NSC 16258
No. of Pages 11
25 May 2015 Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008 1
Neuroscience xxx (2015) xxx–xxx
4
EFFECTS OF JIP3 ON EPILEPTIC SEIZURES: EVIDENCE FROM TEMPORAL LOBE EPILEPSY PATIENTS, KAINIC-INDUCED ACUTE SEIZURES AND PENTYLENETETRAZOLE-INDUCED KINDLED SEIZURES
5 6 7
Z. WANG, a,b Y. CHEN, a Y. LU¨, a X. CHEN, a L. CHENG, a X. MI, a X. XU, a W. DENG, a Y. ZHANG, a N. WANG, a J. LI, a Y. LI a AND X. WANG a*
2 3
a
8 9 10
Department of Neurology, The First Affiliated Hospital of Chongqing Medical University, Chongqing Key Laboratory of Neurology, Chongqing 400016, China
11 12
b
13
Department of Neurology, Fuling Central Hospital, Chongqing 408000, China
Abstract—JNK-interacting protein 3 (JIP3), also known as JNK stress-activated protein kinase-associated protein 1 (JSAP1), is a scaffold protein mainly involved in the regulation of the pro-apoptotic signaling cascade mediated by c-Jun N-terminal kinase (JNK). Overexpression of JIP3 in neurons in vitro has been reported to lead to accelerated activation of JNK and enhanced apoptosis response to cellular stress. However, the occurrence and the functional significance of stress-induced modulations of JIP3 levels in vivo remain elusive. In this study, we investigated the expression of JIP3 in temporal lobe epilepsy (TLE) and in a kainic acid (KA)-induced mouse model of epileptic seizures, and determined whether down-regulation of JIP3 can decrease susceptibility to seizures and neuron damage induced by KA. We found that JIP3 was markedly increased in TLE patients and a mouse model of epileptic seizures; mice underexpressing JIP3 through lentivirus bearing LVLetm1-RNAi showed decreased susceptibility, delayed first seizure and decreased seizure duration response to the epileptogenic properties of KA. Subsequently, a decreased activation of JNK following seizure induction was observed in mice underexpressing JIP3, which also exhibited less neuronal apoptosis in the CA3 region of the hippocampus, as assessed three days after KA administration. We also found that mice underexpressing JIP3 exhibited a delayed pentylenetetrazole (PTZ)-induced kindling seizure process. Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Key words: JIP3, JNK, temporal lobe epilepsy, lentivirus, apoptosis. 14
*Corresponding author. Tel/fax: +86-23-6870-8697. E-mail address: [email protected] (X. Wang). Abbreviations: AEDs, antiepileptic drugs; ANOVA, analysis of variance; GFAP, anti-glial fibrillary acidic protein; IR, ischemia– reperfusion; JIP3, JNK-interacting protein 3; JNK, c-Jun N-terminal kinase; KA, kainic acid; MAP2, anti-microtubule-associated protein-2; OD, optical density; PTZ, pentylenetetrazole; TLE, temporal lobe epilepsy. http://dx.doi.org/10.1016/j.neuroscience.2015.05.008 0306-4522/Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved. 1
INTRODUCTION
15
Epilepsy, characterized by recurrent spontaneous seizures, is one of the most common chronic neurologic disorders, affecting 50 million individuals worldwide (McNamara, 1999; Banerjee et al., 2009). Despite treatment with a variety of antiepileptic drugs (AEDs), approximately 30% of the newly diagnosed epilepsy cases are drug resistant (Schmidt and Loscher, 2005; French, 2007). Temporal lobe epilepsy (TLE) is the most common type of epilepsy in adults, and up to 75% of patients with TLE eventually develop refractory epilepsy (Henshall and Simon, 2005; Schmidt and Loscher, 2005). Uncontrolled seizures ultimately lead to hippocampal sclerosis, the characteristic structural changes in TLE. However, the mechanism of TLE is not completely understood. It is well known that the c-Jun N-terminal kinases (JNKs) play a central role in cell apoptosis under environmental stress (Davis, 2000; Waetzig and Herdegen, 2005) and that JNK is clearly involved in excitotoxic neuronal apoptosis in the hippocampus following seizures (Spigolon et al., 2010; Zhao et al., 2012). JNK-interacting protein 3 (JIP3), which is selectively enriched in brain tissue (Akechi et al., 2001),and was first identified as a scaffold protein, interacts with components of the JNK signaling cascade and facilitates JNK activation (Kelkar et al., 2000; Matsuura et al., 2002; Song and Lee, 2007). Muresan and Muresan (2005) reported that exogenous expression of JIP3 increased the level of JNK activation after anisomycin treatment. A recent study reported that overexpression of JIP3 increased ischemia– reperfusion (IR)-induced JNK activity and apoptosis, whereas the underexpression of JIP3 inhibited IRinduced JNK activation and apoptosis (Xu et al., 2010). However, whether JIP3 is involved in neuronal apoptosis induced by seizures is unclear. Recently, the interactions between JIP3 and JNK have been shown to be modulated by other proteins, such as focal adhesion kinase, toll-like receptors and ROCK1 (Takino et al., 2002, 2005; Ongusaha et al., 2008). In addition, JIP3 has been shown to be an adaptor that links cellular cargo to Kinesin-I, a major molecular motor for axonal transport (Verhey et al., 2001; Koushika, 2008). Finally, recent studies have demonstrated that JIP3 modulates axon elongation in a seemingly paradoxical manner. Bilimoria et al. (2010) showed that JIP3 restricted axon branching in the cerebellar cortex through the GSK3/DCX signaling pathway rather than through a JNK-dependent pathway. In
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
NSC 16258
No. of Pages 11
25 May 2015
2 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
contrast, another report showed that JIP3 enhanced axon elongation in primary hippocampal neurons and cortical neurons in vivo in a JNK-dependent pathway (Sun et al., 2013). Because of the pleiotropic roles of JIP3 in vitro, its physiological functions in vivo are difficult to determine. In this study, we investigated the effect of JIP3 on TLE and on a kainic acid (KA)-induced seizure model. First, we examined JIP3 protein expression in TLE patients and in mice with KA-induced seizures. Then, by knocking down JIP3 in the hippocampus in adult mice, we investigated the effect of underexpression of JIP3 on behavioral activity as well as hippocampus damage in 3 days following KA treatment. We also assessed the effect of the underexpression of JIP3 on a kindling model.
