J Endocrinol Invest DOI 10.1007/s40618-014-0118-1
ORIGINAL ARTICLE
Effects of sex hormones on inflammatory response in male and female vascular endothelial cells Giosue` Annibalini • Deborah Agostini • Cinzia Calcabrini Chiara Martinelli • Evelin Colombo • Michele Guescini • Pasquale Tibollo • Vilberto Stocchi • Piero Sestili
•
Received: 2 April 2014 / Accepted: 8 June 2014 Ó Italian Society of Endocrinology (SIE) 2014
Abstract Purpose Gender-related differences in sex hormones might have a key role in the development of atherosclerosis though direct vascular effects of sex hormones are not yet well understood. Thus, the main purpose of this study was to compare the effects of sex hormones on inflammatory response in Human Umbilical Vein Endothelial Cells (HUVECs) obtained from both male and female donors. Methods We analyzed the expression of receptors and enzymes relevant to the action of androgens (AR, 5areductase 1 and 5a-reductase 2) and estrogens (ERa, ERb, and aromatase) in male and female HUVECs. Furthermore, we analyzed the effect of testosterone (T), 17b-estradiol (E2), dihydrotestosterone (DHT), and several androgenicanabolic steroids (AAS) on VCAM-1, ICAM-1, and E-selectin gene expression and on adhesion of U937 cells to TNF-a-stimulated male and female HUVECs. Results Our results reveal that in HUVECs, regardless of gender, the components involved in the androgen action pathway are predominant as compared to those of estrogen action pathway. In both HUVEC genders, the inflammatory effect of TNF-a was amplified by co-administration of T or DHT and several AAS frequently used in doping, while E2 had no effect. Conclusions This is the first study analyzing, under identical culture conditions, the key components of sex hormone response in male and female HUVECs and the
G. Annibalini (&) D. Agostini C. Calcabrini C. Martinelli E. Colombo M. Guescini P. Tibollo V. Stocchi P. Sestili Dipartimento di Scienze Biomolecolari, Universita` degli Studi di Urbino Carlo Bo, Via I. Maggetti 26, 61029 Urbino, PU, Italy e-mail: [email protected]
possible role of sex hormones in regulating the endothelial inflammatory response. The data obtained in our experimental system showed a pro-inflammatory effect of androgens, while conclusively excluding any protective effect for all the tested hormones. Keywords Steroid hormones HUVECs Gender Inflammation
Introduction Men have a higher prevalence of atherosclerosis and coronary heart disease (CHD) compared to age-related premenopausal women. Dominance of androgens over estrogens has been proposed as the major factor contributing to male predisposition to cardiovascular disorders [1]. However, the effects of testosterone (T) on atherogenesis are controversial, since several investigations have shown a protective rather than a detrimental role of T on the cardiovascular system [2]. Atherosclerosis is a chronic inflammatory process beginning with the expression of adhesion molecules (CAMs) on endothelial cell surfaces, which in turn facilitates monocyte adhesion. Several stimuli such as the bacterial lipopolysaccharide, pro-inflammatory cytokine tumor necrosis factor-a (TNF-a), and oxidized low-density lipoprotein increase the expression of CAMs and hence promote the recruitment of leukocytes [3]. These processes can be at least partially reproduced in vitro using cultured endothelial cells such as Human Umbilical Vein Endothelial Cells (HUVECs). Furthermore, since umbilical cord vein is a fetal annex, HUVECs maintain the gender of the fetus and can be used to clarify the influence of gender on atherosclerosis. T and 17b-estradiol (E2), the main sex
123
J Endocrinol Invest
hormones found in men and women respectively, regulate the inflammatory response of endothelial cells even though the existing data on this regulation are inconsistent [4–9]. An important feature of T action is its conversion to E2, by the enzyme aromatase, or in dihydrotestosterone (DHT), a non-aromatizable androgen, by the enzymes 5a-reductase 1 and 5a-reductase 2. Mukherjee et al. [4] demonstrated that the atheroprotective effect of T requires its conversion to E2 followed by activation of estrogen receptors (ERa and ERb), although this finding was neither confirmed by Zhang et al. [5] nor by Murphy et al. [6]. The action of DHT seems to be even more complex. For example, a proinflammatory action of DHT was reported in male HUVECs [7], whereas Mukherjee et al. [4] found no effect of DHT on CAM expression in female HUVECs. In a HUVEC gender comparison, Death et al. [8] confirmed a proatherogenic effect of DHT in male HUVECs and no effect on female HUVECs, a finding which could be explained by the higher amount of androgen receptor (AR) found in male endothelial cells than in female endothelial cells. These results are in contrast with those obtained by Norata et al. [9], who showed that DHT positively regulates endothelial function in HUVECs not specified for gender, through the activation of an anti-inflammatory response. Interestingly, these authors suggested that the inhibitory effect of DHT on inflammatory cytokine expression could be mediated by the activation of estrogen receptors, after their enzymatic conversion to 5a-androstane-3b,17b-diol (3b-Adiol), a molecule that activates the ERb but is unable to bind AR [10]. Differences in the gender of endothelial cell donors and the resulting variation of sex hormone receptor levels may account for these discrepant findings [8, 11–13]. Indeed, higher levels of ERa and ERb and a lower level of AR in female compared to male endothelial cells are reported, though confirmation of these observations is still lacking since several factors, such as gonad status and the degree of vascular atherosclerosis, might influence the sex hormone receptors expression in vascular tissues [11]. Moreover, an increase in estrogen receptor methylation with passages of isolated endothelial cells [12, 13] and regulation of AR, ERa, and ERb levels by hormones and growth factors present in the culture media has been reported [14–16]. In this study, the expression of sex hormone receptors AR, ERa and ERb and T converting enzymes aromatase, 5a-reductase 1, and 5a-reductase 2 in HUVECs obtained from both male and female donors has been analyzed. The effects of T, DHT, E2, and of several androgenic-anabolic steroids (AAS), which are synthetic derivatives of T, on cytokine-induced CAM expression and leukocyte adhesion to male and female HUVECs have also been investigated.
123
Materials and methods Materials The culture medium M199 and fetal bovine serum (FBS) were obtained from Invitrogen. FBS charcoal stripped, gelatin, endothelial cell growth factor (ECGF), penicillin, streptomycin, heparin, hydrocortisone, glutamine, TNF-a, T, DHT, E2, nandrolon, 4-androsten-3,17-dione, fluoxymesterone, trenbolone, trans-dehydroandrosterone, 17amethyl-testosterone, clostebol acetate, 17b-hydroxy-17methyl-androsta-1,4-dien-3-one, and Calcein-AM were obtained from Sigma-Aldrich (Milan, Italy). The monoclonal antibody for AR was obtained from Thermo Scientific (Milan, Italy); ERa and ERb monoclonal antibodies were purchased from Santa Cruz Biotechnology (DBA, Milan, Italy). Cell cultures Six different HUVEC clones from 3 male and 3 female donors were purchased from the Banca Biologica and Cell Factory, National Institute for Cancer Research (Genova, Italy). The gender of HUVECs derived from male and female newborns was confirmed via PCR analysis of the X–Y amelogenin gene [17]. Cells were cultured on 1.5 % gelatin-coated flasks in M199 medium supplemented with 15 % FBS, 50 U/ml penicillin, 50 lg/ml streptomycin, 5 lg/ml endothelial-derived growth factor, 100 lg/ml heparin, 10 lg/ml hydrocortisone, and 2 mM glutamine. Where indicated cells were shifted to phenol red-free M199 medium supplemented with 15 % FBS charcoal stripped. Cells were used for experiments between passages 3 and 6. Human breast adenocarcinoma cell line MCF-7 was cultured in DMEM supplemented with 10 % FBS, 50 U/ml penicillin, 50 lg/ml streptomycin, and 2 mM glutamine. Real-time RT-PCR quantification Total RNA was extracted and purified using the E.Z.N.A.TM Total RNA kit (Omega Bio-Tek) according to the manufacturer’s instructions and DNA digestion with DNase I enzyme (Qiagen). Complementary DNA was synthesized from 1 lg of total RNA using Omniscript RT (Qiagen) and random hexamers. The PCR was performed with two microliters of cDNA in a Bio-Rad iCycler iQ Multi-Color real-time PCR Detection System using 2X Quantitect SYBR PCR kit (Qiagen) and 300 nM of each primer. The amount of the target transcripts was normalized to the reference gene glyceraldehyde-3-phosphate dehydrogenase (Gapdh). The real-time PCR conditions were 95 °C for 10 min followed by 40 cycles of three-steps
