si et al.,
2011). Hence, one cannot rule out the hypothesis that the feminizing effects noted might be strain or concentration related, and therefore an interesting observation that warrants future study. qPCR Determinations Given that for the morphometric and reproductive parameters assayed only TBT exposure induced significant alterations, effort was put into understanding the possible mode of action (MOA) of this compound at the molecular level. Results are displayed in Table 4. No marked differences were observed in gonads for the aromatase CYP19a1a gene. In female brain, however, TBT exposure significantly decreased CYP19a1b mRNA levels. A brain-specific downregulation in PPARg mRNA levels was observed, in both females and males. No marked differences were observed in gonads. No significant alteration was detected for ESR2a and ESR2b mRNA levels in brain or gonads of the animals exposed to TBT. No differences were observed in gonad RXRba transcripts. As expected, VTG1 transcript levels in females were higher than in males, although none of the groups differed significantly from control animals. In the gastropod Nucella lapillus, exposure to the proposed RXR natural ligand, 9-cis-RA, and the specific agonist MA, at similar TBTconcentration range, led to imposex induction (Castro et al., 2007). Hence, in order to attain great insights into the MOA of TBT, it
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
755
TABLE 4. Summary of qPCR Gene Transcription Results for Zebrafish: cyp19a1a, cyp19a1b, PPARg, ESR2a, ESR2b, VTG1, and RXRba Control Female cyp19a1a cyp19a1b pparg esr2a esr2b
Downloaded by [New York University] at 01:30 10 July 2015
rxrba vtg1 Male cyp19a1a cyp19a1b pparg esr2a esr2b rxrba vtg1
TBT
p
Gonad Brain Brain Gonad Brain Gonad Brain Gonad Gonad Liver
1.89 ± 0.32 5.17 ± 0.71 0.60 ± 0.07 6.17 ± 0.83 0.12 ± 0.01 0.24 ± 0.04 0.25 ± 0.03 0.26 ± 0.05 1.04 ± 0.12 66.27 ± 19.77
2.31 ± 0.51 3.35 ± 0.20 0.24 ± 0.03 7.13 ± 0.95 0.14 ± 0.01 0.21 ± 0.02 0.27 ± 0.04 0.18 ± 0.02 1.17 ± 0.46 26.67 ± 5.92
0.81 0.03 0.002 0.37 0.11 0.96 0.86 0.49 1.00 0.77
Gonad Brain Brain Gonad Brain Gonad Brain Gonad Gonad Liver
0.03 ± 0.01 3.42 ± 0.39 0.75 ± 0.09 1.15 ± 0.16 0.12 ± 0.01 0.25 ± 0.03 0.26 ± 0.02 1.02 ± 0.05 0.53 ± 0.05 0.000013 ± 0.00001
0.02 ± 0.01 3.34 ± 0.30 0.32 ± 0.03 2.00 ± 0.82 0.09 ± 0.04 0.18 ± 0.08 0.15 ± 0.08 0.57 ± 0.25 0.63 ± 0.06 0.001062 ± 0.0006
1.00 0.67 0.007 0.42 0.57 0.26 0.32 0.20 0.56 0.16
Note. Values are mean ± standard error (n = 3–10) and represent mRNA normalized transcription levels, calculated using the 2−Ct relative to the average CT of all samples. A Mann–Whitney U-test was used to compare differences in gene transcription between control and TBT-exposed fish.
was hypothesized that several negative effects of TBT in fish may also be associated with modulation of RXR signaling pathways, since RXR is highly conserved throughout metazoans. Therefore, an experimental design similar to that of Castro et al. (2007) was followed, exposing zebrafish to RXR agonists through their life cycle. Although 9-cis-RA and MA are described, respectively, as the natural ligand and agonist of RXR in mammals, neither of them induced marked changes similar to those found in animals exposed to TBT. Nevertheless, MA also affected the sex ratio leading to a bias of sex toward males, which is comparable to previous findings in zebrafish under lower TBT exposure (Santos et al., 2006). The lack of any apparent effects of 9-cis-RA suggests that the impact of TBT in morphometric and reproductive endpoints is RXR independent. However, caution needs to be taken in such interpretations since the patterns of metabolism, tissue distribution, excretion, and/or bioaccumulation of RXR agonists are unknown in zebrafish. Changes in these parameters may account for
the observed differences between TBT and other tested compounds. Further, since RXR is a heterodimeric pattern of several nuclear receptors, such as PPAR, VDR, PXR, and TR, one cannot rule out the postulation that the effect of TBT reported here may be mediated through a heterodimeric partner. Inhibition of aromatase, the enzyme mainly considered responsible for conversion of androgens into estrogens in vertebrates, was previously suggested as the mechanism underlying TBT masculinization in fish (McAllister and Kime, 2003; Santos et al., 2006). In the present study, a female-specific and significant decrease was observed in the transcription of the aromatase gene brain isoform (CYP19a1b), while no marked changes were detected in gonads and in males. Although an opposite pattern of CYP19a1b gene expression in female brain may be attributed to elevation in proportion of females in the TBTexposed group, caution needs to be taken in the interpretation of these findings, since sex differentiation in zebrafish is sensitive to
Downloaded by [New York University] at 01:30 10 July 2015
756
TBT exposure only up to 40 dpf and our gene expression studies were carried out during the adult stage. This result is consistent with previous findings for zebrafish (McAllister and Kime, 2003) and juvenile salmon (Lyssimachou et al., 2006). In S. marmoratus, despite an increase in CYP19a1b levels in males and no changes in females, elevated testosterone and decreased 17-β estradiol serum levels were observed in females, but no marked alterations found in males (McGinnis and Crivello, 2011; Zhang et al., 2013). An interaction of TBT with PPAR:RXR heterodimers is an alternative scenario for mediating its influence on aromatase, as TBT is a potent agonist for mammalian RXR and PPARγ. In human granulosa cells, coexposure to the PPARγ and RXR agonists troglitazone and LG100268, respectively, inhibited both aromatase activity and mRNA transcripts levels (Yanase et al., 2001). Further, another PPARγ agonist, mono (2ethylhexyl) phthalate (MEHP), was shown to reduce aromatase activity in rat ovarian cells via PPAR:RXR (Lovekamp-Swan et al., 2003). In zebrafish, Riu et al. (2014) recently demonstrated that TBT did not transactivate PPARγ, although TBT induced a marked obesogenic response, a phenomenon known to be mediated through the PPAR:RXR heterodimer. Given that this heterodimer is permissive, being activated by both PPARγ and RXR ligands, it was proposed that induction of this pathway in zebrafish by TBT exposure occurs through RXR. In the current study, a decrease in PPARg levels in brain samples was also detected in the TBT-exposed group. Interestingly, Pascoal et al. (2013) demonstrated that the selective PPARγ agonist rosiglitazone induces imposex in the neogastropod N. lapillus at the same concentration range as TBT. This recent finding correlates well with the observed impact of TBT on brain PPARg and CYP19a1b reported here. The transcription levels of other genes associated with reproductive processes were also quantified, but no significant changes in ESR2a, ESR2b, and VTG1 transcript levels were detected.
D. LIMA ET AL.
CONCLUSIONS Overall, the results presented in this study highlight the complex nature of TBT as an endocrine disruptor in fish, demonstrating that environmental relevant concentrations affect fish fecundity. Evidence indicates that the impact of TBT on biological endpoints reported here may involve the modulation of PPARγ/RXR and brain aromatase genes. Future studies need to focus on modulation of TBT and other EDC on this pathway in brain, and their relationship with reproductive output. ORCID Miguel M. Santos 0001-7347-0546
http://orcid.org/0000-
FUNDING This research was supported by the FCT project PTDC/MAR/115199/2009 and by the European Regional Development Fund (ERDF) through the COMPETE - Operational Competitiveness Programme and national funds through FCT–Foundation for Science and Technology, under the project PEst-C/MAR/ LA0015/2013. D. Lima was a recipient of a PhD fellowship from Fundação para a Ciência e a Tecnologia (SFRH/BD/41561/2007). Joana Soares was a recipient of a PhD fellowship from Fundação para a Ciência e a Tecnologia (SFRH/BD/30211/2006), and Ana André was a recipient of fellowship (SFRH/BPD/8124/ 2011) . M. Gesto was a recipient of postdoctoral fellowships from Fundação para a Ciência e a Tecnologia– FCT (Portugal, SFRH/BPD/ 47572/2008) and Xunta de Galicia (Spain, Ángeles Alvariño program). REFERENCES Abidli, S., Lahbib, Y., González, P. R., Alonso, J. I. G., and Trigui El Menif, N. 2013. Imposex and butyltin burden in Bolinus brandaris (Mollusca, Gastropoda) and sediment
Downloaded by [New York University] at 01:30 10 July 2015
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
from the Tunisian coast. Hydrobiologia 714: 13–24. Alsop, D., Matsumoto, J., Brown, S., and Kraak, G. V. D. 2008. Retinoid requirements in the reproduction of zebrafish. Gen. Comp. Endocrinol. 156: 51–62. Andersen, L., Holbech, H., Gessbo, A., Norrgren, L., and Petersen, G. I. 2003. Effects of exposure to 17alpha-ethinylestradiol during early development on sexual differentiation and induction of vitellogenin in zebrafish (Danio rerio). Comp. Biochem. Physiol. C 134: 365–374. André, A., Ruivo, R., Gesto, M., Castro, L. F. C., and Santos, M. M. 2014. Retinoid metabolism in invertebrates: When evolution meets endocrine disruption. Gen. Comp. Endocrinol. 208: 134–145. Barroso, C. M., Rato, M., Veríssimo, A., Sousa, A., Santos, J. A., Coelho, S., Gaspar, M. B., Maia, F., and Galante-Oliveira, S. 2011. Combined use of Nassarius reticulatus imposex and statolith age determination for tracking temporal evolution of TBT pollution in the NW Portuguese continental shelf. J. Environ. Monit. 13: 3018–3025. Bowles, J., Knight, D., Smith, C., Wilhelm, D., Richman, J., Mamiya, S., Yashiro, K., Chawengsaksophak, K., Wilson, M. J., Rossant, J., Hamada, H., and Koopman, P. 2006. Retinoid signaling determines germ cell fate in mice. Science 312: 596–600. Brown, A. R., Bickley, L. K., Ryan, T. A., Paull, G. C., Hamilton, P., B., Owen, S. F., Sharpe, A. D., and Tyler, C. R. 2012. Differences in sexual development in inbred and outbred zebrafish (Danio rerio) and implications for chemical testing. Aquat. Toxicol. 112–113:27–38. Carvalho, P. N., Rodrigues, P. N., Basto, M. C., and Vasconcelos, M. T. 2009. Butyltin levels in several Portuguese coastal areas. Environ. Monit. Assess. 159: 183–190. Castro, I. B., and Fillmann, G. 2012. High tributyltin and imposex levels in the commercial muricid Thais chocolata from two Peruvian harbor areas. Environ. Toxicol. Chem. 31: 955–960.