EXPERIMENTAL PROCEDURES
77 78
Human brain tissue samples
79
A total of 30 brain tissue samples from patients (17 males and 13 females; mean age 20.17 ± 8.76; range 4–40 years) undergoing surgery for medically intractable TLE were randomly chosen from our brain tissue bank. All procedures and experiments complied with The Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments involving humans and were approved by the National Institutes of Health and the Committee on Human Research at Chongqing Medical University. All TLE patients were refractory to three or more AEDs at the maximal doses. Presurgical assessment consisted of a detailed medication history, neurological examination, interictal and ictal electroencephalogram, neuropsychological testing and neuroradiological studies. Informed written consent for the use of the tissue in research was obtained before the surgery. TLE patients who underwent surgical removal of the epileptogenic zone were for strictly therapeutic purpose. The typical surgical method was anterior temporal neocortex resection. Table 1 summarizes the clinical features of TLE patients. For comparison, we obtained 10 histological normal temporal neocortex samples from individuals (six males and four females; mean age 20.00 ± 6.37 years; range 15–36 years) who were treated for increased intracranial pressure due to head trauma without apparent signs of central nervous system disease or exposure to AEDs. The samples from these patients were obtained only for treatment purpose. There were no significant differences in the age and sex between TLE and control patients (p > 0.05). Table 2 shows the clinical features of the controls.
80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
111
Mice
112
For this study, 6–8-week-old male C57BL/6 mice weighing 18–22 g were obtained from the Experimental Animal Centre of Chongqing Medical University. All animals were housed in a humidity- and temperaturecontrolled room with a 12-h light/dark cycle. Water and food were available ad libitum. The experiment procedures were conducted in compliance with the
113 114 115 116 117 118
Ethics of Experiments on Animals Commission of Chongqing Medical University and were in complete compliance with international standards.
119
Kainic acid-induced seizures
122
Kainic acid (KA, Sigma, USA) was dissolved in 0.9% saline in a volume of 10 ml/kg. Due to the inconsistent and relatively large difference in KA doses administered via intraperitoneal injections in mice described in previous reports (Brecht et al., 2005; Avignone et al., 2008; Szaroma et al., 2012; Zelano et al., 2013), we performed a preliminary dose–response trial. KA was administered at doses of 15, 20 and 25 mg/kg body weight. The dose of 20 mg/kg was established as being sufficient to trigger seizures with lower mortality and was chosen as the optimal dose. Behavioral assessment of seizure severity was scored according to a modified Racine scale as reported previously (Monory et al., 2006): 0-no response; 1-immobility; 2-myoclonic jerks; 3-forelimb clonus and/or Straub tail; 4-forelimb clonus with rearing; 5-continuous rearing and fall; 6-severe clonic-tonic seizures; and 7-death. Mice were scored every 5 min for 60 min after KA injection. The highest score during each 5-min period was recorded by an observer who was blinded to the treatment. To minimize suffering and prevent mortality, we intraperitoneally injected diazepam (5 mg/kg) to blocked epileptic seizures 60 min after KA administration.
123
Pentylenetetrazole (PTZ) kindling
146
A subconvulsive dose of PTZ (Sigma–Aldrich, USA, 35 mg/kg, i.p.) was administered on alternating days. After each PTZ injection, the mice were kept in a Plexiglas chamber and were observed for 30 min. The seizure intensity was scored as follows (Mishra and Goel, 2012): 0-no response; 1-hyperactivity, restlessness and vibrissae twitching; 2-head nodding, head clonus and myoclonic jerks; 3-unilateral or bilateral limb clonus; 4forelimb clonic seizures; 5-generalized tonic-clonic seizures with falling; 6-hind limb extensor; and 7-death.
147
Lentivirus product and stereotaxic injection
157
JIP3 siRNA was designed and synthesized with the following sequences: rat and mice JIP3, CACCGTGATGCTGTCAAATT (Bilimoria et al., 2010). The lentiviral vector backbone was Mu6-MCS-Ubi-EGFP. The same backbone expressing GFP alone was used as a negative control. Lentiviral vector construction (LV-JIP3-RNAi and LV-GFP) and lentivirus product were completed by Shanghai GeneChem Co. Ltd., China. The titer of the lentivirus was 1.2E + 9TU/ml. Stereotaxic intra-hippocampus injection has been described in our previous study (Zhang et al., 2013). Briefly, mice were deeply anesthetized with an intraperitoneal injection of 3.5% chloral hydrate (1 ml/100 g), then fixed in a stereotaxic instrument (Stoelting Co. Ltd., USA). A volume of 2-ll LV-JIP3-RNAi (n = 21) and LV-GFP (n = 21) were infused through a glass pipette (0.2 ll/min) bilaterally into the hippocampus ( 2.0 mm AP, ±2.0 mm
158
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
120 121
124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145
148 149 150 151 152 153 154 155 156
159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174
NSC 16258
No. of Pages 11
25 May 2015
3
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx Table 1. Clinical characteristics of TLE patients Subjects
Gender (M/F)
Age (year)
Course (year)
AEDs before the surgery
Resection tissue
Pathological diagnosis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
F M F M M F F F M M M F M M M F M F F M M F F M M M F F M M
25 21 13 9 24 22 33 24 6 29 19 6 19 23 24 23 21 24 19 4 31 21 40 5 8 18 19 31 19 25
10 14 12 7 21 21 9 20 5 28 17 5 15 2 2 10 3 17 13 3 20 10 20 4 7 13 15 27 18 13
CBZ, TPM, OXT VPA, CBZ, LTG CBZ, TPM, CZP VPA, TPM, LTG, LEV PHT, VPA, CBZ, TPM VPA, PHT, TPM, LEV VPA, OXT, LTG CBZ, OXT, LEV, PB OXT, LTG, LEV VPA, CBZ, PHT, LTG, PB VPA, CBZ, LTG, OXT VPA, LTG, LEV CBZ, TPM, LTG VPA, LTG, LEV OXT, LEV, PB CBZ, OXT, LTG VPA, LTG, LEV VPA, CBZ, OXT,LEV VPA, OXT, LTG OXT, LTG, LEV CBZ, PHT, TPM, LTG CBZ, LTG, CZP CBZ, PHT, LTG, TPM, LTG, LEV, PB VPA, TPM, OXT VPA, CBZ, LEV CBZ, VPA, LTG, OXT VPA, CBZ, LEV, CZP VPA, TPM, LTG, LEV VPA, CBZ, LTG, PB
TNl TNr TNr TNr TNr TNl TNl TNr TNl TNr TNr TNl TNl TNl TNr TNr TNr TNl TNl TNl TNl TNl TNl TNl TNr TNl TNr TNr TNl TNl
NL, NL, NL NL, NL NL, NL G NL NL NL NL NL NL G NL, NL, NL, G G G NL, NL, G NL, NL, NL, NL, NL NL
G G G G
G G G
G G G G G G
P, patients; C, control; M, male; F, female; AEDs, antiepileptic drugs; CBZ, carbamazepine; TPM, topiramate; OXC, oxcarba-zepine; VPA, valproate; LTG, lamotrigine; CZP, clonazepam; LEV, Levetiracetam; PHT, phenytoin; PB, phenobarbital; TN, temporal neocortex; l, left; r, right; NL, neuron loss; G, Gliosis.