J Endocrinol Invest Table 1 Primers used in Realtime RT-PCR quantification
Gene
Primer forward
Primer reverse
AR
TTATGAAGCAGGGATGACTCTG
TGGGTTGTCTCCTCAGTGG
ERa
GGCTACATCATCTCGGTTCC
TCAGGGTGCTGGACAGAAA
ERb
AGTCCCTGGTGTGAAGCAAG
CATCCCTCTTTGAACCTGGA
5a-reductase 1
AAGGAATCTCAGAAAACCAGGA
GCATAGCCACACCACTCCAT
5a-reductase 2
ATTGAATGGATCGGCTATGC
TTGGGGTAGTCCTCAAACATC
Aromatase
ACAACTCGACCCTTCTTTATGA
ACATAGCCCGATTCATTGGT
VCAM-1
ACAAAGGCAGAGTACGCAAACA
GGAGGAAGGGCTGACCAAG
ICAM-1
CCTTCCTCACCGTGTACTGG
AGCGTAGGGTAAGGTTCTTGC
E-selectin
GTGGACTCAAGTGTGAGCAAAT
GAGCAGGAAGAATTGTAGCTGAA
Gapdh
AAATCAAGTGGGGCGATGCT
TGCTGATGATCTTGAGGCTG
at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. The sequences of primers used in real-time RT-PCR quantification are listed in Table 1. Western Blotting Cells were lysed in cell lysis buffer [1 % Nonidet P-40, 0.1 % sodium dodecyl sulfate, 0.5 % sodium deoxycholate, 150 mM NaCl, 5 mM Tris (pH 8.0), and 1 ll/ml protease cocktail inhibitor (Sigma)]. Denatured proteins (30 lg) were resolved by SDS-PAGE (10 % acrylamide for AR and 12 % acrylamide for ERa and ERb) at 100 V for 1 h. Proteins were subsequently blotted to a nitrocellulose membrane (GE Healthcare) over night at 4 °C. The membranes were blocked for 2 h in Tris-buffered salineTween (TBS-T) (10 mM Tris-HCl pH 7.5; 150 mM NaCl; 0.05 % Tween 20) containing 5 % nonfat milk. After washing three times with TBS-T, membranes were incubated over night at 4 °C with primary antibodies for AR (1:2000 dilution), ERa (1:2,000 dilution), ERb (1:2,000 dilution), and a-Tubulin (1:2,000 dilution). Membranes were then washed again and incubated for 1 h with the secondary HRP-conjugated antibody (Pierce) at 1:10,000 dilutions in TBS-T. Immune complexes were visualized using the Supersignal Dura reagent (Pierce) following the manufacturer’s specifications. Adhesion assay Male and female HUVECs were grown to confluence in 96-well microtiter plates precoated with 1.5 % gelatin. Adhesion was evaluated using human monocytic U937 cells which were labeled with 1 lM calcein-AM/106 cells. Cell suspension was incubated at 37 °C for 30 min and then rinsed. U937 cells were resuspended in M199 medium, added (2.5 9 105 cells/well) to 96-well plates containing HUVECs, and incubated for 60 min a 37 °C. After the coculture period, the nonadherent calcein-AM labeled U937 cells were washed with PBS and then centrifuged
upside down for 1 min at 50 9 g. The fluorescence intensity of each well was then measured using a fluorescence plate reader (excitation filter 485 nm, emission filter 530 nm, Fluoroskan Acent FL, Thermo Scientific). Each condition was tested at least in triplicate in the same assay. Individual fluorescence intensity values were then normalized to the mean value of the control group and expressed as relative adhesion units. Statistical analysis The results are expressed as mean ± SE of the number of experiments indicated in the figure legend. Data were analyzed using the SPSS statistical package (SPSS Windows, version 16.0; SPSS Inc., Chicago, IL, USA). A twoway MANOVA was conducted to determine the effect of treatment (control, TNF-a, T, DHT, E2, or AAS) and HUVEC gender (male or female) on the three dependent variables: VCAM-1, ICAM-1, and E-selectin. T tests or univariate ANOVA and Bonferroni post-hoc tests were conducted as follow-up tests. Mean differences were considered statistically significant if P \ 0.05.
Results Quantification of AR, ERa and ERb levels, and T converting enzyme expression in HUVECs obtained from male and female donors The relative abundance of AR, ERa and ERb, aromatase, 5a-reductase 1, and 5a-reductase 2 was determined in HUVECs derived from 3 male and 3 female donors by realtime PCR. No gender-specific difference in sex hormone receptors or T converting enzyme expression was found between male and female endothelial cells (Fig. 1a). HUVECs expressed very low levels of ERa, ERb, aromatase, and 5a-reductase 2 whereas AR and 5a-reductase 1 mRNAs were highly expressed. A marked difference
123
J Endocrinol Invest
10 9 8 7 6 5 4 3 2 1 0
Male Female
b
HUVECs male
AR (110kDa) Tubulin
HUVECs female
HUVECs male
HUVECs female
MCF7
a Target gene/GAPDH mRNA expression
Fig. 1 Quantification of sex hormone receptors and enzymes in male and female HUVECs. a mRNAs quantification by real-time RT-PCR. b Quantification of AR, ERa, and ERb by Western blot. aTubulin levels served as internal controls. The estrogenresponsive MCF-7 cell line was used as positive control for ERa expression
ERα (66kDa) ERβ (56kDa) Tubulin
than 24 h negatively affected cell viability as assessed by trypan blue exclusion (4.2 ± 2.1 and 10.5 ± 3.3 % of trypan blue positive cells in complete media and gonadalfree media, respectively; P \ 0.05). The following experiments with gonadal-free media were, therefore, carried out for up to a maximum of 24 h. As shown in Fig. 2, the expression levels of AR, ERa, and ERb did not differ between male HUVECs cultured either for 10 h in the gonadal-free media or following stimulation with T (1,000 nM) or E2 (1,000 nM) for 48 h in complete medium. The same responses were obtained in female HUVECs (not shown). Effects of T, DHT, E2, and AAS on VCAM-1, ICAM-1, and E-selectin mRNA expression in male and female HUVECs Fig. 2 Quantification by real-time RT-PCR of sex hormone receptor mRNAs in male HUVECs incubated with different culture conditions and after treatment with sex hormones. No significant difference (P \ 0.05) from cells grown in complete medium was found
between the expression level of AR compared to ERa and ERb was also observed at the protein level, as demonstrated by Western blot analysis (Fig. 1b). According to mRNA levels, the AR protein was abundantly expressed in both male and female HUVECs, whereas only the ERb protein was detected in HUVECs, although at a very low expression level. The estrogen-responsive MCF-7 cell line was used as a positive control for ERa protein expression. We subsequently analyzed whether different culture conditions modified the pattern of AR, ERa, and ERb mRNA expression in male and female HUVECs. The incubation of male and female HUVECs with phenol redfree M199 medium and charcoal-stripped FBS for more
123
Basal VCAM-1, ICAM-1, and E-selectin mRNA expression was low in unstimulated cells and preincubation of male and female HUVECs with different concentrations of T and E2 for 48 h, without TNF-a stimulation, did not modify the expression pattern of CAM genes (not shown), as previously reported [4]. Preliminary experiments showed that exposure of HUVECs to 10 ng/ml TNF-a for 4 h led to maximal VCAM-1, ICAM-1, and E-selectin mRNA expression, a level that could not be increased any further. Since sex hormones could either up- or downregulate the HUVEC inflammatory response, a 1-ng/ml concentration of TNF-a was used for the next experiments in order to detect both up-regulation and down-regulation of CAM mRNAs after the sex steroid hormone treatment. The effects of the sex hormones T and E2 on TNF-a induced CAM mRNA expression were first analyzed on male and female HUVECs grown in phenol red- and
J Endocrinol Invest
VCAM/GAPDH mRNA
2.4
pro-inflammatory effect of TNF-a (Fig. 5). Like that which was obtained for T, the increase was statistically significant only for VCAM-1, although the extent of its induction was lower compared to that caused by T (compare Figs. 4a, 5). Finally, we tested the effect of several AAS 48 h treatments (100 nM) on TNF-a (1 ng/ml) induced CAM expression in HUVEC cells. The reported results are referred to male HUVEC cells; the same responses were obtained in female HUVECs (not shown). A statistically significant pro-inflammatory effect was demonstrated for 17a-methyl-testosterone, clostebol acetate and 17bhydroxy-17-methyl-androsta-1,4-dien-3-one (VCAM-1 and ICAM-1 mRNA induction), and trans-dehydroandrosterone (ICAM-1 mRNA induction). Any protective effect of nandrolon, 4-androsten-3,17-dione, fluoxymesterone, and trenbolone was definitively excluded (Fig. 6).