757
Castro, L. F. C., Lima, D., Machado, A., Melo, C., Hiromori, Y., Nishikawa, J., Nakanishi, T., Reis-Henriques, M. A., and Santos, M. M. 2007. Imposex induction is mediated through the retinoid X receptor signaling pathway in the neogastropod Nucella lapillus. Aquat. Toxicol. 85: 57–66. Castro, L. F. C., and Santos, M. M. 2014. To bind or not to bind: The taxonomic scope of nuclear receptor mediated endocrine disruption in invertebrate phyla. Environ. Sci. Technol. 48: 5361–5363 Choi, S. M., Yoo, S. D., and Lee, B. M. 2004. Toxicological characteristics of endocrinedisrupting chemicals: Developmental toxicity, carcinogenicity, and mutagenicity. J. Toxicol. Environ. Health B 7: 1–24. Coelho, I., Lima, D., André, A., Melo, C., Ruivo, R., Reis-Henriques, M. A., Santos, M. M., and Castro, L. F. C. 2013. Molecular characterization of ADH3 from the mollusc Nucella lapillus: Tissue gene expression after tributyltin and retinol exposure. J. Mollusc. Stud. 78: 343–348. Cooke, G.M., Forsythy, D.S., Genevieve, S.B., Romain, T., and Brett, T. 2008. Organotin speciation and tissue distribution in rat dams, fetuses, and neonates following oral administration of tributyltin chloride. J. Toxicol. Environ. Health A 71: 384–395. Dawson, M. I., and Xia, Z. 2012. The retinoid X receptors and their ligands. Biochim. Biophys. Acta 1821: 21–56. Elbrecht, A., and Smith, R. G. 1992. Aromatase enzyme activity and sex determination in chickens. Science 255: 467–470. Fenske, M., and Segner, H. 2004. Aromatase modulation alters gonadal differentiation in developing zebrafish (Danio rerio). Aquat. Toxicol. 67: 105–126. Gesto, M., Castro, L. F. C., Reis-Henriques, M. A., and Santos, M. M. 2012a. Tissue-specific distribution patterns of retinoids and didehydroretinoids in rainbow trout Oncorhynchus mykiss. Comp. Biochem. Physiol. B. 161: 69–78. Gesto, M., Castro, L. F. C., Reis-Henriques, M. A., and Santos, M. M. 2012b. Retinol
Downloaded by [New York University] at 01:30 10 July 2015
758
metabolism in the mollusk Osilinus lineatus indicates an ancient origin for retinyl ester storage capacity. Plos ONE 7: e35138. Gesto, M., Castro, L. F. C., and Santos, M. M. 2013. Differences in retinoid levels and metabolism among gastropod lineages: Imposex-susceptible gastropods lack the ability to store retinoids in the form of retinyl esters. Aquat. Toxicol. 142–143:96–103. Goksoyr, A. 2006. Endocrine disruptors in the marine environment: Mechanisms of toxicity and their influence on reproductive processes in fish. J. Toxicol. Environ. Health A 69: 175–184. Haubruge, E., Petit, F., and Gage, M. J. 2000. Reduced sperm counts in guppies (Poecilia reticulata) following exposure to low levels of tributyltin and bisphenol A. Proc. R. Soc. Lond. 267: 2333–2337. Jobling, S., Coey, J., Whitmore, J. G., Kime, D. E., Van Look, J. K., McAllister, B. G., Beresford, N., Henshaw, A. C., Brighty, G., Tyler, C. R., and Sumpter, J. P. 2002. Wild intersex roach (Rutilus rutilus) have reduced fertility. Biol. Reprod. 67: 515–524. Kanayama, T., Kobayashi, N., Mamiya, S., Nakanishi, T., and Nishikawa, J.-I. 2005. Organotin compounds promote adipocyte differentiation as agonists of the peroxisome proliferator-activated receptor g/retinoid X receptor pathway. Mol. Pharmacol. 67: 766–774. Kazeto, Y., Ijiri, S., Place, A. R., Zohar, Y., and Trant, J. M. 2001. The 5 -flanking regions of CYP19A1 and CYP19A2 in zebrafish. Biochem. Biophys. Res. Commun. 288: 503–508. Kuhl, A. J., and Brouwer, M. 2006. Antiestrogens inhibit xenoestrogen-induced brain aromatase activity but do not prevent xenoestrogen-induced feminization in Japanese medaka (Oryzias latipes). Environ. Health Perspect. 114: 500–506. Lima, D., Reis-Henriques, M. A. Silva, R., Santos, A. I., Castro, L. F. C., and Santos, M. M. 2011. Tributyltin-induced imposex in marine gastropods involves tissue-specific modulation of the retinoid X receptor. Aquat. Toxicol. 101: 221–227.
D. LIMA ET AL.
Livak, K. J., and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25: 402–408. Livera, G., Rouiller-Fabre, V., Pairault, C., Levacher, C., and Habert, R. 2002. Regulation and perturbation of testicular functions by vitamin A. Reproduction 124: 173–180. Lovekamp-Swan, T., Jetten, A. M., and Davis, B. J. 2003. Dual activation of PPARalpha and PPARgamma by mono-(2-ethylhexyl) phthalate in rat ovarian granulosa cells. Mol. Cell. Endocrinol. 201: 133–141. Lubzens, E., Young, G., Bobe, J., and Cerdà, J. 2010. Oogenesis in teleosts: How fish eggs are formed. Gen. Comp. Endocrinol. 165: 367–389. Lyssimachou, A., Jenssen, B. M., and Arukwe, A. 2006. Brain cytochrome P450 aromatase gene isoforms and activity levels in Atlantic salmon after waterborne exposure to nominal environmental concentrations of the pharmaceutical ethynylestradiol and antifoulant tributyltin. Toxicol. Sci. 91: 82–92. Manning, C. S., Lytle, T. F., Walker, W. W., and Lytle, J. S. 1999. Life-cycle toxicity of bis(tributyltin) oxide to the sheepshead minnow (Cyprinodon variegatus). Arch. Environ. Contam. Toxicol. 37: 258–266. McAllister, B. G., and Kime, D. E. 2003. Early life exposure to environmental levels of the aromatase inhibitor tributyltin causes masculinisation and irreversible sperm damage in zebrafish (Danio rerio). Aquat. Toxicol. 65: 309–316. McCaffery, P. J., Adams, J., Maden, M., and Rosa-Molinar, E. 2003. Too much of a good thing: Retinoic acid as an endogenous regulator of neural differentiation and exogenous teratogen. Eur. J. Neurosci. 18: 457–472. McGinnis, C. L., and Crivello, J. F. 2011. Elucidating the mechanism of action of tributyltin (TBT) in zebrafish. Aquat. Toxicol. 103: 25–31. Meador, J. P., Sommers, F. C., Cooper, K. A., and Yanagida, G. 2011. Tributyltin and the
Downloaded by [New York University] at 01:30 10 July 2015
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
obesogen metabolic syndrome in a salmonid. Environ. Res. 111: 50–56. Nakayama, K., Oshima, Y., Nagafuchi, K., Hano, T., Shimasaki, Y., and Honjo, T. 2005. Early-life-stage toxicity in offspring from exposed parent medaka, Oryzias latipes, to mixtures of tributyltin and polychlorinated biphenyls. Environ. Toxicol. Chem. 24: 591–596. Nakayama, K., Oshima, Y., Yamaguchi, T., Tsuruda, Y., Kang, I. J., Kobayashi, M., Imada, N., and Honjo, T. 2004. Fertilization success and sexual behavior in male medaka, Oryzias latipes, exposed to tributyltin. Chemosphere 55: 1331–1337. Nishikawa, J.-I., Mamiya, S., Kanayama, T., Nishikawa, T., Shiraishi, F., and Horiguchi, T. 2004. Involvement of the retinoid X receptor in the development of imposex caused by organotins in gastropods. Environ. Sci. Technol. 38: 6271–6276. O’Donnell, L., Roberston, K. M., Jones, M. E., and Simpson, E. R. 2001. Estrogen and spermatogenesis. Endocr. Rev. 22: 289–318. Pascoal, S., Carvalho, G., Vasieva, O., Hughes, R., Cossins, A., Fang, Y., Ashelford, K., Olohan, L., Barroso, C., Mendo, S., and Creer, S. 2013. Transcriptomics and in vivo tests reveal novel mechanisms underlying endocrine disruption in an ecological sentinel, Nucella lapillus. Mol. Ecol. 22: 1589–1608. Pauly, D. 1983. Some simple methods for the assessment of tropical fish stocks. FAO Fisheries Technical Paper 234. Rome, Italy: FAO. Richard-Mercier, N., Dorizzi, M., Desvages, G., Girondot, M., and Pieau, C. 1995. Endocrine sex reversal of gonads by the aromatase inhibitor Letrozole (CGS 20267) in a turtle with temperature-dependent sex determination. Gen. Comp. Endocrinol. 100: 314–326. Riu, A., McCollum, C. W., Pinto, C. L., Grimaldi, M., Hillenweck, A., Perdu, E., Zalko, D., Bernard, L., Laudet, V., Balaguer, P., Bondesson, M., and Gustafsson, J. A. 2014. Halogenated bisphenol-A analogs act as obesogens in zebrafish larvae (Danio rerio). Toxicol Sci. 139: 48–58.