Table 2. Clinical characteristics of TLE patients Subjects
Gender (F/M)
Age (year)
Etiology diagnosis
Resection tissue
Tissue pathology
1 2 3 4 5 6 7 8 9 10
F F F F M M M M M M
30 17 23 26 36 21 15 19 25 28
Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma
TNr TNr TNr TNl TNl TNr TNl TNl TNl TNr
N N N N N N N N N N
F, female; M, male; l, left; r, right; TN, temporal neocortex; N, normal.
179
ML, 2.0 mm DV from bregma). The pipette was kept in place for 5 min and retracted stepwise to minimize backflux. All mice were allowed 2 weeks to recover from surgery and for the lentivirus to reach maximal expression; then, the behavioral study was performed.
180
Tissue preparation
175 176 177 178
181 182 183 184
Human. One part of the resected brain tissue samples was immediately stored in liquid nitrogen for western blot analysis. Another part of the tissues samples was fixed in 4% paraformaldehyde for 48 h. Then, the tissues
were either processed for paraffin embedding (sectioned into 5 lm for immunohistochemistry analysis) or frozen for cryostat sectioning (10-lm-thick sections for immunofluorescence analysis).
185
Mice. Samples were obtained 2, 4, 8 and 24 h (n = 4 in each) after seizure induction. At various time points, the mice were sacrificed by decapitation after an i.p. injection of a lethal dose of chloral hydrate. The removed brains were dissected to collect hippocampus and then placed in liquid nitrogen for western bolt analysis. The mice used for the morphological and immunofluorescence
189
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
186 187 188
190 191 192 193 194 195
NSC 16258
No. of Pages 11
25 May 2015
4
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
209
studies were deeply anesthetized and intracardially perfused with 0.9% saline, followed by 0.4% paraformaldehyde. The brains were removed and postfixed in the same fixative overnight. The subsequent procedures after fixation were the same for the human samples. To determine the distribution of GFP and the expression of JIP3 in the lentivirus-injected mice, LVJIP3-RNAi mice (n = 3) and LV-GFP mice (n = 3) were sacrificed by decapitation after an i.p. administration of a lethal dose of chloral hydrate. Then, the brain tissues were sectioned immediately at 20 lm at 20 °C and mounted on polylysine-coated slides for laser confocal analysis. The tissues used for western blot were prepared as described above.
210
Western blot
211
241
Tissues samples were homogenized in Lysis Buffer that included phosphatase inhibitors, protease inhibitors and phenyl-methylsulfonyl fluoride (PMSF) (KeyGen Biotech, Nanjing, China). Then, the homogenates were centrifuged at 12000g for 15 min at 4 °C. The supernatants were collected, and the protein concentration was determined using a bicinchoninic acid protein (BCA) assay kit (Beyotime Institute of Biotechnology, China). Samples were stored at 80 °C until analysis. Protein (50 lg per lane) was separated by 8% SDS–PAGE and electrotransferred onto polyvinylidene difluoride membranes (Millipore, MA, USA). After blocking with 5% BSA for 1 h at 37 °C, the membranes were incubated at 4 °C overnight with relevant primary antibodies: rabbit anti-JIP3 (1:200, Santa Cruz biotechnology, USA), rabbit anti-GAPDH (1:2000, Proteintech, Wuhan, China), rabbit antiphosphorylated JNK and rabbit anti-JNK (1:1000, Cell Signaling Technology, USA). Both GAPDH and t-JNK are as loading controls. Then, the membranes were washed and incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (1:5000, Zhongshan Golden Bridge Inc., China) for 1 h at 37 °C. The membranes were visualized using an ECL substrate (Beyotime Institute of Biotechnology, China). The mean optical density (OD) values of bands were measured with Quantity One 1-D Analysis software (Bio-Rad Laboratories, Hercules, USA) and were normalized to loading controls separately. Experiments were carried out in the same condition and repeated three times. The final OD values were averaged from three independent experiments.
242
Double immunofluorescence labeling
243
Frozen sections were air dried at room temperature at least for half an hour. After antigen retrieval, the sections was permeabilized with 0.5% Triton X-100 and incubated in 5% goat serum for 1 h at room temperature. Sections were then incubated with a mixture of rabbit anti-JIP3 antibody (1:50, Santa Cruz Biotechnology) and mouse anti-microtubule-associated protein-2 (MAP2) antibody (Boster Biological Technology, Wuhan, China), or with a mixture of rabbit anti-JIP3 antibody and mouse anti-glial fibrillary acidic protein (GFAP) antibody (Boster Biological Technology)
196 197 198 199 200 201 202 203 204 205 206 207 208
212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240
244 245 246 247 248 249 250 251 252 253
at 4 °C overnight. Sections were washed and incubated with fluorescein isothiocyanate (FITC) goat anti-rabbit IgG (1:200, Zhongshan Golden Bridge Inc. BeiJing, China) and tetraethyl rhodamine isothiocyanate (TRITC)-conjugated goat anti-mouse IgG (1:200, Zhongshan Golden Bridge Inc.) in the dark for 60 min at 37 °C, Then, the sections were washed with PBS and mounted in 1:1 glycerol/PBS. Fluorescent images were acquired by laser scanning confocal microscopy (Leica Microsystems Heidelberg GmbH, Germany ) on an Olympus IX 70 inverted microscope (Olympus, Japan).
254
Immunohistochemistry
265
Ten slides were cut from each sample (30 and 10 samples from TLE patients and controls, respectively), and three slides were randomly selected from each sample for immunohistochemical analysis. All the experiments were carried out in the same condition and repeated three times. Sections were deparaffinized, rehydrated, and antigen recovery was performed as for immunofluorescence. Then, the sections were incubated with primary rabbit anti-JIP3 (1:50, Santa Cruz Biotechnology) at 4 °C overnight, followed by incubation with secondary goat anti-rabbit antibody (Zhongshan Golden Bridge Inc.) for 30 min at 37 °C. Sections were treated with ABC working solution (Zhongshan Golden Bridge Inc.) for 30 min and incubated with 3,3diaminobenzidine (DAB; Zhongshan Golden Bridge Inc.) for 5 min. Counterstaining was carried out with Harris’s hematoxylin. Cell with buffy stain in cytoplasm was considered to be positive. Ten visualfields for each sample were randomly chosen under a LEICA DM600B automatic microscope (Leica Microsystems Heidelberg GmbH, Germany). Image-Pro plus 6.0 software (Media Cybemetrics, USA) was used for the quantitative analysis of JIP3 expression. Mean OD of each visionfield was automatically measured by computer. The final OD values were averaged from three independent experiments.