Male
2
Female
1.6 1.2 0.8 0.4 0
ICAM/GAPDH mRNA
2.5
Male
2
Female
1.5 1 0.5 0
E-selctin/GAPDH mRNA
4
Effects of T, DHT, E2, and AAS on TNF-a-induced monocyte adhesion to male and female HUVECs
Male
3.2
Female
2.4 1.6 0.8 0
TNF-α α
-
+
+
+
+
T nM
0
0
10
100
1000
Fig. 3 Effects of T treatment on TNF-a induced CAM expression in male and female HUVECs cultured in gonadal-free medium. No significant difference (P \ 0.05) from TNF-a treated cells was found
gonadal hormone-free medium. In TNF-a stimulated male and female HUVECs, treatment with higher concentrations of T (100 and 1,000 nM) induced CAM mRNAs slightly, but the increase was not statistically significant (Fig. 3). E2 did not affect CAM expression at any of the concentrations tested (not shown). We then assessed the effects of T treatment for 48 h on cytokine-mediated endothelial CAM induction. In order to avoid loss of cell viability, both male and female HUVECs were grown in complete medium and treated with different concentrations of T for 48 h; TNF-a (1 ng/ml) was added during the last 4 h of incubation. In both male and female HUVEC, T significantly increased the TNF-a induced VCAM-1 expression, whereas the mRNA levels of ICAM-1 and E-selectin were not significantly modified (Fig. 4a). No effect on CAM expression was observed upon incubation with E2 for 48 h (Fig 4b). We also analyzed the effects of DHT on TNF-a induced CAM expression. In both male and female HUVECs, treatment with 100 nM DHT for 48 h slightly amplified the
We subsequently analyzed the effects of sex hormones on endothelial cell-U937 interactions. Male and female HUVECs were treated with T (Fig. 7a), DHT (Fig. 7b), and E2 (Fig. 7c) for 48 h; TNF-a (1 ng/ml) was added during the last 6 h incubation and before the adhesion assay. After treatment with T and DHT, a significant increase in monocyte adhesion to endothelial cells was observed: T and DHT increased the adhesion by 20 and 18 %, respectively, whereas E2 had no effect. As observed in mRNA quantification experiments, the effects of sex hormones appeared to be unrelated to HUVEC gender. Thus, the effect of AAS at 100 nM concentrations on endothelial cell-U937 interaction was evaluated as described for sex hormones in HUVECs (Fig. 8). In agreement with results obtained with RT-PCR Real-time trans-dehydroandrosterone, 17a-methyl-testosterone, clostebol acetate, and 17b-hydroxy-17-methyl-androsta-1,4-dien-3-one showed a statistically significant pro-inflammatory effect. Adhesion of U937 to HUVEC was increased also by nandrolone treatment. None of the AAS had a protective effect.
Discussion This study represents the first comparison of the inflammatory effect of sex hormones T, the non-aromatizable androgen DHT, and E2 on male and female HUVECs. In both HUVEC genders, androgens have a pro-inflammatory effect increasing the TNF-a-induced VCAM-1 gene expression and adhesion of U937 to HUVEC, whereas E2 had no effect.
123
J Endocrinol Invest
VCAM/GAPDH mRNA
a
E-selectin/GADPH mRNA
ICAM/GAPDH mRNA
Fig. 4 Effects of sex hormone treatments on TNF-a induced CAM expression in male and female HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
3
b 3
Male
2.5
Female
*
2
*
1.5
*
1
*
2.5
* *
1.5 1 0.5
0
0
3
Female
2
0.5
3
Male Female
2.5 2
2
1.5
1.5
1
1
0.5
0.5
0
0
3
Female
3
Male Female
2.5
Male
2.5
Male
2.5
2
2
1.5
1.5
1
1
0.5
0.5
0
Female
0
TNF-α α
-
+
+
+
T nM
0
0
10
100
Several authors have used HUVECs to analyze the effect of sex hormones on endothelial cell adhesion, obtaining discrepant findings due, at least in part, to heterogeneity of cell culture conditions [4–9]. In fact, some authors have used normal, complete medium [5], while others have employed phenol red-free medium supplemented with charcoal-stripped serum [4] to exclude any basal estrogen effect or artifactual ER binding. Moreover, although in vivo endothelial cells express both AR and ERs [8, 18], many factors can influence the expression of sex hormone receptors both in vivo [11] and in vitro [12–16, 19]. Since the physiologically relevant effects of sex hormones are mainly receptor dependent [11], knowledge of the levels of receptor expression is essential to gain more insights into the hormone responsiveness of endothelial cells. For this reason, we first compared the expression of the sex hormone receptors AR, ERa and ERb, and T converting enzymes aromatase, 5a-reductase 1, and 5areductase 2 in HUVECs obtained from male and female donors. Surprisingly, no significant gender-related difference was found (Fig. 1). Male and female HUVECs expressed high levels of AR and 5a-reductase 1 and very low levels of estrogen receptors and aromatase (Fig. 1). Neither the different culture conditions nor the treatment
123
Male
+
TNF-α
1000 E2 nM
0
+ 0
+ 10
+ 100
+ 1000
with steroid hormones modified this expression pattern (Fig. 2). These data are in contrast with the general assumption that HUVEC gender is the main factor that determines the pattern of expression of sex hormone receptors. Interestingly, previous studies have demonstrated that normal ER function is required in both males and females for normal cardiovascular development [20]; moreover, a reduction of ER expression is related to the progression of atherosclerosis [21]. It is worth noting that the pattern of sex hormone receptor expression found in our HUVECs (Fig. 1) and in others in vitro studies [18, 19] is more similar to that which is found in atherosclerotic vessels rather than normal vessels. Treatment with the sex hormones T and DHT augmented the TNF-a-induced rise in VCAM-1 gene (Figs. 4a, 5, respectively) and adhesion of U937 to HUVECs (Fig. 6a, b), whereas E2 had no effect (Figs. 4b, 6c). The lack of significant effects of E2 in all the tested conditions could be explained by the very low amount of ERa and ERb in our cells (Fig. 1), and was consistent with other studies demonstrating that vascular reactivity to sex hormones requires functional receptors [11, 22]. The very low level of aromatase expression and the ability of DHT, but
VCAM/GAPDH mRNA
J Endocrinol Invest 3 2.5
Male Female
*
2 1.5
*
1 0.5
ICAM/GAPDH mRNA
0
3 2.5
Male Female
2 1.5 1 0.5 0
E-selectin/GAPDH mRNA
3 2.5
Fig. 6 Effects of AAS treatments on TNF-a induced CAM expression in male HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
Male Female
2 1.5 1 0.5 0
TNF-α DHT nM 0
+ 0
+ 10
+ 100
+ 1000
Fig. 5 Effects of DHT treatment on TNF-a induced CAM expression in male and female HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
not of E2, to replicate pro-inflammatory effects of T suggest that these androgenic effects are mediated via AR. However, more complex mechanisms appear to be involved since the extent of VCAM-1 induction was lower for DHT than it was for T (see Figs. 4a, 5). Interestingly, even though DHT is not aromatizable to E2, recent studies have demonstrated that DHT is not a specific marker of androgen action since it can also be converted to 3b-Adiol, a molecule with a high affinity for estrogen receptors but unable to bind AR [10, 23, 24]. Notably, Norata et al. [10] demonstrated that 3b-Adiol promotes some anti-inflammatory effects on TNF-a stimulated HUVECs via ERb activation. In any case, due to the very low level of estrogen receptors found in our HUVEC lines (Fig. 1), 3bAdiol, if present, could not exert its protective effect. Atherosclerosis and CHD are prevalent in men compared to premenopausal women, and this evidence has been linked to dominance of androgens over estrogens in male gender [1]. However, a decrease in serum testosterone
levels, induced by aging or by androgen deprivation treatments, is associated with CHD and with several cardiovascular risk factors, such as insulin resistance and diabetes, lipid and inflammatory profiles, and visceral obesity [2]. Testosterone therapy aimed to achieve a normal physiological testosterone concentration provides beneficial effects on CHD and on metabolic syndrome, and thus is likely to act on whole body environmental and pathophysiological factors predisposing to atherosclerosis [2]. These effects are a result of achieving physiological serum testosterone concentration by balancing T and E2 levels but not by administration of normal androgen levels [2]. Obviously, the results of in vitro studies can help in understand the effects of androgen supplementation to endothelial cell, but cannot reproduce whole body effects of sex hormones. Our in vitro study suggests that supplementation of high doses of androgens could have direct negative consequences on endothelial cells also in vivo, especially in subjects presenting a chronic pro-inflammatory status such as obesity, metabolic syndrome, diabetes, and atherosclerosis. Based on our results regarding natural sex hormones, we next decided to test several anabolic androgenic steroids (AAS). Even though AAS have been prohibited in sports since 1974, they are still widely abused by athletes, who use doses of hormones that are between 10 and 100 times higher than therapeutic doses. Structural modifications have been introduced into T molecule in order to circumvent doping control and to become more anabolic and less androgenic than natural hormones [25].