759
Rodrigues, P., Reis-Henriques, M. A., Campos, J., and Santos, M. M. 2006. Urogenital papilla feminization in male Pomatoschistus minutus from two estuaries in northwestern Iberian Peninsula. Mar. Environ. Res. 62: S258–S262. Rotchell, J.M., and Ostrander, G.K., 2003. Molecular markers of endocrine disruption in aquatic organisms. J. Toxicol. Environ. Health B 6: 453–495. Santos, M. M., Vieira, N., and Santos, A. M. 2000. Imposex in the dogwhelk Nucella lapillus(L.) along the Portuguese coast. Mar. Pollut. Bull. 40: 643–646. Santos, M. M., Castro, L. F. C., Vieira, M. N., Micael, J. Morabito, R., Massanisso, P., and Reis-Henriques, M. A. 2005. New insights into the mechanism of imposex induction in the dogwhelk Nucella lapillus. Comp. Biochem. Physiol. Toxicol. Appl. Pharmacol. 141: 101–109. Santos, M. M., Enes, P., Reis-Henriques, M. A., Kuballa, J., Castro, L. F. C., and Vieira, M. N. 2009. Organotin levels in seafood from Portuguese markets and the risk for consumers. Chemosphere 75: 661–666. Santos, M. M., Micael, J., Carvalho, A. P., Morabito, R., Booy, P., Massanisso, P., Lamoree, M., and Reis-Henriques, M. A. 2006. Estrogens counteract the masculinizing effect of tributyltin in zebrafish. Comp. Biochem. Physiol. C. 142: 151–155. Santos, M.M., Reis-Henriques, M. A., and Castro, L. F. C. 2012. Lipid homeostasis perturbation by organotins: Effects on vertebrates and invertebrates. Biochem. Biol. Effects Organotins 83–96. Sárria, M. P., Santos, M. M., Reis-Henriques, M. A., Vieira, N. M., and Monteiro, N. M., 2011. The unpredictable effects of mixtures of androgenic and estrogenic chemicals on fish early life. Environ. Int. 37: 418–424. Segner, H. 2009. Zebrafish (Danio rerio) as a model organism for investigating endocrine disruption. Comp. Biochem. Physiol. C 149: 187–195. Shimasaki, Y., Kitano, T., Oshima, Y., Inoue, S., Imada, N., and Honjo, T. 2003. Tributyltin
Downloaded by [New York University] at 01:30 10 July 2015
760
causes masculinization in fish. Environ. Toxicol. Chem. 22: 141–144. Shimasaki, Y., Oshima, Y., Inoue, S., Inoue, Y., Kang, I. J., Nakayama, K., Imoto, H., and Honjo, T. 2006. Effect of tributyltin on reproduction in Japanese whiting, Sillago japonica. Mar. Environ. Res. 62: S245–S248. Si, J., Wu, X., Wan, C., Zeng, T., Zhang, M., Xie, K., and Li, J. 2011. Peripubertal exposure to low doses of tributyltin chloride affects the homeostasis of serum T, E2, LH, and body weight of male mice. Environ. Toxicol. 26: 307–314. Soares, J., Coimbra, A. M., Reis-Henriques, M. A., Monteiro, N. M., Vieira, M. N., Oliveira, J. M., Guedes-Dias, P., Fontaínhas-Fernandes, A., Parra, S. S., Carvalho, A. P., Castro, L. F. C., and Santos, M. M. 2009. Disruption of zebrafish (Danio rerio) embryonic development after full life-cycle parental exposure to low levels of ethinylestradiol. Aquat. Toxicol. 95: 330–338. Sousa, A. C., Oliveira, I. B., Laranjeiro, F., Takahashi, S., Tanabe, S., Cunha, M. R., and Barroso, C. M. 2012. Organotin levels in Nazaré canyon (west Iberian Margin, NE Atlantic) and adjacent coastal area. Mar. Pollut. Bull. 64: 422–426. Sumpter, J. P. 2005. Endocrine disrupters in the aquatic environment: An overview. Acta Hydrochem. Hydrobiol. 33: 9–16. Uchida, D., Yamashita, M., Kitano, T., and Iguchi, T. 2004. An aromatase inhibitor or high water temperature induce oocyte apoptosis and depletion of P450 aromatase activity in the gonads of genetic female zebrafish during sex-reversal. Comp. Biochem. Physiol. A 137: 11–20.
D. LIMA ET AL.
Yanase, T., Mu., Y. M., Nishi, Y., Goto, K., Nomura, M., Okabe, T., Takayanagi, R., and Nawata, H. 2001. Regulation of aromatase by nuclear receptors. J. Steroid Biochem. Mol. Biol. 79: 187–192. Yoon, K., Kwack, S.J., Kim, H.S., and Lee, B. M. 2014. Estrogenic endocrine-disrupting chemicals: Molecular mechanisms of action on putative human diseases. J. Toxicol. Environ. Health B 17: 127–174. Zhang, J., Zuo, Z., Chen, Y., Zhao, Y., Hu, S., and Wang, C. 2007. Effect of tributyltin on the development of ovary in female cuvier (Sebastiscus marmoratus). Aquat. Toxicol. 83: 174–179. Zhang, J., Zuo, Z., He, C., Cai, J., Wang, Y., Chen, Y., and Wang, C. 2009a. Effect of tributyltin on testicular development in Sebastiscus marmoratus and the mechanism involved. Environ. Toxicol. Chem. 28: 1528–1535. Zhang, J., Zuo, Z., He, C., Wu, D., Chen, Y., and Wang, C. 2009b. Inhibition of thyroidal status related to depression of testicular development in Sebastiscus marmoratus exposed to tributyltin. Aquat. Toxicol. 94: 62–67. Zhang, J., Zuo, Z., Wang, Y., Yu, A., Chen, Y., and Wang, C. 2011. Tributyltin chloride results in dorsal curvature in embryo development of Sebastiscus marmoratus via apoptosis pathway. Chemosphere 82: 437–442. Zhang, J., Zuo, Z., Zhu, W., Sun, P., and Wang, C. 2013. Sex-different effects of tributyltin on brain aromatase, estrogen receptor, and retinoid X receptor gene expression in rockfish (Sebastiscus marmoratus). Mar. Environ. Res. 90: 113–118.
Journal of Toxicology and Environmental Health, Part A: Current Issues Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/uteh20
Effects of Tributyltin and Other Retinoid Receptor Agonists in Reproductive-Related Endpoints in the Zebrafish (Danio rerio) ab
ad
a
a
ac
Daniela Lima , L. Filipe C. Castro , Inês Coelho , Ricardo Lacerda , Manuel Gesto , Joana a
ab
a
a
ad
Soares , Ana André , Ricardo Capela , Tiago Torres , António Paulo Carvalho Santos
& Miguel M.
ad
a
Interdisciplinary Centre for Marine and Environmental Research (CIIMAR), CIMAR Associate Laboratory, University of Porto Porto, Portugal b
Click for updates
ICBAS–Institute of Biomedical Sciences Abel Salazar, University of Porto, Porto, Portugal
c
Laboratory of Animal and Comparative Physiology, Faculty of Biology, University of Vigo, Campus As Lagoas-Marcosende, Vigo, Spain d
FCUP–Department of Biology, Faculty of Sciences, University of Porto, Porto, Portugal Published online: 19 Jun 2015.
To cite this article: Daniela Lima, L. Filipe C. Castro, Inês Coelho, Ricardo Lacerda, Manuel Gesto, Joana Soares, Ana André, Ricardo Capela, Tiago Torres, António Paulo Carvalho & Miguel M. Santos (2015) Effects of Tributyltin and Other Retinoid Receptor Agonists in Reproductive-Related Endpoints in the Zebrafish (Danio rerio), Journal of Toxicology and Environmental Health, Part A: Current Issues, 78:12, 747-760, DOI: 10.1080/15287394.2015.1028301 To link to this article: http://dx.doi.org/10.1080/15287394.2015.1028301
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Journal of Toxicology and Environmental Health, Part A, 78:747–760, 2015 Copyright © Taylor & Francis Group, LLC ISSN: 1528-7394 print / 1087-2620 online DOI: 10.1080/15287394.2015.1028301
EFFECTS OF TRIBUTYLTIN AND OTHER RETINOID RECEPTOR AGONISTS IN REPRODUCTIVE-RELATED ENDPOINTS IN THE ZEBRAFISH (Danio rerio) Daniela Lima1,2, L. Filipe C. Castro1,4, Inês Coelho1, Ricardo Lacerda1, Manuel Gesto1,3, Joana Soares1, Ana André1,2, Ricardo Capela1, Tiago Torres1, António Paulo Carvalho1,4, Miguel M. Santos1,4
Downloaded by [New York University] at 01:30 10 July 2015
1 Interdisciplinary Centre for Marine and Environmental Research (CIIMAR), CIMAR Associate Laboratory, University of Porto Porto, Portugal 2 ICBAS–Institute of Biomedical Sciences Abel Salazar, University of Porto, Porto, Portugal 3 Laboratory of Animal and Comparative Physiology, Faculty of Biology, University of Vigo, Campus As Lagoas-Marcosende, Vigo, Spain 4 FCUP–Department of Biology, Faculty of Sciences, University of Porto, Porto, Portugal
Both field and experimental data examined the influence of exposure to environmental contaminant tributyltin (TBT) on marine organisms. Although most attention focused on the imposex phenomenon in gastropods, adverse effects were also observed in other taxonomic groups. It has been shown that imposex induction involves modulation of retinoid signaling in gastropods. Whether TBT influences similar pathways in fish is yet to be addressed. In this study, larvae of the model teleost Danio rerio were exposed to natural retinoids, all-trans-retinoic acid, 9-cis-retinoic acid, and all-trans-retinol, as well as to the RXR synthetic pan-agonist methoprene acid (MA) and to TBT. Larvae were exposed to TBT from 5 days post fertilization (dpf) to adulthood, and reproductive capacity was assessed and correlated with mode of action. TBT significantly decreased fecundity at environmentally relevant levels at 1 µg TBT Sn/g in diet. Interestingly, in contrast to previous reports, TBT altered zebrafish sex ratio toward females, whereas MA exposure biased sex toward males. Since fecundity was significantly altered in the TBT-exposed group with up to 62% decrease, the potentially affected pathways were investigated. Significant downregulation was observed in brain mRNA levels of aromatase b (CYP19a1b) in females and peroxisome proliferator activated receptor gamma (PPARg) in both males and females, suggesting an involvement of these pathways in reproductive impairment associated with TBT.