266
Cresyl Violet and TUNEL staining
292
Cresyl Violet staining was used to detect morphological changes and neuron destruction in the hippocampus, particularly in the CA3 region. The sections (5 lm) from three days after the KA treatment were soaked in a solution containing 0.1% Cresyl Violet (Sigma–Aldrich, MO, USA). TUNEL analysis was performed to measure the degree of apoptosis in the tissue using an in situ Cell Death Detection Kit (Roche Molecular Biochemicals, Mannheim, Germany) according to the manufacturer’s protocol. TUNEL-positive cells in the CA3 region of each section were counted by observers who were blinded to the treatment conditions.
293
Statistical analysis
306
All data are presented as mean ± SE. Statistical analysis of the results were performed using the unpaired t-test for comparisons of the two groups, and a one-way analysis of variance (ANOVA) ANOVA followed by Dunnett’s test for
307
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
255 256 257 258 259 260 261 262 263 264
267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291
294 295 296 297 298 299 300 301 302 303 304 305
308 309 310
NSC 16258
No. of Pages 11
25 May 2015
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx 311 312 313 314
315
multigroup comparisons. A repeated measures ANOVA was used for estimating the group differences in seizure severity and kindling acquisition. A value of p < 0.05 was considered statistically significant.
RESULTS
5
study showed that JIP3 expression was significantly higher in 25 of 30 samples in the temporal neocortex of TLE patients than that in controls (1.213 ± 0.1041 in patients with TLE and 0.6035 ± 0.07080 in control, P < 0.01, Fig. 2A, B). Immunohistochemical study showed that neuronal JIP3 immunoreactivity was stronger in patients with TLE (Fig. 2D) than in controls (Fig. 2C), which were significantly different (0.1303 ± 0.01487 in TLE and 0.05089 ± 0.006938 in control, P < 0.01; Fig. 2E). JIP3 expression was significantly increased in 24 of the 30 samples compared with controls.
325
337
340
316
Location of JIP3 in human and mice brain
317
321
JIP3 was expressed exclusively in neurons and mainly localized in the cytoplasm in TLE patients and mice post-seizure. JIP3 was colocalized with the dendritic marker MAP2 (Fig. 1A–C, G–I), but not with the astrocytic marker GFAP (Fig. 1D–F, J–I).
322
Overexpressed JIP3 in patients with TLE
Increased expression of JIP3 and the phosphorylation of JNK (p-JNK) in the hippocampus of KA-induced seizure mice model
323
Then, we investigated the expression of JIP3 in 30 TLE patients and 10 non-epileptic controls. Western blotting
Given the limitations of human studies, we used animal models of acute seizure trigged by KA administration.
318 319 320
324
Fig. 1. Immunofluorescent labeling of JIP3 in the cortex. JIP3 (green) and MAP2 (red) are colocalized in the temporal neocortex of a TLE patient (A–C) and in an epileptic mouse 3 days post seizures (G–I). JIP3 (green) and GFAP (red) are not colocalized in the temporal neocortex of a TLE patient (D–F) and in an epileptic mouse 3 days post seizures (J–L). The scale bar is 75 lm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
326 327 328 329 330 331 332 333 334 335 336
338 339
341
NSC 16258
No. of Pages 11
25 May 2015
6
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 2. Western blotting and immunohistochemistry analysis of the expression of JIP3 in the temporal neocortex of TLE patients. (A) Representative images of JIP3 expression in the temporal neocortex from the control and TLE group. (B) Comparison of the intensity ratio indicates significantly higher expression of JIP3 in patients with TLE than in controls. (**p < 0.01, unpaired t test, n = 30 in TLE group and n = 10 in control group). (C) Weak immunoreactive staining of JIP3 in the temporal neocortex of a control. (D) Relatively strong immunoreactive staining of JIP3 in a patient with TLE. (E) Comparison of the mean OD value indicates a significantly higher expression of JIP3 in the TLE group than in the control group (**p < 0.01, unpaired t test, n = 30 in TLE group and n = 10 in control group). The scale bar is 50 lm.
342 343 344 345 346 347 348 349 350 351 352 353 354 355 356
357 358 359 360 361 362 363 364 365
Prolonged seizure was triggered by intraperitoneally injected KA (20 mg/kg) in mice. KA administration induced a rapid and prominent increase in JIP3 in the hippocampus, increasing as early as 2 h following SE and reaching a peak at 8 h and maintaining a relatively high level thereafter (*P < 0.05 compared with control; Fig. 3A, B). Because JIP3 controls the efficiency of the JNK signaling pathway, we simultaneously measured pJNK expression which was used as an indication of the JNK activation state. We found that the dynamics of pJNK (46 kDa) is parallel to JIP3 expression after the induction of seizures (*P < 0.05 compared with control; Fig. 3A, B). p-JNK (54 kDa) and t-JNK levels were also investigated. However, p-JNK (54 kDa), t-JNK (46 kDa or 54 kDa) level remained unchanged.
Analysis of JIP3 expression after injection of recombinant lentivirus LV-JIP3-RNAi and LV- GFP were injected into the hippocampus as described above. We detected the transfection efficiency 14 days after lentivirus injection. LV bearing GFP was observed in the entire hippocampus and almost none was found in other tissues (Fig. 3C). Furthermore, the expression of JIP3 was significantly decreased in the LV-JIP3-RNAi group
compared with the LV-GFP group 14 days after the LV injection (*p < 0.05; Fig. 3D, E).