123
J Endocrinol Invest Fig. 7 Effects of T, DHT, and E2 treatment on TNF-a induced adhesion of U937 cells to male and female HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
Adhesion of U937 to HUVECs
a 1.8
1.5
Male Female
Adhesion of U97 to HUVECs
1.5
Male Female
1.8
*
1.5
*
*
0.9
0.6
0.6
0.6
0.3
0.3
0.3
* * * *
1.00
0.50
0.00
0
TNF-α + 100 DHT nM 0
Male Female
0.9
0.9
+ 0
c
1.2
1.2
0
*
*
1.2
TNF-α T nM 0
1.50
b 1.8
0
+ 0
+ 100
TNF-α
E2 nM 0
+ 0
+ 100
This study represents the first complete characterization of sex steroid conversion enzyme and receptors in male and female HUVECs, and reveals that the components involved in androgen action are predominant on those of estrogen action. The results reported in this paper show that the use (and abuse) of synthetic steroids and natural sex hormones is likely to play a direct and negative role in vascular inflammation and atherosclerosis. Acknowledgments This study was supported by ‘‘Commissione per la vigilanza ed il controllo sul doping’’, Italian Ministry of Health. We would like to thank GlaxoSmithKline which provided valuable reagents and Dr. Laura Guerra for linguistic help. Conflict of interest of interest.
The authors declare that they have no conflict
References Fig. 8 Effects of AAS treatment on TNF-a induced adhesion of U937 cells to HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
Substitution can modify molecule binding to AR, and little information is available on the effect of structural changes on the action of AAS. The data obtained in our experimental system showed that several AAS, frequently used in doping, have a pro-inflammatory effect on endothelial cells and thus a potential in vivo effect on atherosclerosis and CHD, especially in predisposed subjects. We could not find a clear correlation between structure modification of AAS (that could influence AR binding) and their pro-inflammatory effect, anyway we conclusively excluded any protective effect for all the tested hormones. It is worthy of note that our data have been obtained after a 48-h incubation; however, AAS abusers use high doses of hormones for a long time, leading to hypothesize an even more detrimental effect.
123
1. Wu FC, von Eckardstein A (2003) Androgens and coronary artery disease. Endocr Rev 24(2):183–217 2. Jones TH, Saad F (2009) The effects of testosterone on risk factors for, and the mediators of, the atherosclerotic process. Atherosclerosis 207(2):318–327 3. Libby P, Ridker PM, Hansson GK (2011) Progress and challenges in translating the biology of atherosclerosis. Nature 473(7347): 317–325 4. Mukherjee TK, Dinh H, Chaudhuri G, Nathan L (2002) Testosterone attenuates expression of vascular cell adhesion molecule-1 by conversion to estradiol by aromatase in endothelial cells: implications in atherosclerosis. Proc Natl Acad Sci USA 99(6): 4055–4060 5. Zhang X, Wang LY, Jiang TY, Zhang HP, Dou Y, Zhao JH, Zhao H, Qiao ZD, Qiao JT (2002) Effects of testosterone and 17-betaestradiol on TNF-alpha-induced E-selectin and VCAM-1 expression in endothelial cells. Analysis of the underlying receptor pathways. Life Sci 71(1):15–29 6. Murphy HS, Sun Q, Murphy BA, Mo R, Huo J, Chen J, Chensue SW, Adams M, Richardson BC, Yung R (2004) Tissue-specific effect of estradiol on endothelial cell-dependent lymphocyte recruitment. Microvasc Res 68(3):273–285 7. McCrohon JA, Jessup W, Handelsman DJ, Celermajer DS (1999) Androgen exposure increases human monocyte adhesion to
J Endocrinol Invest
8.
9.
10.
11.
12.
13.
14.
15.
16.
vascular endothelium and endothelial cell expression of vascular cell adhesion molecule-1. Circulation 99(17):2317–2322 Death AK, McGrath KC, Sader MA, Nakhla S, Jessup W, Handelsman DJ, Celermajer DS (2004) Dihydrotestosterone promotes vascular cell adhesion molecule-1 expression in male human endothelial cells via a nuclear factor-kappaB-dependent pathway. Endocrinology 145(4):1889–1897 Norata GD, Tibolla G, Seccomandi PM, Poletti A, Catapano AL (2006) Dihydrotestosterone decreases tumor necrosis factor-alpha and lipopolysaccharide-induced inflammatory response in human endothelial cells. J Clin Endocrinol Metab 91(2):546–554 Norata GD, Cattaneo P, Poletti A, Catapano AL (2010) The androgen derivative 5alpha-androstane-3beta, 17beta-diol inhibits tumor necrosis factor alpha and lipopolysaccharide induced inflammatory response in human endothelial cells and in mice aorta. Atherosclerosis 212(1):100–106 Vitale C, Mendelsohn ME, Rosano GM (2009) Gender differences in the cardiovascular effect of sex hormones. Nat Rev Cardiol 6(8):532–542 Post WS, Goldschmidt-Clermont PJ, Wilhide CC, Heldman AW, Sussman MS, Ouyang P, Milliken EE, Issa JP (1999) Methylation of the estrogen receptor gene is associated with aging and atherosclerosis in the cardiovascular system. Cardiovasc Res 43(4):985–991 Ying AK, Hassanain HH, Roos CM, Smiraglia DJ, Issa JJ, Michler RE, Caligiuri M, Plass C, Goldschmidt-Clermont PJ (2000) Methylation of the estrogen receptor-alpha gene promoter is selectively increased in proliferating human aortic smooth muscle cells. Cardiovasc Res 46(1):172–179 Ihionkhan CE, Chambliss KL, Gibson LL, Hahner LD, Mendelsohn ME, Shaul PW (2002) Estrogen causes dynamic alterations in endothelial estrogen receptor expression. Circ Res 91(9):814–820 Haas E, Meyer MR, Schurr U, Bhattacharya I, Minotti R, Nguyen HH, Heigl A, Lachat M, Genoni M, Barton M (2007) Differential effects of 17beta-estradiol on function and expression of estrogen receptor alpha, estrogen receptor beta, and GPR30 in arteries and veins of patients with atherosclerosis. Hypertension 49(6):1358–1363 Caulin-Glaser T, Watson CA, Pardi R, Bender JR (1996) Effects of 17beta-estradiol on cytokine-induced endothelial cell adhesion molecule expression. J Clin Invest 98(1):36–42
17. Akane A (1998) Sex determination by PCR analysis of the X–Y amelogenin gene. Methods Mol Biol 98:245–249 18. Evans MJ, Harris HA, Miller CP, Karathanasis SK, Adelman SJ (2002) Estrogen receptors alpha and beta have similar activities in multiple endothelial cell pathways. Endocrinology 143(10): 3785–3795 19. Toth B, Saadat G, Geller A, Scholz C, Schulze S, Friese K, Jeschke U (2008) Human umbilical vascular endothelial cells express estrogen receptor beta (ERbeta) and progesterone receptor A (PR-A), but not ERalpha and PR-B. Histochem Cell Biol 130(2):399–405 20. Mendelsohn ME, Karas RH (2005) Molecular and cellular basis of cardiovascular gender differences. Science 308(5728): 1583–1587 21. Virdis A, Ghiadoni L, Pinto S, Lombardo M, Petraglia F, Gennazzani A, Buralli S, Taddei S, Salvetti A (2000) Mechanisms responsible for endothelial dysfunction associated with acute estrogen deprivation in normotensive women. Circulation 101(19):2258–2263 22. Mori M, Tsukahara F, Yoshioka T, Irie K, Ohta H (2004) Suppression by 17beta-estradiol of monocyte adhesion to vascular endothelial cells is mediated by estrogen receptors. Life Sci 75(5):599–609 23. Weihua Z, Lathe R, Warner M, Gustafsson JA (2002) An endocrine pathway in the prostate, ERbeta, AR, 5alpha-androstane3beta, 17beta-diol, and CYP7B1, regulates prostate growth. Proc Natl Acad Sci USA 99(21):13589–13594 24. Guerini V, Sau D, Scaccianoce E, Rusmini P, Ciana P, Maggi A, Martini PG, Katzenellenbogen BS, Martini L, Motta M, Poletti A (2005) The androgen derivative 5alpha-androstane-3beta, 17betadiol inhibits prostate cancer cell migration through activation of the estrogen receptor beta subtype. Cancer Res 65(12):5445–5453 25. Fragkaki AG, Angelis YS, Koupparis M, Tsantili-Kakoulidou A, Kokotos G, Georgakopoulos C (2009) Structural characteristics of anabolic androgenic steroids contributing to binding to the androgen receptor and to their anabolic and androgenic activities. Applied modifications in the steroidal structure. Steroids 74(2):172–197
123
ORIGINAL ARTICLE
Effects of sex hormones on inflammatory response in male and female vascular endothelial cells Giosue` Annibalini • Deborah Agostini • Cinzia Calcabrini Chiara Martinelli • Evelin Colombo • Michele Guescini • Pasquale Tibollo • Vilberto Stocchi • Piero Sestili
•
Received: 2 April 2014 / Accepted: 8 June 2014 Ó Italian Society of Endocrinology (SIE) 2014