of estrogenic compounds, perhaps because they are responsible for numerous feminization events observed (Jobling et al., 2002; Rodrigues et al., 2006; Soares et al., 2009). The effects of EDCs such as androgenic compounds have been less studied in fish (Goksoyr, 2006). Imposex in marine snails is the best characterized example of endocrine disruption in aquatic animals (Santos et al., 2000; 2005; Rotchell and Ostrander, 2003). Imposex consists in the development of male reproductive structures (penis and vas deferens) in female
In recent years, numerous studies have focused on adverse effects produced by compounds that interfere with the endocrine systems and that are generically referred to as endocrine-disrupting chemicals (EDCs) (Choi et al., 2004; Sumpter, 2005; Yoon et al., 2014). Some of these investigations involve species living in aquatic ecosystems, as aquatic ecosystems are traditionally the ultimate fate for anthropogenic substances (Sumpter, 2005; Sarria et al., 2011). Studies on EDC in fish have predominantly focused on the effects
Received 28 October 2014; accepted 9 March 2015. Address correspondence to L. Filipe C. Castro or Miguel M. Santos, CIIMAR, Rua dos Bragas, 289, 4050-123 Porto, Portugal. E-mail: [email protected] , [email protected] 747
Downloaded by [New York University] at 01:30 10 July 2015
748
D. LIMA ET AL.
FIGURE 1. Overview of the experimental design.
gastropods, mainly as a result of the exposure to tributyltin (TBT), a biocide used in the past as a component of antifouling paints in ships hulls. Although its use in antifouling paints was prohibited in 2008 (Santos et al., 2009; Barroso et al., 2011), it is still used in industrial processing such as of wood and paper, and ecologically relevant levels in water, sediments, and biota are still detected (Santos et al., 2009; Castro and Fillmann, 2012; Sousa et al., 2012; Abidli et al., 2013). In fish, other adverse outcomes have been attributed to TBT, such as alterations in male sexual behavior (Nakayama et al., 2004), decreased sperm quality and quantity (Haubruge et al., 2000; McAllister and Kime, 2003; Zhang et al., 2009b), male biased populations (McAllister and Kime, 2003; Santos et al., 2006), decreased hatchability rates (Nakayama et al., 2005; Shimasaki et al., 2006), and morphological abnormalities in larvae (Nakayama et al., 2005; Zhang et al., 2011). Surprisingly, the impact of chronic life-cycle TBT exposure on ecologically relevant endpoints such as reproductive output has seldom been addressed in fish. It was suggested that TBT masculinizing effects are a result of its potential to modulate CYP19 (aromatase),
responsible for converting androgens to estrogens (Rotchell and Ostrander, 2003). Indeed, downregulation of CYP19, at either the gene and/or protein level, is associated with increased levels of testosterone in mammals (O’Donnell et al., 2001) and development of testes in female chicken (Elbrecht and Smith, 1992) and turtles (Richard-Mercier et al., 1995). Aromatase inhibition in fish was also reported to induce the transformation of genetically female fish into phenotypic males (Fensk and Segner, 2004; Uchida et al., 2004). In gastropods, inhibition of aromatase by TBT was suggested to mediate imposex induction; however, investigators demonstrated that imposex induction involves modulation of retinoid X receptor (RXR) by TBT (Nishikawa et al., 2004; Castro et al., 2007; Lima et al., 2011). In mammals, RXR is an obligate heterodimeric partner for other nuclear receptors, such as the retinoic acid receptor (RAR), peroxisome proliferator activated receptor (PPAR), and vitamin D receptor (VDR), among others (Dawson and Xia, 2012). The mammalian RAR/RXR complex mediates the biological effects of retinoids (André et al., 2014; Castro and Santos, 2014) and is involved in (1) regulation of reproductive processes, essential
Downloaded by [New York University] at 01:30 10 July 2015
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
for gonad function and (2) control of the timing for meiosis initiation (Bowles et al., 2006). Retinoid-deficient diets interfere with reproductive capability in rodents, chickens, and fish (Livera et al., 2002; Alsop et al., 2008), whereas enhanced retinoid signaling induces developmental abnormalities (McCaffery et al., 2003). In Danio rerio (zebrafish), exposure to a retinoic acid synthesis inhibitor produced a 95% decrease in number of spawned eggs (Alsop et al., 2008), but the mechanisms involved remain unknown. In the fish Sebasticus marmoratus (cuvier), suppression of spermatogenesis by TBT was accompanied by alterations in RXR, PPAR, and estrogen receptor (ESR) mRNA levels in gonads (Zhang et al., 2009a). Considering the high RXR sequence and structural homology throughout bilaterians, one may postulate that the reported influence of TBT in fish might operate through alterations in RXR signaling, as it is known to occur in gastropods (Gesto et al., 2013; Castro and Santos, 2014). The aim of this study was to address these questions by exposing zebrafish from 5 days post fertilization (dpf) up to adulthood, 120 dpf, to TBT, to the RXR agonist methoprene acid (MA), to retinoic acid alltrans (all-trans-RA) and 9-cis-(9-cis-RA) isomers, and to all-trans-retinol, following a conceptual approach similar to that of our previous studies on gastropods (Castro et al., 2007; Lima et al., 2011). At 116 dpf, reproduction was induced and fecundity, egg viability, and hatchability rates were determined. In order to understand the molecular pathways associated with disruption of these reproductive endpoints, and to contrast the findings with our data on gastropods, qualitative polymerase chain reaction (qPCR) analysis of gene transcripts was also conducted. Since reproduction in fish is controlled through the hypothalamus– pituitary–gonad axis, our study focused on target genes in adult brain and gonad. The potentially affected genes investigated are involved in retinoid signaling, including RXR and PPARg, and in reproduction ESR, CYP19, and vitellogenin (VTG). Zebrafish was the animal model selected for this study due to its sensitivity
749
to both androgenic and estrogenic chemicals (Santos et al., 2006), as well as to chemicals disrupting the retinoid signaling pathways (Alsop et al., 2008). This species is easy to maintain and reproduce in the lab, and the full genome sequence is available. Hence, the assessment of D. rerio reproductive fitness may thus be used to provide clues and new data in order to estimate the ecological relevance and population impacts resulting from exposure to EDC, while at the same time the affected molecular pathways can be addressed.
EXPERIMENTAL Chemicals and Concentrations Used TBTCl (96%), 9-cis-RA, all-trans-RA, alltrans-retinol, and MA were obtained from Sigma-Aldrich. These compounds were dissolved in acetone and incorporated in the diet at the following nominal concentrations, per wet mass: 1 μg TBT Sn/g (i.e., 2.74 μg TBTCl/g), 5 μg/g (for both 9-cis-RA and all-trans-RA), 250,000 IU/kg (retinol), and 25 μg/g (MA). The selection of these concentrations was based on previous studies with gastropods (Castro et al., 2007) and fish (Shimasaki et al., 2003; Santos et al., 2006; Alsop et al., 2008). Previous studies showed that full-lifecycle exposure to TBT through the diet at concentrations of 25–100 ng TBTSn/g in zebrafish and 0.1–1 μg TBTSn/g in the Japanese flounder (Shimasaki et al., 2003; Santos et al., 2006) induced a bias of sex toward male. Based on these early findings, a TBT concentration in the diet of 1 μg TBT Sn/g was selected. This TBT level in the diet is of environmental relevance since fish preys with TBT tissue levels of the same order were detected worldwide (Santos et al., 2009). Considering that the aim was to compare TBT effects with that of compounds expected to act on the same signaling pathways (i.e., retinoid signaling), we selected MA, RA, and retinol doses in the same range as the TBT dose and with the same conceptual approach that our previous studies with gastropods followed (Castro et al., 2007; Coelho et al., 2013). Further, normal retinol requirements in fish
750
D. LIMA ET AL.
range from 20,000 to 50,000 IU/kg (Alsop et al., 2008), and our control diet contained 20,000 IU/kg of retinol. Therefore, our treatment diet containing 250,000 IU/kg of retinol aimed at studying the effects of excess retinoid administration throughout the life cycle.
Downloaded by [New York University] at 01:30 10 July 2015
Diet Formulation Fish diet was formulated as described elsewhere (Santos et al., 2006). The diet contained the following composition (% of dry matter): fish flour (61%), CPSP, a fish protein concentrate used as appetizer (5%), vitamin complex (1%), mineral complex (1%), choline chloride at 60% (0.5%), cod liver oil (3%), dextrin (27.5%), and ligand (1%); retinyl acetate (SIGMA) was added to 20,000 IU/kg. Overall, the diet displayed 50% crude protein and 10% crude fat. After formulation of the diets, chemicals were incorporated using acetone as vehicle, and placed in an oven at 37◦ C to allow full evaporation of acetone (Gesto et al., 2012a). This procedure was performed in the dark to minimize photodegradation. Chemical Analysis In order to confirm the adequacy of the methodology used to spike the diet, the actual concentrations of the retinoids in the diets were confirmed by high-performance liquid chromatography (HPLC) as described by Gesto et al. (2012a, 2012b). Concentrations of retinoids (9-cis-RA, all-trans-RA, all-trans-retinol) were within 80–90% of the nominal levels. A solution of TBT of 1 mg TBT Sn/ml in acetone was used as stock to spike the diet. Actual concentration of this stock solution was confirmed according to the methodology described in detail by Carvalho et al. (2009), and actual TBT concentration in the diet was 600 ngTBTSn/g, with recovery rates of approximately 50%. Parental Generation and Larvae Production In this experiment, D. rerio larvae were exposed to different treatments at 5 dpf. Our
breeding stock, wild-type zebrafish obtained from local suppliers in Singapore, was maintained in a 250-L aquarium equipped with biological and mechanical filters, at 28 ± 1◦ C, under a photoperiod of 14:10 h (light:dark), and fed twice per day ad libitum with commercial fish food Tetramin to ensure maximum fertility (Soares et al., 2009). The day before reproduction, 6–8 males were housed with 8–10 females in a reproduction cage, with a net bottom with marbles, suspended in a 30L aquarium at 28 ± 1◦ C. The next morning, 1.5 h after lights were turned on, animals were removed, eggs collected, cleaned, and fertilized eggs were placed in 5-L aquaria up to 5 dpf. By that time, larvae were randomly distributed among experimental treatments.