366
Underexpression of JIP3 attenuated acute seizures in mice after KA administration and inhibited the PTZinduced kindling seizure process
368
We first investigated the therapeutic potential of the underexpression of JIP3 in the hippocampus in KAinduced seizures. Mice were pretreated with LV-JIP3RNAi and LV-GFP 14 days before KA injection. LVJIP3-RNAi mice showed significantly attenuated seizure severity (P = 0.01; Fig. 4A), increased onset latency (P < 0.01; Fig. 4B) and decreased duration of seizures (P < 0.05; Fig. 4B) compared with LV-GFP mice treated with KA. Then, we detected whether down-regulation of JIP3 had a similar effect on another PTZ-induced kindling seizure model. The repeated administration of PTZ at 35 mg/kg produced chemical kindling by a progressive increase in the seizure score. No difference was noted in convulsive behavior with the first injection (Fig. 4C). Subsequently, when LV-GFP mice started to develop seizures, many LV-JIP3-RNAi animals remained insensitive to PTZ. LV-JIP3-RNAi mice eventually developed seizures with progressively increased score,
371
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
367
369 370
372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389
NSC 16258
No. of Pages 11
25 May 2015
7
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 3. Expression of JIP3, p-JNK and t-JNK in the hippocampus after systemic administration of KA and the expressions of green fluorescent protein (GFP) and JIP3 after injection of recombinant LV. (A) Representative Western Blots for the expression of JIP3, p-JNK, t-JNK at various time points after KA administration. (B) Comparison of the mean intensity ratio of JIP3 and p-JNK, t-JNK between control and epileptic mice at each time point after seizure induction, the expression of JIP3 and p-JNK (46 kDa) were significantly increased after KA induction (*p < 0.05 versus control. ANOVA followed by Dunnett’s test n = 4). (C) Immunofluorescent image showing GFP expression in the entire hippocampus. The scale bar is 500 lm. (D) Western blotting images showing JIP3 expressions after injection of LV-GFP and LV-JIP3-RNAi on day 14. (G) Comparison of the mean intensity ratio shows significantly decreased expression of JIP3 in the LV-JIP3-RNAi group compared with LV-GFP group (*p < 0.05, unpaired t test, n = 3).
390 391
392 393 394 395 396 397 398 399 400 401
402 403 404 405 406 407 408 409 410 411 412 413 414 415 416
but the seizures remained less severe than those in LVGFP mice (P < 0.05). Decreased p-JNK expression in the hippocampus in LV-JIP3-RNAi mice with KA-induced seizures We next investigated whether JIP3 contributes to the activation of JNK following KA-induced seizures. The expression of p-JNK was analyzed in the hippocampus of LV-JIP3-RNAi and LV-GFP mice 8 h after seizure induction. We found both JIP3 and p-JNK (46 kDa) expressions were significantly decreased in the hippocampus after seizures in the LV-JIP3-RNAi mice compared with the LV-GFP mice. (*p < 0.05, Fig. 4D, E). Underexpression of JIP3 produced neuronal protection in the hippocampus three days after KA treatment According to previous studies, the CA3 region of the hippocampus is the most vulnerable excitotoxic lesions caused by KA (Friedman et al., 1994; Park et al., 2008). Thus, we detected the CA3 region using Cresyl Violet and TUNEL staining. For the Cresyl Violet staining, photomicrographs of the negative control group (normal tissue) showed the integrity of the pyramidal cells with round and pale stained nuclei, while the pyramidal cells of the LV-GFP group treated with KA showed shrunken cells with pyknotic nuclei. However, we observed a large number of viable cells in the LV-JIP3-RNAi mice treated with KA demonstrating the protective effect of the
underexpression of JIP3 (Fig. 5A). TUNEL findings were consistent with Cresyl Violet staining results. There was a large increase in apoptotic cells in the LV-GFP mice after KA induction versus the control mice (***P < 0.001), whereas the LV-JIP3-RNAi mice showed no significant difference compared to the control group (p > 0.05) and significantly less apoptosis cells compared to LV-GFP mice treated with KA (#P < 0.05), as shown in Fig. 5B, C.
417
DISCUSSION
426
There is considerable evidence for the regulation of apoptosis signaling pathways in human TLE. Although it has been difficult to dissociate the consequences of epilepsy from its causes such as neuron death, preventing seizure-induced neuronal death is recognized as a potential therapeutic strategy for epileptogenesis (Henshall and Simon, 2005). It has been reported that JIP3 controls the efficiency and specificity of the JNK apoptotic signaling cascade (Borsello and Forloni, 2007). We hypothesized that JIP3 would be implicated in epileptic seizures and neuronal apoptosis. We perform our study in the TLE patients and the KA seizure model in adult mice. We chose this model because KA-induced seizure activity and brain damage are similar to human TLE (Ben-Ari and Cossart, 2000; Park et al., 2008). The present study reports the markedly increased JIP3 expression in TLE patients. We also found significantly increased JIP3 levels in the KA-induced seizure model, which suggests that an increased JIP3
427
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
418 419 420 421 422 423 424 425
428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445
NSC 16258
No. of Pages 11
25 May 2015
8
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 4. Effects of downexpressing JIP3 on KA-induced seizures and PTZ kindling process as well as expression of p-JNK after KA administration. (A) Graph showing Racine scores per 5 min period over 60 min after KA injection for LV-GFP group and LV-JIP3-RNAi group. Seizure response over time is more severe in the LV-JIP3-RNAi group (P = 0.01, repeated measures ANOVA: F(1,16) = 8.518; n = 9). (B) Bar graph showing the increased latency of first seizure (**p < 0.01) and deceased duration (*p < 0.05) in LV-JIP3-RNAi mice compared with LV-GFP mice after KA injection (unpaired t test, n = 9). (C) Development of PTZ kindling seizures evoked by repeated injection subthreshold dose (35 mg/kg). LV-JIP3RNAi mice shows significantly retarded kindling process compared with LV-GFP mice (p < 0.05; repeated measures ANOVA: F(1,16) = 5.490; n = 9). (D) Western blot analysis of the level of JIP3 and p-JNK in the hippocampus between the LV-GFP group and LV-JIP3-RNAi group in 8 h after KA administration. (E) Comparison of the intensity ratio showing significantly decreased JIP3 and p-JNK (46 kDa) expression in LV-JIP3-RNAi group compared with LV-GFP group (*p < 0.05, unpaired t test, n = 4). However, the p-JNK (54 kDa), t-JNK (46 kDa or 54 kDa) level were still unchanged.