Abstract Purpose Gender-related differences in sex hormones might have a key role in the development of atherosclerosis though direct vascular effects of sex hormones are not yet well understood. Thus, the main purpose of this study was to compare the effects of sex hormones on inflammatory response in Human Umbilical Vein Endothelial Cells (HUVECs) obtained from both male and female donors. Methods We analyzed the expression of receptors and enzymes relevant to the action of androgens (AR, 5areductase 1 and 5a-reductase 2) and estrogens (ERa, ERb, and aromatase) in male and female HUVECs. Furthermore, we analyzed the effect of testosterone (T), 17b-estradiol (E2), dihydrotestosterone (DHT), and several androgenicanabolic steroids (AAS) on VCAM-1, ICAM-1, and E-selectin gene expression and on adhesion of U937 cells to TNF-a-stimulated male and female HUVECs. Results Our results reveal that in HUVECs, regardless of gender, the components involved in the androgen action pathway are predominant as compared to those of estrogen action pathway. In both HUVEC genders, the inflammatory effect of TNF-a was amplified by co-administration of T or DHT and several AAS frequently used in doping, while E2 had no effect. Conclusions This is the first study analyzing, under identical culture conditions, the key components of sex hormone response in male and female HUVECs and the
G. Annibalini (&) D. Agostini C. Calcabrini C. Martinelli E. Colombo M. Guescini P. Tibollo V. Stocchi P. Sestili Dipartimento di Scienze Biomolecolari, Universita` degli Studi di Urbino Carlo Bo, Via I. Maggetti 26, 61029 Urbino, PU, Italy e-mail: [email protected]
possible role of sex hormones in regulating the endothelial inflammatory response. The data obtained in our experimental system showed a pro-inflammatory effect of androgens, while conclusively excluding any protective effect for all the tested hormones. Keywords Steroid hormones HUVECs Gender Inflammation
Introduction Men have a higher prevalence of atherosclerosis and coronary heart disease (CHD) compared to age-related premenopausal women. Dominance of androgens over estrogens has been proposed as the major factor contributing to male predisposition to cardiovascular disorders [1]. However, the effects of testosterone (T) on atherogenesis are controversial, since several investigations have shown a protective rather than a detrimental role of T on the cardiovascular system [2]. Atherosclerosis is a chronic inflammatory process beginning with the expression of adhesion molecules (CAMs) on endothelial cell surfaces, which in turn facilitates monocyte adhesion. Several stimuli such as the bacterial lipopolysaccharide, pro-inflammatory cytokine tumor necrosis factor-a (TNF-a), and oxidized low-density lipoprotein increase the expression of CAMs and hence promote the recruitment of leukocytes [3]. These processes can be at least partially reproduced in vitro using cultured endothelial cells such as Human Umbilical Vein Endothelial Cells (HUVECs). Furthermore, since umbilical cord vein is a fetal annex, HUVECs maintain the gender of the fetus and can be used to clarify the influence of gender on atherosclerosis. T and 17b-estradiol (E2), the main sex
123
J Endocrinol Invest
hormones found in men and women respectively, regulate the inflammatory response of endothelial cells even though the existing data on this regulation are inconsistent [4–9]. An important feature of T action is its conversion to E2, by the enzyme aromatase, or in dihydrotestosterone (DHT), a non-aromatizable androgen, by the enzymes 5a-reductase 1 and 5a-reductase 2. Mukherjee et al. [4] demonstrated that the atheroprotective effect of T requires its conversion to E2 followed by activation of estrogen receptors (ERa and ERb), although this finding was neither confirmed by Zhang et al. [5] nor by Murphy et al. [6]. The action of DHT seems to be even more complex. For example, a proinflammatory action of DHT was reported in male HUVECs [7], whereas Mukherjee et al. [4] found no effect of DHT on CAM expression in female HUVECs. In a HUVEC gender comparison, Death et al. [8] confirmed a proatherogenic effect of DHT in male HUVECs and no effect on female HUVECs, a finding which could be explained by the higher amount of androgen receptor (AR) found in male endothelial cells than in female endothelial cells. These results are in contrast with those obtained by Norata et al. [9], who showed that DHT positively regulates endothelial function in HUVECs not specified for gender, through the activation of an anti-inflammatory response. Interestingly, these authors suggested that the inhibitory effect of DHT on inflammatory cytokine expression could be mediated by the activation of estrogen receptors, after their enzymatic conversion to 5a-androstane-3b,17b-diol (3b-Adiol), a molecule that activates the ERb but is unable to bind AR [10]. Differences in the gender of endothelial cell donors and the resulting variation of sex hormone receptor levels may account for these discrepant findings [8, 11–13]. Indeed, higher levels of ERa and ERb and a lower level of AR in female compared to male endothelial cells are reported, though confirmation of these observations is still lacking since several factors, such as gonad status and the degree of vascular atherosclerosis, might influence the sex hormone receptors expression in vascular tissues [11]. Moreover, an increase in estrogen receptor methylation with passages of isolated endothelial cells [12, 13] and regulation of AR, ERa, and ERb levels by hormones and growth factors present in the culture media has been reported [14–16]. In this study, the expression of sex hormone receptors AR, ERa and ERb and T converting enzymes aromatase, 5a-reductase 1, and 5a-reductase 2 in HUVECs obtained from both male and female donors has been analyzed. The effects of T, DHT, E2, and of several androgenic-anabolic steroids (AAS), which are synthetic derivatives of T, on cytokine-induced CAM expression and leukocyte adhesion to male and female HUVECs have also been investigated.
123
Materials and methods Materials The culture medium M199 and fetal bovine serum (FBS) were obtained from Invitrogen. FBS charcoal stripped, gelatin, endothelial cell growth factor (ECGF), penicillin, streptomycin, heparin, hydrocortisone, glutamine, TNF-a, T, DHT, E2, nandrolon, 4-androsten-3,17-dione, fluoxymesterone, trenbolone, trans-dehydroandrosterone, 17amethyl-testosterone, clostebol acetate, 17b-hydroxy-17methyl-androsta-1,4-dien-3-one, and Calcein-AM were obtained from Sigma-Aldrich (Milan, Italy). The monoclonal antibody for AR was obtained from Thermo Scientific (Milan, Italy); ERa and ERb monoclonal antibodies were purchased from Santa Cruz Biotechnology (DBA, Milan, Italy). Cell cultures Six different HUVEC clones from 3 male and 3 female donors were purchased from the Banca Biologica and Cell Factory, National Institute for Cancer Research (Genova, Italy). The gender of HUVECs derived from male and female newborns was confirmed via PCR analysis of the X–Y amelogenin gene [17]. Cells were cultured on 1.5 % gelatin-coated flasks in M199 medium supplemented with 15 % FBS, 50 U/ml penicillin, 50 lg/ml streptomycin, 5 lg/ml endothelial-derived growth factor, 100 lg/ml heparin, 10 lg/ml hydrocortisone, and 2 mM glutamine. Where indicated cells were shifted to phenol red-free M199 medium supplemented with 15 % FBS charcoal stripped. Cells were used for experiments between passages 3 and 6. Human breast adenocarcinoma cell line MCF-7 was cultured in DMEM supplemented with 10 % FBS, 50 U/ml penicillin, 50 lg/ml streptomycin, and 2 mM glutamine. Real-time RT-PCR quantification Total RNA was extracted and purified using the E.Z.N.A.TM Total RNA kit (Omega Bio-Tek) according to the manufacturer’s instructions and DNA digestion with DNase I enzyme (Qiagen). Complementary DNA was synthesized from 1 lg of total RNA using Omniscript RT (Qiagen) and random hexamers. The PCR was performed with two microliters of cDNA in a Bio-Rad iCycler iQ Multi-Color real-time PCR Detection System using 2X Quantitect SYBR PCR kit (Qiagen) and 300 nM of each primer. The amount of the target transcripts was normalized to the reference gene glyceraldehyde-3-phosphate dehydrogenase (Gapdh). The real-time PCR conditions were 95 °C for 10 min followed by 40 cycles of three-steps