Exposure Conditions For the present study, a flow-through system consisting of 13 tanks was used, consisting of 3 replicates for the control and 2 for each of the other treatments: TBT, 9-cis-RA, all-transRA, MA, and retinol. From 5 dpf up to 21 dpf, larvae were kept in 5-L aquaria, and were transferred to 30-L aquaria after 21 dpf. The flow-throw system was designed to allow daily full renewal of water, which was previously dechlorinated and filtrated (40 L/d). Water temperature was maintained around 28 ± 1◦ C. Other water parameters (pH, oxygen concentration, and ammonia) were checked every week to ensure consistency among replicates and adequate levels for zebrafish development. Fish were kept under a 14:10 h photoperiod (light:dark) and continuous aeration. The experiment started at 5 dpf with 330 larvae per replicate, and fish density was adjusted throughout the test, to 115 and 32 fish at 25 and 60 dpf, respectively. Tanks were cleaned every other day by siphoning the bottom to prevent accumulation of feces and deterioration of water quality. Mortality was registered daily and dead animals were removed. Fish were exposed from 5 dpf up to 120 dpf to different treatments via food. Animals were fed this diet three times per day. Every other day, animals
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
received a supplement of brine shrimp (Artemia spp.), freshly hatched for 24 h/48 h.
Downloaded by [New York University] at 01:30 10 July 2015
Assessment of Reproductive Capacity Reproductive tests were performed for 5 consecutive days between 116 and 120 dpf. Experimental aquaria were divided in two by a polypropylene plate, and in each division a suspended reproduction cage was placed (Soares et al., 2009). Animals were randomly assigned to each cage, but sex ratio was maintained as much as possible. Thus, for each treatment there were four replicates (six in the case of the control). Reproduction was induced as described in the Parental Generation and Larvae Production section, during 5 consecutive days. At 11/2 h after initiation of the light phase, eggs were collected, nonfertilized eggs discharged, and the remaining eggs were stored in 96% ethanol at –20◦ C for posterior quantification. In addition, 80 fertilized eggs were collected per replicate and incubated for 5 d to determine percent hatched larvae. Egg viability rate was calculated as percent ratio between fertilized eggs and total egg number, fecundity as the average number of eggs per female per day, and hatchability as percent of hatched larvae. At the end of the experiment, animals were anesthetized with ethyl 3-aminobenzoate methanesulfonate salt (MS-222), at a concentration of 300 mg/L. Fish size was measured to the nearest millimeter, weight was determined, and each body was dissected under a stereomicroscope. Brain, liver, and gonads were excised and stored in RNAlater (Ambion). Condition factor of the fish was determined using the formula weight/length3 × 100 (Pauly, 1983). Gene Transcription Analysis Based on the morphometric data and reproductive endpoints, control and TBTexposed animals underwent additional gene transcription studies. RNA extraction was performed from adult brain, liver, and gonads. RNA was extracted using the animal tissues protocol of the illustra RNAspin Mini
751
RNA Isolation Kit (GE), with on-column DNAse digestion. RNA was quantified using a Nanodrop spectrophotometer by measuring sample absorbance at 260 nm. The cDNA synthesis was performed with the iScriptTMcDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions using 150 ng of total RNA to produce 20 μl cDNA. For qPCR quantifications a 200-nM final primer concentration was used and cDNA sample dilution was optimized for each gene. Samples were run in duplicate and in every plate were included a no-template control and a standard curve. The qPCR primers and annealing temperatures used in this study are detailed in Table 1. Primers were designed using the software Beacon Designer 5. For each gene, qPCR annealing temperatures were optimized and reaction efficiencies determined using standard curves, with serial dilutions of experimental samples cDNA. For all genes, reaction efficiencies ranged from 90 to 105%. Amplification cycles consisted of 15 min denaturation at 95◦ C, followed by 35 cycles of 10 s of denaturation at 95◦ C, 30 s of hybridization (temperature depending on the primers; see Table 2), and 30 s of extension at 72◦ C. The expression of each gene in different tissues was normalized to the reference gene mRNA levels and calculated using the formula 2−Ct (Livak and Schmittgen, 2001). An elongation factor 1α (ef1a) was used as the reference gene in brain and gonad, but it was not stable in liver. Therefore, β-actin was used to normalize liver VTG1 qPCR results. Transcription levels of CYP19a1b, CYP19a1a, ESR2a, and ESR2b were also quantified. The mRNA transcripts of VTG1, an important gene for oogenesis that encodes the egg yolk precursor vitellogenin (VTG), was quantified in liver. As TBT is a mammalian and molluskan RXR agonist, zebrafish RXR gonadal levels were determined. Zebrafish rxrba was the isoform analyzed, since it was affected by TBT exposure in S. marmoratus (Zhang et al., 2009a). Finally, PPARg mRNA levels were also investigated as a possible target of TBT exposure, given TBT’s agonistic potential toward human PPARγ (Kanayama et al., 2005;
752
D. LIMA ET AL.
TABLE 1. Primer Sequences and Annealing Temperatures Used in qPCR Determinations Primer
Primer sequence
Annealing temperature (◦ C)
actb2
F: 5 ACTGTATTGTCTGGTGGTAC 3 R: 5 TACTCCTGCTTGCTAATCC 3 F: 5 GGACACAGAGACTTCATCAAGAAC 3 R: 5 ACCAACACCAGCAGCAACG 3 F: 5 CTCCAAACCCAATCAGTTCA 3 R: 5 GACAGCAGAGCCACCAGAATA 3 F: 5 AGATACAGTCTCAGATAGG 3 R: 5 CCAATGTTCAGGATTAGG 3 F: 5 TGCTGGACTCGGTGACTG 3 R: 5 GAGGAACCATCTTCTTCATCT 3 F: 5 CCCAGAAAACCTTCACACATC 3 R: 5 TGTCTTGTTCACCGTCTCCTC 3 F: 5 GGTTTCATTACGGCGTTCAC 3 R: 5 TGGTTCACGTCACTGGAGAA 3 F: 5 CTTACGACACAGGATTCAG 3 R: 5 GTCTTCATAGGTCTCAATGG 3
60
ef1a cyp19a1a cyp19a1b esr2a esr2b pparg
Downloaded by [New York University] at 01:30 10 July 2015
vtg1
54 60 55 58 58 60 58
TABLE 2. Morphometric Parameters at the End of the Exposure Experiment
Control TBT 9-cis-RA All-trans-RA MA Retinol
Total Length (mm)
Total weight (mg)
Female
Male
Female
41.4 ± 2.2a 39.1 ± 2.4b 41.6 ± 2.9a 41.4 ± 2.9a 42.5 ± 1.9a 41.8 ± 1.6a
39.4 ± 1.9 40.5 ± 3.2 39.3 ± 2.6 40.5 ± 1.4 40.8 ± 1.7 40.0 ± 1.6
828.5 ± 158.5a 727.8 ± 198.5b 889.3 ± 194.4a 887.7 ± 203.7a 945.9 ± 161.2a 833.1 ± 116.6a
Gonad weight (mg)
Condition factor
Male
Female
Female
Male
606.8 ± 73.1 639.6 ± 106.1 589.3 ± 92.1 660.9 ± 75.5 665.7 ± 74.0 630.5 ± 83.4
122.3 ± 64.3 110.4 ± 75.2 169.6 ± 84.6 136.6 ± 57.8 142.6 ± 53.2 129.7 ± 52.2
1.2 ± 0.2 1.2 ± 0.2 1.2 ± 0.1 1.2 ± 0.1 1.2 ± 0.1 1.1 ± 0.2
1.0 ± 0.1 1.0 ± 0.2 1.0 ± 0.1 1.0 ± 0.1 1.0 ± 0.1 1.0 ± 0.1
Male 6.8 ± 1.6a 8.6 ± 2.3b 7.1 ± 2.3a 7.6 ± 1.4a 7.6 ± 1.8a 7.3 ± 1.7a
Note. For each parameter and sex, different letters correspond to significant differences (p < .05). Values presented as mean ± standard error (n = 18–35). A one-way ANOVA, followed by Newman–Keuls multiple comparison test, was used for female and male total weight, male gonad weight, and total length. For the other parameters, a Kruskal–Wallis nonparametric ANOVA was performed, followed by a multiple comparison test.
Zhang et al., 2009a), and the presence of PPAR-responsive elements in the promoter zone of zebrafish CYP19 (Kazeto et al., 2001; Kanayama et al., 2005). Statistical Analysis In order to examine treatment effects on the biological parameters studied, a one-way analysis of variance (ANOVA) was used, followed by the Newman–Keuls multiple comparison test (confidence level of 95%). When data did not fit the ANOVA assumptions for normality (Kolmogorov–Smirnov/Shapiro–Wilks) and homogeneity of variance (Levene), the Kruskal– Wallis nonparametric ANOVA was used, followed by multiple comparisons of mean ranks for all groups. A chi-squared test, using the
control as expected values, was used to compare the sex ratio between control and other treatments. For the qPCR results, data were compared to the corresponding control, for each tissue and sex, by a Mann–Whitney Utest. These analyses were performed using Statistica Software 7.0. The criterion for significance was set at p < .05.
RESULTS AND DISCUSSION Biological Parameters Mortality Mortality was recorded throughout the experiment and no marked differences were observed among treatments (data not shown). From 5 to 25 dpf (critical period), mortality rates were all below 20%,
Downloaded by [New York University] at 01:30 10 July 2015
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
which is similar to the levels observed in other studies during this period (Santos et al., 2006). From 25 dpf to the end of exposure, mortalities were similar between treatments and did not exceed 6%. Morphometric Data and Condition Factor TBT was the only treatment that significantly altered the morphometric endpoints examined in females (Table 2). However, the effects on females were different from those observed in males. In comparison to the control, TBT-exposed females were significantly smaller and weighed less, while no marked changes in total length and weight were found in males. For gonad weight, TBT treatment resulted in males with heavier testes but it did not markedly affect female ovary size. To our knowledge, sex-specific alterations of weight and length in fish have apparently not been reported previously with TBT exposure. In a recent study with juvenile salmon, Salmo salar, a 55-d exposure to low TBT levels (0.06 to 0.55 nmol/g of TBT in diet) increased total length and body weight, whereas an opposite pattern was observed at the highest doses (Meador et al., 2011). A similar effect was noted in male mice (Cooke et al., 2008; Si et al., 2011), but data from other vertebrates are scarce and mechanisms involved are yet to be fully elucidated (Santos et al., 2012). Interestingly, immature males of rockfish exposed to 100 ng/L TBT (as Sn) for 48 d showed increased total lipids and lipid droplets in the testis (Zang et al., 2009a). Hence, it is of interest to determine in future studies whether the rise in male testis weight in TBT-exposed group observed may also be related to fat accumulation. Reproductive Endpoints The overall results of reproductive endpoints are displayed in Table 3. The average number of eggs per female was significantly lower in TBT-exposed fish, which corresponds to a reduction of 62% in fecundity in comparison to control. Despite the fall in fecundity in TBT-exposed animals, no significant differences were observed for egg viability and hatchability in any of the experimental groups.