446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464
level is a common feature of seizure activity. Our study also supports an important functional role of JIP3 in seizures because the underexpression of JIP3 results in an anticonvulsive effect after KA administration. In addition, we detected a marked suppression of kindled seizure progression in response to repeated PTZ treatment in mice underexpressing JIP3. Therefore, our data indicate that JIP3 contributes to epileptic seizures, although the specific mechanism is unclear. We next showed that JIP3 mediates JNK activation and neuron apoptosis in KA-induced seizures. As expected, increased JNK activation is inversed in the LV-JIP3-RNAi group after KA treatment, which is consistent with previous studies that showed knockdown of JIP3 inhibits the activation of JNK in neonate brains (Ha et al., 2005) as well as in cells treated with LPS or following IR (Matsuguchi et al., 2003; Xu et al., 2010). A previous study showed that c-Jun (a nuclear substrate of JNK) mutant could not be phosphorylated on serine 63
and 73, and this lack of phosphorylation inhibited neuronal cell apoptosis after administration (Behrens et al., 1999). Moreover, recent reports have demonstrated that JNK inhibitors, such as SP600125 and D-JNKI-1, can efficiently block JNK activation and protect against neuronal death induced by seizures (Chen et al., 2010; Spigolon et al., 2010). In this study, the reduced expression of JIP3 significantly decreased JNK activation 8 h after KA administration, and mice underexpressing JIP3 exhibited less structural damage and neuronal apoptosis in the CA3 region of the hippocampus 3 days after KA treatment. These data indicate that the underexpression of JIP3 reduces the translocation of activated JNK into the nucleus, which ultimately results in decreased apoptosis. The effect of the underexpression of JIP3 on a PTZ kindling seizure model, was also investigated in our study. Previous studies revealed that knockdown JNK3 or c-Jun mutant mice exhibited no difference in seizure time course and severity compared with wild mice in a
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483
NSC 16258
No. of Pages 11
25 May 2015
9
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 5. Effect of underexpressing JIP3 on KA-induced hippocampus cell apoptosis. (A, B) Representative photomicrographs showing Cresyl Violet staining and TUNEL staining in the CA3 region of the hippocampus in 3 days after KA treatment. (C) Decreased TUNEL-positive cells in the LVJIP3-RNAi group (***p < 0.001 compared with control; #p < 0.05, compared with LV-GFP group; no difference between LV-JIP3-RNAi group and control group, ANOVA followed by Dunnett’s test, n = 4). The scale bar is 100 lm and the insets are 10-fold. 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508
PTZ-induced acute seizure model (Yang et al., 1997; Behrens et al., 1999). However, our study found that the underexpression of JIP3 significantly slowed down the PTZ kindling seizure process. This discrepancy may be due to the different methods of PTZ administration. Unlike a single bolus injection in PTZ-induced acute seizures, we used repeated administration of a subthreshold dose and the entire kindling process lasts a relative long time. Another possible mechanism is that JIP3 may be implicated in other mechanisms except for the JNK cascades. For example, JIP3 can potentiate axon branching (Sun et al., 2013), and network rearrangement caused by axonal sprouting may be involved in epileptogenesis (Perez et al., 1996; Tang and Loke, 2010). This study also has some limitations. First, we are not able to equally compare JIP3 expression between TLE patients (from the neocortex) and KA-induced epileptic seizure mice (from hippocampus) as we cannot obtain hippocampus samples from individual controls due to practical and ethical reasons. Second, we investigated the effect of knockdown of JIP3 but did not study the effect of overexpression of JIP3 on seizures. Nonetheless, the expression of JIP3 is enriched in brain tissue itself and is significantly increased in both TLE patients and epileptic seizure mice model, the
significance of overexpression of JIP3 may be rather limited. Third, although our study found that JIP3 protected hippocampus neuron from excitotoxic stimulation might be through the inhibition of JNK activation, however, the exact mechanism of why loss of jip3 results in neuron protections or whether there are other mechanisms need further study in the coming years.
509
CONCLUSION
516
Our study demonstrates the increased expression of JIP3 in the temporal neocortex of TLE patients and in the experimental model of epileptic seizures. The underexpression of JIP3 substantially decreases seizure activity, inhibits JNK activation and diminishes seizureinduced hippocampus neuronal death in KA-induced acute seizure model. Furthermore, the underexpression of JIP3 significantly retards the PTZ kindling seizure process. The above findings provide evidence that JIP3 is involved in epileptic seizures and the regulation of neuronal response to excitotoxic stress.
517
UNCITED REFERENCES
528
Qureshi and Mehler (2010) and Li et al. (2013).
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
510 511 512 513 514 515
518 519 520 521 522 523 524 525 526 527
529
NSC 16258
No. of Pages 11
25 May 2015
10
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
537
Acknowledgments—This work was supported by National Nature Science Foundation of China (No. 81271445). We appreciate the patients and their families for their participation in this study. The authors sincerely thank Tiantan Hospital and Xuanwu Hospital of the Capital Medical University for providing the brain tissues, and the National Institutes of Health of China and the Ethics Committee on Human Research of Chongqing Medical University for their support.
538
REFERENCES
539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596