J Endocrinol Invest Table 1 Primers used in Realtime RT-PCR quantification
Gene
Primer forward
Primer reverse
AR
TTATGAAGCAGGGATGACTCTG
TGGGTTGTCTCCTCAGTGG
ERa
GGCTACATCATCTCGGTTCC
TCAGGGTGCTGGACAGAAA
ERb
AGTCCCTGGTGTGAAGCAAG
CATCCCTCTTTGAACCTGGA
5a-reductase 1
AAGGAATCTCAGAAAACCAGGA
GCATAGCCACACCACTCCAT
5a-reductase 2
ATTGAATGGATCGGCTATGC
TTGGGGTAGTCCTCAAACATC
Aromatase
ACAACTCGACCCTTCTTTATGA
ACATAGCCCGATTCATTGGT
VCAM-1
ACAAAGGCAGAGTACGCAAACA
GGAGGAAGGGCTGACCAAG
ICAM-1
CCTTCCTCACCGTGTACTGG
AGCGTAGGGTAAGGTTCTTGC
E-selectin
GTGGACTCAAGTGTGAGCAAAT
GAGCAGGAAGAATTGTAGCTGAA
Gapdh
AAATCAAGTGGGGCGATGCT
TGCTGATGATCTTGAGGCTG
at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. The sequences of primers used in real-time RT-PCR quantification are listed in Table 1. Western Blotting Cells were lysed in cell lysis buffer [1 % Nonidet P-40, 0.1 % sodium dodecyl sulfate, 0.5 % sodium deoxycholate, 150 mM NaCl, 5 mM Tris (pH 8.0), and 1 ll/ml protease cocktail inhibitor (Sigma)]. Denatured proteins (30 lg) were resolved by SDS-PAGE (10 % acrylamide for AR and 12 % acrylamide for ERa and ERb) at 100 V for 1 h. Proteins were subsequently blotted to a nitrocellulose membrane (GE Healthcare) over night at 4 °C. The membranes were blocked for 2 h in Tris-buffered salineTween (TBS-T) (10 mM Tris-HCl pH 7.5; 150 mM NaCl; 0.05 % Tween 20) containing 5 % nonfat milk. After washing three times with TBS-T, membranes were incubated over night at 4 °C with primary antibodies for AR (1:2000 dilution), ERa (1:2,000 dilution), ERb (1:2,000 dilution), and a-Tubulin (1:2,000 dilution). Membranes were then washed again and incubated for 1 h with the secondary HRP-conjugated antibody (Pierce) at 1:10,000 dilutions in TBS-T. Immune complexes were visualized using the Supersignal Dura reagent (Pierce) following the manufacturer’s specifications. Adhesion assay Male and female HUVECs were grown to confluence in 96-well microtiter plates precoated with 1.5 % gelatin. Adhesion was evaluated using human monocytic U937 cells which were labeled with 1 lM calcein-AM/106 cells. Cell suspension was incubated at 37 °C for 30 min and then rinsed. U937 cells were resuspended in M199 medium, added (2.5 9 105 cells/well) to 96-well plates containing HUVECs, and incubated for 60 min a 37 °C. After the coculture period, the nonadherent calcein-AM labeled U937 cells were washed with PBS and then centrifuged
upside down for 1 min at 50 9 g. The fluorescence intensity of each well was then measured using a fluorescence plate reader (excitation filter 485 nm, emission filter 530 nm, Fluoroskan Acent FL, Thermo Scientific). Each condition was tested at least in triplicate in the same assay. Individual fluorescence intensity values were then normalized to the mean value of the control group and expressed as relative adhesion units. Statistical analysis The results are expressed as mean ± SE of the number of experiments indicated in the figure legend. Data were analyzed using the SPSS statistical package (SPSS Windows, version 16.0; SPSS Inc., Chicago, IL, USA). A twoway MANOVA was conducted to determine the effect of treatment (control, TNF-a, T, DHT, E2, or AAS) and HUVEC gender (male or female) on the three dependent variables: VCAM-1, ICAM-1, and E-selectin. T tests or univariate ANOVA and Bonferroni post-hoc tests were conducted as follow-up tests. Mean differences were considered statistically significant if P \ 0.05.
Results Quantification of AR, ERa and ERb levels, and T converting enzyme expression in HUVECs obtained from male and female donors The relative abundance of AR, ERa and ERb, aromatase, 5a-reductase 1, and 5a-reductase 2 was determined in HUVECs derived from 3 male and 3 female donors by realtime PCR. No gender-specific difference in sex hormone receptors or T converting enzyme expression was found between male and female endothelial cells (Fig. 1a). HUVECs expressed very low levels of ERa, ERb, aromatase, and 5a-reductase 2 whereas AR and 5a-reductase 1 mRNAs were highly expressed. A marked difference
123
J Endocrinol Invest
10 9 8 7 6 5 4 3 2 1 0
Male Female
b
HUVECs male
AR (110kDa) Tubulin
HUVECs female
HUVECs male
HUVECs female
MCF7
a Target gene/GAPDH mRNA expression
Fig. 1 Quantification of sex hormone receptors and enzymes in male and female HUVECs. a mRNAs quantification by real-time RT-PCR. b Quantification of AR, ERa, and ERb by Western blot. aTubulin levels served as internal controls. The estrogenresponsive MCF-7 cell line was used as positive control for ERa expression
ERα (66kDa) ERβ (56kDa) Tubulin
than 24 h negatively affected cell viability as assessed by trypan blue exclusion (4.2 ± 2.1 and 10.5 ± 3.3 % of trypan blue positive cells in complete media and gonadalfree media, respectively; P \ 0.05). The following experiments with gonadal-free media were, therefore, carried out for up to a maximum of 24 h. As shown in Fig. 2, the expression levels of AR, ERa, and ERb did not differ between male HUVECs cultured either for 10 h in the gonadal-free media or following stimulation with T (1,000 nM) or E2 (1,000 nM) for 48 h in complete medium. The same responses were obtained in female HUVECs (not shown). Effects of T, DHT, E2, and AAS on VCAM-1, ICAM-1, and E-selectin mRNA expression in male and female HUVECs Fig. 2 Quantification by real-time RT-PCR of sex hormone receptor mRNAs in male HUVECs incubated with different culture conditions and after treatment with sex hormones. No significant difference (P \ 0.05) from cells grown in complete medium was found
between the expression level of AR compared to ERa and ERb was also observed at the protein level, as demonstrated by Western blot analysis (Fig. 1b). According to mRNA levels, the AR protein was abundantly expressed in both male and female HUVECs, whereas only the ERb protein was detected in HUVECs, although at a very low expression level. The estrogen-responsive MCF-7 cell line was used as a positive control for ERa protein expression. We subsequently analyzed whether different culture conditions modified the pattern of AR, ERa, and ERb mRNA expression in male and female HUVECs. The incubation of male and female HUVECs with phenol redfree M199 medium and charcoal-stripped FBS for more
123
Basal VCAM-1, ICAM-1, and E-selectin mRNA expression was low in unstimulated cells and preincubation of male and female HUVECs with different concentrations of T and E2 for 48 h, without TNF-a stimulation, did not modify the expression pattern of CAM genes (not shown), as previously reported [4]. Preliminary experiments showed that exposure of HUVECs to 10 ng/ml TNF-a for 4 h led to maximal VCAM-1, ICAM-1, and E-selectin mRNA expression, a level that could not be increased any further. Since sex hormones could either up- or downregulate the HUVEC inflammatory response, a 1-ng/ml concentration of TNF-a was used for the next experiments in order to detect both up-regulation and down-regulation of CAM mRNAs after the sex steroid hormone treatment. The effects of the sex hormones T and E2 on TNF-a induced CAM mRNA expression were first analyzed on male and female HUVECs grown in phenol red- and
J Endocrinol Invest
VCAM/GAPDH mRNA
2.4
pro-inflammatory effect of TNF-a (Fig. 5). Like that which was obtained for T, the increase was statistically significant only for VCAM-1, although the extent of its induction was lower compared to that caused by T (compare Figs. 4a, 5). Finally, we tested the effect of several AAS 48 h treatments (100 nM) on TNF-a (1 ng/ml) induced CAM expression in HUVEC cells. The reported results are referred to male HUVEC cells; the same responses were obtained in female HUVECs (not shown). A statistically significant pro-inflammatory effect was demonstrated for 17a-methyl-testosterone, clostebol acetate and 17bhydroxy-17-methyl-androsta-1,4-dien-3-one (VCAM-1 and ICAM-1 mRNA induction), and trans-dehydroandrosterone (ICAM-1 mRNA induction). Any protective effect of nandrolon, 4-androsten-3,17-dione, fluoxymesterone, and trenbolone was definitively excluded (Fig. 6).