753
The changes in total length and weight of TBT-exposed females might be associated with decrease in fecundity noted in TBT-exposed zebrafish. This is consistent with the observation in several fish species where larger females tend to display higher breeding capacity. Several previous reports demonstrated that TBT, at environmentally relevant doses, affects male and female fish gonad development and population sex ratio (McAllister and Kime, 2003; Santos et al., 2006; Zhang et al., 2007, 2009a). However, alterations in the chronic life cycle impacting fecundity, a key ecologically relevant endpoint, have seldom been demonstrated. Although inhibition of RA synthesis was reported to reduce egg production in zebrafish (Alsop et al., 2008), the effects of excess retinoid signaling on fish reproduction have apparently not previously been studied. In the present investigation, only TBT significantly altered female fecundity, decreasing egg production by 62% in comparison to the control. In addition to the influence on fecundity, in a previous study parental TBT exposure also decreased egg viability and larvae hatchability (Nakayama et al., 2005). In our study, TBT exposure did not significantly affect egg viability and larvae hatchability. Sex Ratio The overall sex ratios per treatment group are displayed in Table 3. With the exception of TBT and MA, treatments did not induce significant changes in the male:female ratio with respect to the control. The TBT group, however, demonstrated a female proportion significantly higher in comparison to control. Conversely, MA displayed a significant increase in the percentage of males in comparison to control. Interestingly, previous studies reported a masculinizing effect of TBT in zebrafish when exposed during the sex differentiation period (McAllister and Kime, 2003; Santos et al., 2006). In contrast to these two studies, an rise in the percentage of females in the TBTexposed groups was found. Danio rerio is a gonochoristic species, with undifferentiated juvenile gonads that present immature oocytes
754
D. LIMA ET AL.
TABLE 3. Sex Ratio and Reproductive Parameters From the Breeding Trials Performed at the End of the Experimental Period
Treatment
Fecundity (eggs/female/day)
Viability (%)
Hatchability (%)
Female %
Control TBT 9-cis-RA All-trans-RA MA Retinol
113.6 ± 27.7a 43.0 ± 19.5b 111.0 ± 47.8a 134.0 ± 38.3a 112.6 ± 6.3a 80.8 ± 24.3ab
94.9 ± 1.6 84.1 ± 15.9 94.0 ± 4.9 92.1 ± 2.6 95.3 ± 3.2 96.3 ± 2.0
92.4 ± 4.3 80.6 ± 7.7 95.8 ± 3.4 84.5 ± 14.4 91.9 ± 4.3 89.5 ± 9.4
51.6 63.8∗ 49.2 47.2 40.4∗ 50.7
Downloaded by [New York University] at 01:30 10 July 2015
Note. For each parameter, different letters correspond to significant differences (p < .05). Values presented as mean ± standard error (n = 45–70 for sex ratio; n = 4 independent reproduction trials). Egg viability and hatchability were analyzed using a nonparametric ANOVA. For female fecundity a parametric ANOVA was performed, followed by a Newman–Keuls multiple comparison test. Asterisk indicates significant differences in sex ratio in comparison with the control group (chi-squared test).
that either mature and grow into an ovary, or enter into apoptosis and originate testes (Segner, 2009). In zebrafish, as in other fish species, sex determination is a labile process that may be influenced by environmental factors, but also by exposure to hormones and EDC (Rotchell and Ostrander, 2003; Andersen et al., 2003; Goksoyr, 2006). Although TBT was reported to disrupt sex ratio toward males, recent studies indicated the complex nature of endocrine disruption by this compound (McGinnis and Crivello, 2011; Zhang et al., 2013). In an attempt to elucidate the mechanisms of endocrine disruption induced by TBT in zebrafish, McGinnis and Crivello (2011) screened the transcription of genes typically associated with female and male sex differentiation and concluded that exposure to TBT in adulthood induced an overall masculinizing effect tempered by feminizing effects in both gonads and brain. Interestingly, the masculinizing effects of TBT in fish were not observed throughout all teleost groups. Life-cycle exposure of medaka to a range of TBT concentrations failed to induce a sex ratio bias toward males (Kuhl and Brower, 2006). Further, a recent study with several zebrafish strains indicated that not all strains respond similarly to several EDC (Brown el al., 2012). In addition, TBT and some other EDC were found to display an inverted U-shape response for several endpoints, depending on the concentration. A good example is the impact of TBT on body weight in fish and mammals (Cooke et al., 2008; Meador et al., 2011; Si et al.,
2011). Hence, one cannot rule out the hypothesis that the feminizing effects noted might be strain or concentration related, and therefore an interesting observation that warrants future study. qPCR Determinations Given that for the morphometric and reproductive parameters assayed only TBT exposure induced significant alterations, effort was put into understanding the possible mode of action (MOA) of this compound at the molecular level. Results are displayed in Table 4. No marked differences were observed in gonads for the aromatase CYP19a1a gene. In female brain, however, TBT exposure significantly decreased CYP19a1b mRNA levels. A brain-specific downregulation in PPARg mRNA levels was observed, in both females and males. No marked differences were observed in gonads. No significant alteration was detected for ESR2a and ESR2b mRNA levels in brain or gonads of the animals exposed to TBT. No differences were observed in gonad RXRba transcripts. As expected, VTG1 transcript levels in females were higher than in males, although none of the groups differed significantly from control animals. In the gastropod Nucella lapillus, exposure to the proposed RXR natural ligand, 9-cis-RA, and the specific agonist MA, at similar TBTconcentration range, led to imposex induction (Castro et al., 2007). Hence, in order to attain great insights into the MOA of TBT, it
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
755
TABLE 4. Summary of qPCR Gene Transcription Results for Zebrafish: cyp19a1a, cyp19a1b, PPARg, ESR2a, ESR2b, VTG1, and RXRba Control Female cyp19a1a cyp19a1b pparg esr2a esr2b
Downloaded by [New York University] at 01:30 10 July 2015
rxrba vtg1 Male cyp19a1a cyp19a1b pparg esr2a esr2b rxrba vtg1
TBT
p
Gonad Brain Brain Gonad Brain Gonad Brain Gonad Gonad Liver
1.89 ± 0.32 5.17 ± 0.71 0.60 ± 0.07 6.17 ± 0.83 0.12 ± 0.01 0.24 ± 0.04 0.25 ± 0.03 0.26 ± 0.05 1.04 ± 0.12 66.27 ± 19.77
2.31 ± 0.51 3.35 ± 0.20 0.24 ± 0.03 7.13 ± 0.95 0.14 ± 0.01 0.21 ± 0.02 0.27 ± 0.04 0.18 ± 0.02 1.17 ± 0.46 26.67 ± 5.92
0.81 0.03 0.002 0.37 0.11 0.96 0.86 0.49 1.00 0.77
Gonad Brain Brain Gonad Brain Gonad Brain Gonad Gonad Liver
0.03 ± 0.01 3.42 ± 0.39 0.75 ± 0.09 1.15 ± 0.16 0.12 ± 0.01 0.25 ± 0.03 0.26 ± 0.02 1.02 ± 0.05 0.53 ± 0.05 0.000013 ± 0.00001
0.02 ± 0.01 3.34 ± 0.30 0.32 ± 0.03 2.00 ± 0.82 0.09 ± 0.04 0.18 ± 0.08 0.15 ± 0.08 0.57 ± 0.25 0.63 ± 0.06 0.001062 ± 0.0006
1.00 0.67 0.007 0.42 0.57 0.26 0.32 0.20 0.56 0.16
Note. Values are mean ± standard error (n = 3–10) and represent mRNA normalized transcription levels, calculated using the 2−Ct relative to the average CT of all samples. A Mann–Whitney U-test was used to compare differences in gene transcription between control and TBT-exposed fish.
was hypothesized that several negative effects of TBT in fish may also be associated with modulation of RXR signaling pathways, since RXR is highly conserved throughout metazoans. Therefore, an experimental design similar to that of Castro et al. (2007) was followed, exposing zebrafish to RXR agonists through their life cycle. Although 9-cis-RA and MA are described, respectively, as the natural ligand and agonist of RXR in mammals, neither of them induced marked changes similar to those found in animals exposed to TBT. Nevertheless, MA also affected the sex ratio leading to a bias of sex toward males, which is comparable to previous findings in zebrafish under lower TBT exposure (Santos et al., 2006). The lack of any apparent effects of 9-cis-RA suggests that the impact of TBT in morphometric and reproductive endpoints is RXR independent. However, caution needs to be taken in such interpretations since the patterns of metabolism, tissue distribution, excretion, and/or bioaccumulation of RXR agonists are unknown in zebrafish. Changes in these parameters may account for
the observed differences between TBT and other tested compounds. Further, since RXR is a heterodimeric pattern of several nuclear receptors, such as PPAR, VDR, PXR, and TR, one cannot rule out the postulation that the effect of TBT reported here may be mediated through a heterodimeric partner. Inhibition of aromatase, the enzyme mainly considered responsible for conversion of androgens into estrogens in vertebrates, was previously suggested as the mechanism underlying TBT masculinization in fish (McAllister and Kime, 2003; Santos et al., 2006). In the present study, a female-specific and significant decrease was observed in the transcription of the aromatase gene brain isoform (CYP19a1b), while no marked changes were detected in gonads and in males. Although an opposite pattern of CYP19a1b gene expression in female brain may be attributed to elevation in proportion of females in the TBTexposed group, caution needs to be taken in the interpretation of these findings, since sex differentiation in zebrafish is sensitive to
Downloaded by [New York University] at 01:30 10 July 2015
756
TBT exposure only up to 40 dpf and our gene expression studies were carried out during the adult stage. This result is consistent with previous findings for zebrafish (McAllister and Kime, 2003) and juvenile salmon (Lyssimachou et al., 2006). In S. marmoratus, despite an increase in CYP19a1b levels in males and no changes in females, elevated testosterone and decreased 17-β estradiol serum levels were observed in females, but no marked alterations found in males (McGinnis and Crivello, 2011; Zhang et al., 2013). An interaction of TBT with PPAR:RXR heterodimers is an alternative scenario for mediating its influence on aromatase, as TBT is a potent agonist for mammalian RXR and PPARγ. In human granulosa cells, coexposure to the PPARγ and RXR agonists troglitazone and LG100268, respectively, inhibited both aromatase activity and mRNA transcripts levels (Yanase et al., 2001). Further, another PPARγ agonist, mono (2ethylhexyl) phthalate (MEHP), was shown to reduce aromatase activity in rat ovarian cells via PPAR:RXR (Lovekamp-Swan et al., 2003). In zebrafish, Riu et al. (2014) recently demonstrated that TBT did not transactivate PPARγ, although TBT induced a marked obesogenic response, a phenomenon known to be mediated through the PPAR:RXR heterodimer. Given that this heterodimer is permissive, being activated by both PPARγ and RXR ligands, it was proposed that induction of this pathway in zebrafish by TBT exposure occurs through RXR. In the current study, a decrease in PPARg levels in brain samples was also detected in the TBT-exposed group. Interestingly, Pascoal et al. (2013) demonstrated that the selective PPARγ agonist rosiglitazone induces imposex in the neogastropod N. lapillus at the same concentration range as TBT. This recent finding correlates well with the observed impact of TBT on brain PPARg and CYP19a1b reported here. The transcription levels of other genes associated with reproductive processes were also quantified, but no significant changes in ESR2a, ESR2b, and VTG1 transcript levels were detected.