Akechi M, Ito M, Uemura K, Takamatsu N, Yamashita S, Uchiyama K, Yoshioka K, Shiba T (2001) Expression of JNK cascade scaffold protein JSAP1 in the mouse nervous system. Neurosci Res 39:391–400. Avignone E, Ulmann L, Levavasseur F, Rassendren F, Audinat E (2008) Status epilepticus induces a particular microglial activation state characterized by enhanced purinergic signaling. J Neurosci 28:9133–9144. Banerjee PN, Filippi D, Allen Hauser W (2009) The descriptive epidemiology of epilepsy-a review. Epilepsy Res 85:31–45. Behrens A, Sibilia M, Wagner EF (1999) Amino-terminal phosphorylation of c-Jun regulates stress-induced apoptosis and cellular proliferation. Nat Genet 21:326–329. Ben-Ari Y, Cossart R (2000) Kainate, a double agent that generates seizures: two decades of progress. Trends Neurosci 23:580–587. Bilimoria PM, de la Torre-Ubieta L, Ikeuchi Y, Becker EB, Reiner O, Bonni A (2010) A JIP3-regulated GSK3beta/DCX signaling pathway restricts axon branching. J Neurosci 30:16766–16776. Borsello T, Forloni G (2007) JNK signalling: a possible target to prevent neurodegeneration. Curr Pharm Des 13:1875–1886. Brecht S, Kirchhof R, Chromik A, Willesen M, Nicolaus T, Raivich G, Wessig J, Waetzig V, Goetz M, Claussen M, Pearse D, Kuan C-Y, Vaudano E, Behrens A, Wagner E, Flavell RA, Davis RJ, Herdegen T (2005) Specific pathophysiological functions of JNK isoforms in the brain. Eur J Neurosci 21:363–377. Chen X, Wu J, Hua D, Shu K, Wang JZ, Li L, Lei T (2010) The c-Jun N-terminal kinase inhibitor SP600125 is neuroprotective in amygdala kindled rats. Brain Res 1357:104–114. Davis RJ (2000) Signal transduction by the JNK group of MAP kinases. Cell 103:239–252. French JA (2007) Refractory epilepsy: clinical overview. Epilepsia 48(Suppl. 1):3–7. Friedman LK, Pellegrini-Giampietro DE, Sperber EF, Bennett MV, Moshe SL, Zukin RS (1994) Kainate-induced status epilepticus alters glutamate and GABAA receptor gene expression in adult rat hippocampus: an in situ hybridization study. J Neurosci 14:2697–2707. Ha HY, Cho IH, Lee KW, Song JY, Kim KS, Yu YM, Lee JK, Song JS, Yang SD, Shin HS, Han PL (2005) The axon guidance defect of the telencephalic commissures of the JSAP1-deficient brain was partially rescued by the transgenic expression of JIP1. Dev Biol 277:184–199. Henshall DC, Simon RP (2005) Epilepsy and apoptosis pathways. J Cereb Blood Flow Metab 25:1557–1572. Kelkar N, Gupta S, Dickens M, Davis RJ (2000) Interaction of a mitogen-activated protein kinase signaling module with the neuronal protein JIP3. Mol Cell Biol 20:1030–1043. Koushika SP (2008) ‘‘JIP’’ing along the axon: the complex roles of JIPs in axonal transport. Bioessays 30:10–14. Li Y, Xiao D, Yang S, Zhang L (2013) Promoter methylation represses AT2R gene and increases brain hypoxic-ischemic injury in neonatal rats. Neurobiol Dis 60:32–38. Matsuguchi T, Masuda A, Sugimoto K, Nagai Y, Yoshikai Y (2003) JNK-interacting protein 3 associates with Toll-like receptor 4 and is involved in LPS-mediated JNK activation. EMBO J 22:4455–4464. Matsuura H, Nishitoh H, Takeda K, Matsuzawa A, Amagasa T, Ito M, Yoshioka K, Ichijo H (2002) Phosphorylation-dependent
530 531 532 533 534 535 536
scaffolding role of JSAP1/JIP3 in the ASK1-JNK signaling pathway. A new mode of regulation of the MAP kinase cascade. J Biol Chem 277:40703–40709. McNamara JO (1999) Emerging insights into the genesis of epilepsy. Nature 399:A15–A22. Mishra A, Goel RK (2012) Age dependent learning and memory deficit in Pentylenetetrazol kindled mice. Eur J Pharmacol 674:315–320. Monory K, Massa F, Egertova M, Eder M, Blaudzun H, Westenbroek R, Kelsch W, Jacob W, Marsch R, Ekker M, Long J, Rubenstein JL, Goebbels S, Nave KA, During M, Klugmann M, Wolfel B, Dodt HU, Zieglgansberger W, Wotjak CT, Mackie K, Elphick MR, Marsicano G, Lutz B (2006) The endocannabinoid system controls key epileptogenic circuits in the hippocampus. Neuron 51:455–466. Muresan Z, Muresan V (2005) C-Jun NH2-terminal kinase-interacting protein-3 facilitates phosphorylation and controls localization of amyloid-beta precursor protein. J Neurosci 25:3741–3751. Ongusaha PP, Qi HH, Raj L, Kim YB, Aaronson SA, Davis RJ, Shi Y, Liao JK, Lee SW (2008) Identification of ROCK1 as an upstream activator of the JIP-3 to JNK signaling axis in response to UVB damage. Sci Signal 1:ra14. Park HJ, Kim HJ, Ra J, Zheng LT, Yim SV, Chung JH (2008) Protective effect of topiramate on kainic acid-induced cell death in mice hippocampus. Epilepsia 49:163–167. Perez Y, Morin F, Beaulieu C, Lacaille JC (1996) Axonal sprouting of CA1 pyramidal cells in hyperexcitable hippocampal slices of kainate-treated rats. Eur J Neurosci 8:736–748. Qureshi IA, Mehler MF (2010) Epigenetic mechanisms underlying human epileptic disorders and the process of epileptogenesis. Neurobiol Dis 39:53–60. Schmidt D, Loscher W (2005) Drug resistance in epilepsy: putative neurobiologic and clinical mechanisms. Epilepsia 46:858–877. Song JJ, Lee YJ (2007) Differential activation of the JNK signal pathway by UV irradiation and glucose deprivation. Cell Signal 19:563–572. Spigolon G, Veronesi C, Bonny C, Vercelli A (2010) C-Jun N-terminal kinase signaling pathway in excitotoxic cell death following kainic acid-induced status epilepticus. Eur J Neurosci 31:1261–1272. Sun T, Yu N, Zhai LK, Li N, Zhang C, Zhou L, Huang Z, Jiang XY, Shen Y, Chen ZY (2013) C-Jun NH2-terminal kinase (JNK)interacting protein-3 (JIP3) regulates neuronal axon elongation in a kinesin- and JNK-dependent manner. J Biol Chem 288:14531–14543. Szaroma W, Dziubek K, Gren A, Kreczmer B, Kapusta E (2012) Influence of the kainic acid on antioxidant status in the brain, liver and kidneys of the mouse. Acta Physiol Hung 99:447–459. Takino T, Nakada M, Miyamori H, Watanabe Y, Sato T, Gantulga D, Yoshioka K, Yamada KM, Sato H (2005) JSAP1/JIP3 cooperates with focal adhesion kinase to regulate c-Jun N-terminal kinase and cell migration. J Biol Chem 280:37772–37781. Takino T, Yoshioka K, Miyamori H, Yamada KM, Sato H (2002) A scaffold protein in the c-Jun N-terminal kinase signaling pathway is associated with focal adhesion kinase and tyrosinephosphorylated. Oncogene 21:6488–6497. Tang FR, Loke WK (2010) Cyto-, axo- and dendro-architectonic changes of neurons in the limbic system in the mouse pilocarpine model of temporal lobe epilepsy. Epilepsy Res 89:43–51. Verhey KJ, Meyer D, Deehan R, Blenis J, Schnapp BJ, Rapoport TA, Margolis B (2001) Cargo of kinesin identified as JIP scaffolding proteins and associated signaling molecules. J Cell Biol 152:959–970. Waetzig V, Herdegen T (2005) Context-specific inhibition of JNKs: overcoming the dilemma of protection and damage. Trends Pharmacol Sci 26:455–461. Xu B, Zhou O K Y, Choy PC, Pierce GN, Siow YL (2010) Regulation of stress-associated scaffold proteins JIP1 and JIP3 on the c-Jun NH2-terminal kinase in ischemia-reperfusion. Can J Physiol Pharmacol 88:1084–1092. Yang DD, Kuan CY, Whitmarsh AJ, Rincon M, Zheng TS, Davis RJ, Rakic P, Flavell RA (1997) Absence of excitotoxicity-induced
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667
NSC 16258
No. of Pages 11
25 May 2015
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx 668 669 670 671 672 673 680 681 682
apoptosis in the hippocampus of mice lacking the Jnk3 gene. Nature 389:865–870. Zelano J, Halawa I, Clausen F, Kumlien E (2013) Hyponatremia augments kainic-acid induced status epilepticus in the mouse: a model for dysmetabolic status epilepticus. Epilepsy Res 106:29–34.