Male
2
Female
1.6 1.2 0.8 0.4 0
ICAM/GAPDH mRNA
2.5
Male
2
Female
1.5 1 0.5 0
E-selctin/GAPDH mRNA
4
Effects of T, DHT, E2, and AAS on TNF-a-induced monocyte adhesion to male and female HUVECs
Male
3.2
Female
2.4 1.6 0.8 0
TNF-α α
-
+
+
+
+
T nM
0
0
10
100
1000
Fig. 3 Effects of T treatment on TNF-a induced CAM expression in male and female HUVECs cultured in gonadal-free medium. No significant difference (P \ 0.05) from TNF-a treated cells was found
gonadal hormone-free medium. In TNF-a stimulated male and female HUVECs, treatment with higher concentrations of T (100 and 1,000 nM) induced CAM mRNAs slightly, but the increase was not statistically significant (Fig. 3). E2 did not affect CAM expression at any of the concentrations tested (not shown). We then assessed the effects of T treatment for 48 h on cytokine-mediated endothelial CAM induction. In order to avoid loss of cell viability, both male and female HUVECs were grown in complete medium and treated with different concentrations of T for 48 h; TNF-a (1 ng/ml) was added during the last 4 h of incubation. In both male and female HUVEC, T significantly increased the TNF-a induced VCAM-1 expression, whereas the mRNA levels of ICAM-1 and E-selectin were not significantly modified (Fig. 4a). No effect on CAM expression was observed upon incubation with E2 for 48 h (Fig 4b). We also analyzed the effects of DHT on TNF-a induced CAM expression. In both male and female HUVECs, treatment with 100 nM DHT for 48 h slightly amplified the
We subsequently analyzed the effects of sex hormones on endothelial cell-U937 interactions. Male and female HUVECs were treated with T (Fig. 7a), DHT (Fig. 7b), and E2 (Fig. 7c) for 48 h; TNF-a (1 ng/ml) was added during the last 6 h incubation and before the adhesion assay. After treatment with T and DHT, a significant increase in monocyte adhesion to endothelial cells was observed: T and DHT increased the adhesion by 20 and 18 %, respectively, whereas E2 had no effect. As observed in mRNA quantification experiments, the effects of sex hormones appeared to be unrelated to HUVEC gender. Thus, the effect of AAS at 100 nM concentrations on endothelial cell-U937 interaction was evaluated as described for sex hormones in HUVECs (Fig. 8). In agreement with results obtained with RT-PCR Real-time trans-dehydroandrosterone, 17a-methyl-testosterone, clostebol acetate, and 17b-hydroxy-17-methyl-androsta-1,4-dien-3-one showed a statistically significant pro-inflammatory effect. Adhesion of U937 to HUVEC was increased also by nandrolone treatment. None of the AAS had a protective effect.
Discussion This study represents the first comparison of the inflammatory effect of sex hormones T, the non-aromatizable androgen DHT, and E2 on male and female HUVECs. In both HUVEC genders, androgens have a pro-inflammatory effect increasing the TNF-a-induced VCAM-1 gene expression and adhesion of U937 to HUVEC, whereas E2 had no effect.
123
J Endocrinol Invest
VCAM/GAPDH mRNA
a
E-selectin/GADPH mRNA
ICAM/GAPDH mRNA
Fig. 4 Effects of sex hormone treatments on TNF-a induced CAM expression in male and female HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
3
b 3
Male
2.5
Female
*
2
*
1.5
*
1
*
2.5
* *
1.5 1 0.5
0
0
3
Female
2
0.5
3
Male Female
2.5 2
2
1.5
1.5
1
1
0.5
0.5
0
0
3
Female
3
Male Female
2.5
Male
2.5
Male
2.5
2
2
1.5
1.5
1
1
0.5
0.5
0
Female
0
TNF-α α
-
+
+
+
T nM
0
0
10
100
Several authors have used HUVECs to analyze the effect of sex hormones on endothelial cell adhesion, obtaining discrepant findings due, at least in part, to heterogeneity of cell culture conditions [4–9]. In fact, some authors have used normal, complete medium [5], while others have employed phenol red-free medium supplemented with charcoal-stripped serum [4] to exclude any basal estrogen effect or artifactual ER binding. Moreover, although in vivo endothelial cells express both AR and ERs [8, 18], many factors can influence the expression of sex hormone receptors both in vivo [11] and in vitro [12–16, 19]. Since the physiologically relevant effects of sex hormones are mainly receptor dependent [11], knowledge of the levels of receptor expression is essential to gain more insights into the hormone responsiveness of endothelial cells. For this reason, we first compared the expression of the sex hormone receptors AR, ERa and ERb, and T converting enzymes aromatase, 5a-reductase 1, and 5areductase 2 in HUVECs obtained from male and female donors. Surprisingly, no significant gender-related difference was found (Fig. 1). Male and female HUVECs expressed high levels of AR and 5a-reductase 1 and very low levels of estrogen receptors and aromatase (Fig. 1). Neither the different culture conditions nor the treatment
123
Male
+
TNF-α
1000 E2 nM
0
+ 0
+ 10
+ 100
+ 1000
with steroid hormones modified this expression pattern (Fig. 2). These data are in contrast with the general assumption that HUVEC gender is the main factor that determines the pattern of expression of sex hormone receptors. Interestingly, previous studies have demonstrated that normal ER function is required in both males and females for normal cardiovascular development [20]; moreover, a reduction of ER expression is related to the progression of atherosclerosis [21]. It is worth noting that the pattern of sex hormone receptor expression found in our HUVECs (Fig. 1) and in others in vitro studies [18, 19] is more similar to that which is found in atherosclerotic vessels rather than normal vessels. Treatment with the sex hormones T and DHT augmented the TNF-a-induced rise in VCAM-1 gene (Figs. 4a, 5, respectively) and adhesion of U937 to HUVECs (Fig. 6a, b), whereas E2 had no effect (Figs. 4b, 6c). The lack of significant effects of E2 in all the tested conditions could be explained by the very low amount of ERa and ERb in our cells (Fig. 1), and was consistent with other studies demonstrating that vascular reactivity to sex hormones requires functional receptors [11, 22]. The very low level of aromatase expression and the ability of DHT, but
VCAM/GAPDH mRNA
J Endocrinol Invest 3 2.5
Male Female
*
2 1.5
*
1 0.5
ICAM/GAPDH mRNA
0
3 2.5
Male Female
2 1.5 1 0.5 0
E-selectin/GAPDH mRNA
3 2.5
Fig. 6 Effects of AAS treatments on TNF-a induced CAM expression in male HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
Male Female
2 1.5 1 0.5 0
TNF-α DHT nM 0
+ 0
+ 10
+ 100
+ 1000
Fig. 5 Effects of DHT treatment on TNF-a induced CAM expression in male and female HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
not of E2, to replicate pro-inflammatory effects of T suggest that these androgenic effects are mediated via AR. However, more complex mechanisms appear to be involved since the extent of VCAM-1 induction was lower for DHT than it was for T (see Figs. 4a, 5). Interestingly, even though DHT is not aromatizable to E2, recent studies have demonstrated that DHT is not a specific marker of androgen action since it can also be converted to 3b-Adiol, a molecule with a high affinity for estrogen receptors but unable to bind AR [10, 23, 24]. Notably, Norata et al. [10] demonstrated that 3b-Adiol promotes some anti-inflammatory effects on TNF-a stimulated HUVECs via ERb activation. In any case, due to the very low level of estrogen receptors found in our HUVEC lines (Fig. 1), 3bAdiol, if present, could not exert its protective effect. Atherosclerosis and CHD are prevalent in men compared to premenopausal women, and this evidence has been linked to dominance of androgens over estrogens in male gender [1]. However, a decrease in serum testosterone
levels, induced by aging or by androgen deprivation treatments, is associated with CHD and with several cardiovascular risk factors, such as insulin resistance and diabetes, lipid and inflammatory profiles, and visceral obesity [2]. Testosterone therapy aimed to achieve a normal physiological testosterone concentration provides beneficial effects on CHD and on metabolic syndrome, and thus is likely to act on whole body environmental and pathophysiological factors predisposing to atherosclerosis [2]. These effects are a result of achieving physiological serum testosterone concentration by balancing T and E2 levels but not by administration of normal androgen levels [2]. Obviously, the results of in vitro studies can help in understand the effects of androgen supplementation to endothelial cell, but cannot reproduce whole body effects of sex hormones. Our in vitro study suggests that supplementation of high doses of androgens could have direct negative consequences on endothelial cells also in vivo, especially in subjects presenting a chronic pro-inflammatory status such as obesity, metabolic syndrome, diabetes, and atherosclerosis. Based on our results regarding natural sex hormones, we next decided to test several anabolic androgenic steroids (AAS). Even though AAS have been prohibited in sports since 1974, they are still widely abused by athletes, who use doses of hormones that are between 10 and 100 times higher than therapeutic doses. Structural modifications have been introduced into T molecule in order to circumvent doping control and to become more anabolic and less androgenic than natural hormones [25].