D. LIMA ET AL.
CONCLUSIONS Overall, the results presented in this study highlight the complex nature of TBT as an endocrine disruptor in fish, demonstrating that environmental relevant concentrations affect fish fecundity. Evidence indicates that the impact of TBT on biological endpoints reported here may involve the modulation of PPARγ/RXR and brain aromatase genes. Future studies need to focus on modulation of TBT and other EDC on this pathway in brain, and their relationship with reproductive output. ORCID Miguel M. Santos 0001-7347-0546
http://orcid.org/0000-
FUNDING This research was supported by the FCT project PTDC/MAR/115199/2009 and by the European Regional Development Fund (ERDF) through the COMPETE - Operational Competitiveness Programme and national funds through FCT–Foundation for Science and Technology, under the project PEst-C/MAR/ LA0015/2013. D. Lima was a recipient of a PhD fellowship from Fundação para a Ciência e a Tecnologia (SFRH/BD/41561/2007). Joana Soares was a recipient of a PhD fellowship from Fundação para a Ciência e a Tecnologia (SFRH/BD/30211/2006), and Ana André was a recipient of fellowship (SFRH/BPD/8124/ 2011) . M. Gesto was a recipient of postdoctoral fellowships from Fundação para a Ciência e a Tecnologia– FCT (Portugal, SFRH/BPD/ 47572/2008) and Xunta de Galicia (Spain, Ángeles Alvariño program). REFERENCES Abidli, S., Lahbib, Y., González, P. R., Alonso, J. I. G., and Trigui El Menif, N. 2013. Imposex and butyltin burden in Bolinus brandaris (Mollusca, Gastropoda) and sediment
Downloaded by [New York University] at 01:30 10 July 2015
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
from the Tunisian coast. Hydrobiologia 714: 13–24. Alsop, D., Matsumoto, J., Brown, S., and Kraak, G. V. D. 2008. Retinoid requirements in the reproduction of zebrafish. Gen. Comp. Endocrinol. 156: 51–62. Andersen, L., Holbech, H., Gessbo, A., Norrgren, L., and Petersen, G. I. 2003. Effects of exposure to 17alpha-ethinylestradiol during early development on sexual differentiation and induction of vitellogenin in zebrafish (Danio rerio). Comp. Biochem. Physiol. C 134: 365–374. André, A., Ruivo, R., Gesto, M., Castro, L. F. C., and Santos, M. M. 2014. Retinoid metabolism in invertebrates: When evolution meets endocrine disruption. Gen. Comp. Endocrinol. 208: 134–145. Barroso, C. M., Rato, M., Veríssimo, A., Sousa, A., Santos, J. A., Coelho, S., Gaspar, M. B., Maia, F., and Galante-Oliveira, S. 2011. Combined use of Nassarius reticulatus imposex and statolith age determination for tracking temporal evolution of TBT pollution in the NW Portuguese continental shelf. J. Environ. Monit. 13: 3018–3025. Bowles, J., Knight, D., Smith, C., Wilhelm, D., Richman, J., Mamiya, S., Yashiro, K., Chawengsaksophak, K., Wilson, M. J., Rossant, J., Hamada, H., and Koopman, P. 2006. Retinoid signaling determines germ cell fate in mice. Science 312: 596–600. Brown, A. R., Bickley, L. K., Ryan, T. A., Paull, G. C., Hamilton, P., B., Owen, S. F., Sharpe, A. D., and Tyler, C. R. 2012. Differences in sexual development in inbred and outbred zebrafish (Danio rerio) and implications for chemical testing. Aquat. Toxicol. 112–113:27–38. Carvalho, P. N., Rodrigues, P. N., Basto, M. C., and Vasconcelos, M. T. 2009. Butyltin levels in several Portuguese coastal areas. Environ. Monit. Assess. 159: 183–190. Castro, I. B., and Fillmann, G. 2012. High tributyltin and imposex levels in the commercial muricid Thais chocolata from two Peruvian harbor areas. Environ. Toxicol. Chem. 31: 955–960.
757
Castro, L. F. C., Lima, D., Machado, A., Melo, C., Hiromori, Y., Nishikawa, J., Nakanishi, T., Reis-Henriques, M. A., and Santos, M. M. 2007. Imposex induction is mediated through the retinoid X receptor signaling pathway in the neogastropod Nucella lapillus. Aquat. Toxicol. 85: 57–66. Castro, L. F. C., and Santos, M. M. 2014. To bind or not to bind: The taxonomic scope of nuclear receptor mediated endocrine disruption in invertebrate phyla. Environ. Sci. Technol. 48: 5361–5363 Choi, S. M., Yoo, S. D., and Lee, B. M. 2004. Toxicological characteristics of endocrinedisrupting chemicals: Developmental toxicity, carcinogenicity, and mutagenicity. J. Toxicol. Environ. Health B 7: 1–24. Coelho, I., Lima, D., André, A., Melo, C., Ruivo, R., Reis-Henriques, M. A., Santos, M. M., and Castro, L. F. C. 2013. Molecular characterization of ADH3 from the mollusc Nucella lapillus: Tissue gene expression after tributyltin and retinol exposure. J. Mollusc. Stud. 78: 343–348. Cooke, G.M., Forsythy, D.S., Genevieve, S.B., Romain, T., and Brett, T. 2008. Organotin speciation and tissue distribution in rat dams, fetuses, and neonates following oral administration of tributyltin chloride. J. Toxicol. Environ. Health A 71: 384–395. Dawson, M. I., and Xia, Z. 2012. The retinoid X receptors and their ligands. Biochim. Biophys. Acta 1821: 21–56. Elbrecht, A., and Smith, R. G. 1992. Aromatase enzyme activity and sex determination in chickens. Science 255: 467–470. Fenske, M., and Segner, H. 2004. Aromatase modulation alters gonadal differentiation in developing zebrafish (Danio rerio). Aquat. Toxicol. 67: 105–126. Gesto, M., Castro, L. F. C., Reis-Henriques, M. A., and Santos, M. M. 2012a. Tissue-specific distribution patterns of retinoids and didehydroretinoids in rainbow trout Oncorhynchus mykiss. Comp. Biochem. Physiol. B. 161: 69–78. Gesto, M., Castro, L. F. C., Reis-Henriques, M. A., and Santos, M. M. 2012b. Retinol
Downloaded by [New York University] at 01:30 10 July 2015
758
metabolism in the mollusk Osilinus lineatus indicates an ancient origin for retinyl ester storage capacity. Plos ONE 7: e35138. Gesto, M., Castro, L. F. C., and Santos, M. M. 2013. Differences in retinoid levels and metabolism among gastropod lineages: Imposex-susceptible gastropods lack the ability to store retinoids in the form of retinyl esters. Aquat. Toxicol. 142–143:96–103. Goksoyr, A. 2006. Endocrine disruptors in the marine environment: Mechanisms of toxicity and their influence on reproductive processes in fish. J. Toxicol. Environ. Health A 69: 175–184. Haubruge, E., Petit, F., and Gage, M. J. 2000. Reduced sperm counts in guppies (Poecilia reticulata) following exposure to low levels of tributyltin and bisphenol A. Proc. R. Soc. Lond. 267: 2333–2337. Jobling, S., Coey, J., Whitmore, J. G., Kime, D. E., Van Look, J. K., McAllister, B. G., Beresford, N., Henshaw, A. C., Brighty, G., Tyler, C. R., and Sumpter, J. P. 2002. Wild intersex roach (Rutilus rutilus) have reduced fertility. Biol. Reprod. 67: 515–524. Kanayama, T., Kobayashi, N., Mamiya, S., Nakanishi, T., and Nishikawa, J.-I. 2005. Organotin compounds promote adipocyte differentiation as agonists of the peroxisome proliferator-activated receptor g/retinoid X receptor pathway. Mol. Pharmacol. 67: 766–774. Kazeto, Y., Ijiri, S., Place, A. R., Zohar, Y., and Trant, J. M. 2001. The 5 -flanking regions of CYP19A1 and CYP19A2 in zebrafish. Biochem. Biophys. Res. Commun. 288: 503–508. Kuhl, A. J., and Brouwer, M. 2006. Antiestrogens inhibit xenoestrogen-induced brain aromatase activity but do not prevent xenoestrogen-induced feminization in Japanese medaka (Oryzias latipes). Environ. Health Perspect. 114: 500–506. Lima, D., Reis-Henriques, M. A. Silva, R., Santos, A. I., Castro, L. F. C., and Santos, M. M. 2011. Tributyltin-induced imposex in marine gastropods involves tissue-specific modulation of the retinoid X receptor. Aquat. Toxicol. 101: 221–227.