123
J Endocrinol Invest Fig. 7 Effects of T, DHT, and E2 treatment on TNF-a induced adhesion of U937 cells to male and female HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
Adhesion of U937 to HUVECs
a 1.8
1.5
Male Female
Adhesion of U97 to HUVECs
1.5
Male Female
1.8
*
1.5
*
*
0.9
0.6
0.6
0.6
0.3
0.3
0.3
* * * *
1.00
0.50
0.00
0
TNF-α + 100 DHT nM 0
Male Female
0.9
0.9
+ 0
c
1.2
1.2
0
*
*
1.2
TNF-α T nM 0
1.50
b 1.8
0
+ 0
+ 100
TNF-α
E2 nM 0
+ 0
+ 100
This study represents the first complete characterization of sex steroid conversion enzyme and receptors in male and female HUVECs, and reveals that the components involved in androgen action are predominant on those of estrogen action. The results reported in this paper show that the use (and abuse) of synthetic steroids and natural sex hormones is likely to play a direct and negative role in vascular inflammation and atherosclerosis. Acknowledgments This study was supported by ‘‘Commissione per la vigilanza ed il controllo sul doping’’, Italian Ministry of Health. We would like to thank GlaxoSmithKline which provided valuable reagents and Dr. Laura Guerra for linguistic help. Conflict of interest of interest.
The authors declare that they have no conflict
References Fig. 8 Effects of AAS treatment on TNF-a induced adhesion of U937 cells to HUVECs. *P \ 0.05, significantly different when compared with TNF-a treated cells
Substitution can modify molecule binding to AR, and little information is available on the effect of structural changes on the action of AAS. The data obtained in our experimental system showed that several AAS, frequently used in doping, have a pro-inflammatory effect on endothelial cells and thus a potential in vivo effect on atherosclerosis and CHD, especially in predisposed subjects. We could not find a clear correlation between structure modification of AAS (that could influence AR binding) and their pro-inflammatory effect, anyway we conclusively excluded any protective effect for all the tested hormones. It is worthy of note that our data have been obtained after a 48-h incubation; however, AAS abusers use high doses of hormones for a long time, leading to hypothesize an even more detrimental effect.
123
1. Wu FC, von Eckardstein A (2003) Androgens and coronary artery disease. Endocr Rev 24(2):183–217 2. Jones TH, Saad F (2009) The effects of testosterone on risk factors for, and the mediators of, the atherosclerotic process. Atherosclerosis 207(2):318–327 3. Libby P, Ridker PM, Hansson GK (2011) Progress and challenges in translating the biology of atherosclerosis. Nature 473(7347): 317–325 4. Mukherjee TK, Dinh H, Chaudhuri G, Nathan L (2002) Testosterone attenuates expression of vascular cell adhesion molecule-1 by conversion to estradiol by aromatase in endothelial cells: implications in atherosclerosis. Proc Natl Acad Sci USA 99(6): 4055–4060 5. Zhang X, Wang LY, Jiang TY, Zhang HP, Dou Y, Zhao JH, Zhao H, Qiao ZD, Qiao JT (2002) Effects of testosterone and 17-betaestradiol on TNF-alpha-induced E-selectin and VCAM-1 expression in endothelial cells. Analysis of the underlying receptor pathways. Life Sci 71(1):15–29 6. Murphy HS, Sun Q, Murphy BA, Mo R, Huo J, Chen J, Chensue SW, Adams M, Richardson BC, Yung R (2004) Tissue-specific effect of estradiol on endothelial cell-dependent lymphocyte recruitment. Microvasc Res 68(3):273–285 7. McCrohon JA, Jessup W, Handelsman DJ, Celermajer DS (1999) Androgen exposure increases human monocyte adhesion to
J Endocrinol Invest
8.
9.
10.
11.
12.
13.
14.
15.
16.
vascular endothelium and endothelial cell expression of vascular cell adhesion molecule-1. Circulation 99(17):2317–2322 Death AK, McGrath KC, Sader MA, Nakhla S, Jessup W, Handelsman DJ, Celermajer DS (2004) Dihydrotestosterone promotes vascular cell adhesion molecule-1 expression in male human endothelial cells via a nuclear factor-kappaB-dependent pathway. Endocrinology 145(4):1889–1897 Norata GD, Tibolla G, Seccomandi PM, Poletti A, Catapano AL (2006) Dihydrotestosterone decreases tumor necrosis factor-alpha and lipopolysaccharide-induced inflammatory response in human endothelial cells. J Clin Endocrinol Metab 91(2):546–554 Norata GD, Cattaneo P, Poletti A, Catapano AL (2010) The androgen derivative 5alpha-androstane-3beta, 17beta-diol inhibits tumor necrosis factor alpha and lipopolysaccharide induced inflammatory response in human endothelial cells and in mice aorta. Atherosclerosis 212(1):100–106 Vitale C, Mendelsohn ME, Rosano GM (2009) Gender differences in the cardiovascular effect of sex hormones. Nat Rev Cardiol 6(8):532–542 Post WS, Goldschmidt-Clermont PJ, Wilhide CC, Heldman AW, Sussman MS, Ouyang P, Milliken EE, Issa JP (1999) Methylation of the estrogen receptor gene is associated with aging and atherosclerosis in the cardiovascular system. Cardiovasc Res 43(4):985–991 Ying AK, Hassanain HH, Roos CM, Smiraglia DJ, Issa JJ, Michler RE, Caligiuri M, Plass C, Goldschmidt-Clermont PJ (2000) Methylation of the estrogen receptor-alpha gene promoter is selectively increased in proliferating human aortic smooth muscle cells. Cardiovasc Res 46(1):172–179 Ihionkhan CE, Chambliss KL, Gibson LL, Hahner LD, Mendelsohn ME, Shaul PW (2002) Estrogen causes dynamic alterations in endothelial estrogen receptor expression. Circ Res 91(9):814–820 Haas E, Meyer MR, Schurr U, Bhattacharya I, Minotti R, Nguyen HH, Heigl A, Lachat M, Genoni M, Barton M (2007) Differential effects of 17beta-estradiol on function and expression of estrogen receptor alpha, estrogen receptor beta, and GPR30 in arteries and veins of patients with atherosclerosis. Hypertension 49(6):1358–1363 Caulin-Glaser T, Watson CA, Pardi R, Bender JR (1996) Effects of 17beta-estradiol on cytokine-induced endothelial cell adhesion molecule expression. J Clin Invest 98(1):36–42
17. Akane A (1998) Sex determination by PCR analysis of the X–Y amelogenin gene. Methods Mol Biol 98:245–249 18. Evans MJ, Harris HA, Miller CP, Karathanasis SK, Adelman SJ (2002) Estrogen receptors alpha and beta have similar activities in multiple endothelial cell pathways. Endocrinology 143(10): 3785–3795 19. Toth B, Saadat G, Geller A, Scholz C, Schulze S, Friese K, Jeschke U (2008) Human umbilical vascular endothelial cells express estrogen receptor beta (ERbeta) and progesterone receptor A (PR-A), but not ERalpha and PR-B. Histochem Cell Biol 130(2):399–405 20. Mendelsohn ME, Karas RH (2005) Molecular and cellular basis of cardiovascular gender differences. Science 308(5728): 1583–1587 21. Virdis A, Ghiadoni L, Pinto S, Lombardo M, Petraglia F, Gennazzani A, Buralli S, Taddei S, Salvetti A (2000) Mechanisms responsible for endothelial dysfunction associated with acute estrogen deprivation in normotensive women. Circulation 101(19):2258–2263 22. Mori M, Tsukahara F, Yoshioka T, Irie K, Ohta H (2004) Suppression by 17beta-estradiol of monocyte adhesion to vascular endothelial cells is mediated by estrogen receptors. Life Sci 75(5):599–609 23. Weihua Z, Lathe R, Warner M, Gustafsson JA (2002) An endocrine pathway in the prostate, ERbeta, AR, 5alpha-androstane3beta, 17beta-diol, and CYP7B1, regulates prostate growth. Proc Natl Acad Sci USA 99(21):13589–13594 24. Guerini V, Sau D, Scaccianoce E, Rusmini P, Ciana P, Maggi A, Martini PG, Katzenellenbogen BS, Martini L, Motta M, Poletti A (2005) The androgen derivative 5alpha-androstane-3beta, 17betadiol inhibits prostate cancer cell migration through activation of the estrogen receptor beta subtype. Cancer Res 65(12):5445–5453 25. Fragkaki AG, Angelis YS, Koupparis M, Tsantili-Kakoulidou A, Kokotos G, Georgakopoulos C (2009) Structural characteristics of anabolic androgenic steroids contributing to binding to the androgen receptor and to their anabolic and androgenic activities. Applied modifications in the steroidal structure. Steroids 74(2):172–197
123