D. LIMA ET AL.
Livak, K. J., and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25: 402–408. Livera, G., Rouiller-Fabre, V., Pairault, C., Levacher, C., and Habert, R. 2002. Regulation and perturbation of testicular functions by vitamin A. Reproduction 124: 173–180. Lovekamp-Swan, T., Jetten, A. M., and Davis, B. J. 2003. Dual activation of PPARalpha and PPARgamma by mono-(2-ethylhexyl) phthalate in rat ovarian granulosa cells. Mol. Cell. Endocrinol. 201: 133–141. Lubzens, E., Young, G., Bobe, J., and Cerdà, J. 2010. Oogenesis in teleosts: How fish eggs are formed. Gen. Comp. Endocrinol. 165: 367–389. Lyssimachou, A., Jenssen, B. M., and Arukwe, A. 2006. Brain cytochrome P450 aromatase gene isoforms and activity levels in Atlantic salmon after waterborne exposure to nominal environmental concentrations of the pharmaceutical ethynylestradiol and antifoulant tributyltin. Toxicol. Sci. 91: 82–92. Manning, C. S., Lytle, T. F., Walker, W. W., and Lytle, J. S. 1999. Life-cycle toxicity of bis(tributyltin) oxide to the sheepshead minnow (Cyprinodon variegatus). Arch. Environ. Contam. Toxicol. 37: 258–266. McAllister, B. G., and Kime, D. E. 2003. Early life exposure to environmental levels of the aromatase inhibitor tributyltin causes masculinisation and irreversible sperm damage in zebrafish (Danio rerio). Aquat. Toxicol. 65: 309–316. McCaffery, P. J., Adams, J., Maden, M., and Rosa-Molinar, E. 2003. Too much of a good thing: Retinoic acid as an endogenous regulator of neural differentiation and exogenous teratogen. Eur. J. Neurosci. 18: 457–472. McGinnis, C. L., and Crivello, J. F. 2011. Elucidating the mechanism of action of tributyltin (TBT) in zebrafish. Aquat. Toxicol. 103: 25–31. Meador, J. P., Sommers, F. C., Cooper, K. A., and Yanagida, G. 2011. Tributyltin and the
Downloaded by [New York University] at 01:30 10 July 2015
TRIBUTYLTIN AND ZEBRAFISH REPRODUCTIVE PARAMETERS
obesogen metabolic syndrome in a salmonid. Environ. Res. 111: 50–56. Nakayama, K., Oshima, Y., Nagafuchi, K., Hano, T., Shimasaki, Y., and Honjo, T. 2005. Early-life-stage toxicity in offspring from exposed parent medaka, Oryzias latipes, to mixtures of tributyltin and polychlorinated biphenyls. Environ. Toxicol. Chem. 24: 591–596. Nakayama, K., Oshima, Y., Yamaguchi, T., Tsuruda, Y., Kang, I. J., Kobayashi, M., Imada, N., and Honjo, T. 2004. Fertilization success and sexual behavior in male medaka, Oryzias latipes, exposed to tributyltin. Chemosphere 55: 1331–1337. Nishikawa, J.-I., Mamiya, S., Kanayama, T., Nishikawa, T., Shiraishi, F., and Horiguchi, T. 2004. Involvement of the retinoid X receptor in the development of imposex caused by organotins in gastropods. Environ. Sci. Technol. 38: 6271–6276. O’Donnell, L., Roberston, K. M., Jones, M. E., and Simpson, E. R. 2001. Estrogen and spermatogenesis. Endocr. Rev. 22: 289–318. Pascoal, S., Carvalho, G., Vasieva, O., Hughes, R., Cossins, A., Fang, Y., Ashelford, K., Olohan, L., Barroso, C., Mendo, S., and Creer, S. 2013. Transcriptomics and in vivo tests reveal novel mechanisms underlying endocrine disruption in an ecological sentinel, Nucella lapillus. Mol. Ecol. 22: 1589–1608. Pauly, D. 1983. Some simple methods for the assessment of tropical fish stocks. FAO Fisheries Technical Paper 234. Rome, Italy: FAO. Richard-Mercier, N., Dorizzi, M., Desvages, G., Girondot, M., and Pieau, C. 1995. Endocrine sex reversal of gonads by the aromatase inhibitor Letrozole (CGS 20267) in a turtle with temperature-dependent sex determination. Gen. Comp. Endocrinol. 100: 314–326. Riu, A., McCollum, C. W., Pinto, C. L., Grimaldi, M., Hillenweck, A., Perdu, E., Zalko, D., Bernard, L., Laudet, V., Balaguer, P., Bondesson, M., and Gustafsson, J. A. 2014. Halogenated bisphenol-A analogs act as obesogens in zebrafish larvae (Danio rerio). Toxicol Sci. 139: 48–58.
759
Rodrigues, P., Reis-Henriques, M. A., Campos, J., and Santos, M. M. 2006. Urogenital papilla feminization in male Pomatoschistus minutus from two estuaries in northwestern Iberian Peninsula. Mar. Environ. Res. 62: S258–S262. Rotchell, J.M., and Ostrander, G.K., 2003. Molecular markers of endocrine disruption in aquatic organisms. J. Toxicol. Environ. Health B 6: 453–495. Santos, M. M., Vieira, N., and Santos, A. M. 2000. Imposex in the dogwhelk Nucella lapillus(L.) along the Portuguese coast. Mar. Pollut. Bull. 40: 643–646. Santos, M. M., Castro, L. F. C., Vieira, M. N., Micael, J. Morabito, R., Massanisso, P., and Reis-Henriques, M. A. 2005. New insights into the mechanism of imposex induction in the dogwhelk Nucella lapillus. Comp. Biochem. Physiol. Toxicol. Appl. Pharmacol. 141: 101–109. Santos, M. M., Enes, P., Reis-Henriques, M. A., Kuballa, J., Castro, L. F. C., and Vieira, M. N. 2009. Organotin levels in seafood from Portuguese markets and the risk for consumers. Chemosphere 75: 661–666. Santos, M. M., Micael, J., Carvalho, A. P., Morabito, R., Booy, P., Massanisso, P., Lamoree, M., and Reis-Henriques, M. A. 2006. Estrogens counteract the masculinizing effect of tributyltin in zebrafish. Comp. Biochem. Physiol. C. 142: 151–155. Santos, M.M., Reis-Henriques, M. A., and Castro, L. F. C. 2012. Lipid homeostasis perturbation by organotins: Effects on vertebrates and invertebrates. Biochem. Biol. Effects Organotins 83–96. Sárria, M. P., Santos, M. M., Reis-Henriques, M. A., Vieira, N. M., and Monteiro, N. M., 2011. The unpredictable effects of mixtures of androgenic and estrogenic chemicals on fish early life. Environ. Int. 37: 418–424. Segner, H. 2009. Zebrafish (Danio rerio) as a model organism for investigating endocrine disruption. Comp. Biochem. Physiol. C 149: 187–195. Shimasaki, Y., Kitano, T., Oshima, Y., Inoue, S., Imada, N., and Honjo, T. 2003. Tributyltin
Downloaded by [New York University] at 01:30 10 July 2015
760
causes masculinization in fish. Environ. Toxicol. Chem. 22: 141–144. Shimasaki, Y., Oshima, Y., Inoue, S., Inoue, Y., Kang, I. J., Nakayama, K., Imoto, H., and Honjo, T. 2006. Effect of tributyltin on reproduction in Japanese whiting, Sillago japonica. Mar. Environ. Res. 62: S245–S248. Si, J., Wu, X., Wan, C., Zeng, T., Zhang, M., Xie, K., and Li, J. 2011. Peripubertal exposure to low doses of tributyltin chloride affects the homeostasis of serum T, E2, LH, and body weight of male mice. Environ. Toxicol. 26: 307–314. Soares, J., Coimbra, A. M., Reis-Henriques, M. A., Monteiro, N. M., Vieira, M. N., Oliveira, J. M., Guedes-Dias, P., Fontaínhas-Fernandes, A., Parra, S. S., Carvalho, A. P., Castro, L. F. C., and Santos, M. M. 2009. Disruption of zebrafish (Danio rerio) embryonic development after full life-cycle parental exposure to low levels of ethinylestradiol. Aquat. Toxicol. 95: 330–338. Sousa, A. C., Oliveira, I. B., Laranjeiro, F., Takahashi, S., Tanabe, S., Cunha, M. R., and Barroso, C. M. 2012. Organotin levels in Nazaré canyon (west Iberian Margin, NE Atlantic) and adjacent coastal area. Mar. Pollut. Bull. 64: 422–426. Sumpter, J. P. 2005. Endocrine disrupters in the aquatic environment: An overview. Acta Hydrochem. Hydrobiol. 33: 9–16. Uchida, D., Yamashita, M., Kitano, T., and Iguchi, T. 2004. An aromatase inhibitor or high water temperature induce oocyte apoptosis and depletion of P450 aromatase activity in the gonads of genetic female zebrafish during sex-reversal. Comp. Biochem. Physiol. A 137: 11–20.
D. LIMA ET AL.
Yanase, T., Mu., Y. M., Nishi, Y., Goto, K., Nomura, M., Okabe, T., Takayanagi, R., and Nawata, H. 2001. Regulation of aromatase by nuclear receptors. J. Steroid Biochem. Mol. Biol. 79: 187–192. Yoon, K., Kwack, S.J., Kim, H.S., and Lee, B. M. 2014. Estrogenic endocrine-disrupting chemicals: Molecular mechanisms of action on putative human diseases. J. Toxicol. Environ. Health B 17: 127–174. Zhang, J., Zuo, Z., Chen, Y., Zhao, Y., Hu, S., and Wang, C. 2007. Effect of tributyltin on the development of ovary in female cuvier (Sebastiscus marmoratus). Aquat. Toxicol. 83: 174–179. Zhang, J., Zuo, Z., He, C., Cai, J., Wang, Y., Chen, Y., and Wang, C. 2009a. Effect of tributyltin on testicular development in Sebastiscus marmoratus and the mechanism involved. Environ. Toxicol. Chem. 28: 1528–1535. Zhang, J., Zuo, Z., He, C., Wu, D., Chen, Y., and Wang, C. 2009b. Inhibition of thyroidal status related to depression of testicular development in Sebastiscus marmoratus exposed to tributyltin. Aquat. Toxicol. 94: 62–67. Zhang, J., Zuo, Z., Wang, Y., Yu, A., Chen, Y., and Wang, C. 2011. Tributyltin chloride results in dorsal curvature in embryo development of Sebastiscus marmoratus via apoptosis pathway. Chemosphere 82: 437–442. Zhang, J., Zuo, Z., Zhu, W., Sun, P., and Wang, C. 2013. Sex-different effects of tributyltin on brain aromatase, estrogen receptor, and retinoid X receptor gene expression in rockfish (Sebastiscus marmoratus). Mar. Environ. Res. 90: 113–118.