11
Zhang X, Chen G, Lu Y, Liu J, Fang M, Luo J, Cao Q, Wang X (2013) Association of mitochondrial Letm1 with epileptic seizures. Cereb Cortex. Zhao Y, Spigolon G, Bonny C, Culman J, Vercelli A, Herdegen T (2012) The JNK inhibitor D-JNKI-1 blocks apoptotic JNK signaling in brain mitochondria. Mol Cell Neurosci 49:300–310.
(Accepted 5 May 2015) (Available online xxxx)
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
674 675 676 677 678 679
No. of Pages 11
25 May 2015 Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008 1
Neuroscience xxx (2015) xxx–xxx
4
EFFECTS OF JIP3 ON EPILEPTIC SEIZURES: EVIDENCE FROM TEMPORAL LOBE EPILEPSY PATIENTS, KAINIC-INDUCED ACUTE SEIZURES AND PENTYLENETETRAZOLE-INDUCED KINDLED SEIZURES
5 6 7
Z. WANG, a,b Y. CHEN, a Y. LU¨, a X. CHEN, a L. CHENG, a X. MI, a X. XU, a W. DENG, a Y. ZHANG, a N. WANG, a J. LI, a Y. LI a AND X. WANG a*
2 3
a
8 9 10
Department of Neurology, The First Affiliated Hospital of Chongqing Medical University, Chongqing Key Laboratory of Neurology, Chongqing 400016, China
11 12
b
13
Department of Neurology, Fuling Central Hospital, Chongqing 408000, China
Abstract—JNK-interacting protein 3 (JIP3), also known as JNK stress-activated protein kinase-associated protein 1 (JSAP1), is a scaffold protein mainly involved in the regulation of the pro-apoptotic signaling cascade mediated by c-Jun N-terminal kinase (JNK). Overexpression of JIP3 in neurons in vitro has been reported to lead to accelerated activation of JNK and enhanced apoptosis response to cellular stress. However, the occurrence and the functional significance of stress-induced modulations of JIP3 levels in vivo remain elusive. In this study, we investigated the expression of JIP3 in temporal lobe epilepsy (TLE) and in a kainic acid (KA)-induced mouse model of epileptic seizures, and determined whether down-regulation of JIP3 can decrease susceptibility to seizures and neuron damage induced by KA. We found that JIP3 was markedly increased in TLE patients and a mouse model of epileptic seizures; mice underexpressing JIP3 through lentivirus bearing LVLetm1-RNAi showed decreased susceptibility, delayed first seizure and decreased seizure duration response to the epileptogenic properties of KA. Subsequently, a decreased activation of JNK following seizure induction was observed in mice underexpressing JIP3, which also exhibited less neuronal apoptosis in the CA3 region of the hippocampus, as assessed three days after KA administration. We also found that mice underexpressing JIP3 exhibited a delayed pentylenetetrazole (PTZ)-induced kindling seizure process. Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Key words: JIP3, JNK, temporal lobe epilepsy, lentivirus, apoptosis. 14
*Corresponding author. Tel/fax: +86-23-6870-8697. E-mail address: [email protected] (X. Wang). Abbreviations: AEDs, antiepileptic drugs; ANOVA, analysis of variance; GFAP, anti-glial fibrillary acidic protein; IR, ischemia– reperfusion; JIP3, JNK-interacting protein 3; JNK, c-Jun N-terminal kinase; KA, kainic acid; MAP2, anti-microtubule-associated protein-2; OD, optical density; PTZ, pentylenetetrazole; TLE, temporal lobe epilepsy. http://dx.doi.org/10.1016/j.neuroscience.2015.05.008 0306-4522/Ó 2015 IBRO. Published by Elsevier Ltd. All rights reserved. 1
INTRODUCTION
15
Epilepsy, characterized by recurrent spontaneous seizures, is one of the most common chronic neurologic disorders, affecting 50 million individuals worldwide (McNamara, 1999; Banerjee et al., 2009). Despite treatment with a variety of antiepileptic drugs (AEDs), approximately 30% of the newly diagnosed epilepsy cases are drug resistant (Schmidt and Loscher, 2005; French, 2007). Temporal lobe epilepsy (TLE) is the most common type of epilepsy in adults, and up to 75% of patients with TLE eventually develop refractory epilepsy (Henshall and Simon, 2005; Schmidt and Loscher, 2005). Uncontrolled seizures ultimately lead to hippocampal sclerosis, the characteristic structural changes in TLE. However, the mechanism of TLE is not completely understood. It is well known that the c-Jun N-terminal kinases (JNKs) play a central role in cell apoptosis under environmental stress (Davis, 2000; Waetzig and Herdegen, 2005) and that JNK is clearly involved in excitotoxic neuronal apoptosis in the hippocampus following seizures (Spigolon et al., 2010; Zhao et al., 2012). JNK-interacting protein 3 (JIP3), which is selectively enriched in brain tissue (Akechi et al., 2001),and was first identified as a scaffold protein, interacts with components of the JNK signaling cascade and facilitates JNK activation (Kelkar et al., 2000; Matsuura et al., 2002; Song and Lee, 2007). Muresan and Muresan (2005) reported that exogenous expression of JIP3 increased the level of JNK activation after anisomycin treatment. A recent study reported that overexpression of JIP3 increased ischemia– reperfusion (IR)-induced JNK activity and apoptosis, whereas the underexpression of JIP3 inhibited IRinduced JNK activation and apoptosis (Xu et al., 2010). However, whether JIP3 is involved in neuronal apoptosis induced by seizures is unclear. Recently, the interactions between JIP3 and JNK have been shown to be modulated by other proteins, such as focal adhesion kinase, toll-like receptors and ROCK1 (Takino et al., 2002, 2005; Ongusaha et al., 2008). In addition, JIP3 has been shown to be an adaptor that links cellular cargo to Kinesin-I, a major molecular motor for axonal transport (Verhey et al., 2001; Koushika, 2008). Finally, recent studies have demonstrated that JIP3 modulates axon elongation in a seemingly paradoxical manner. Bilimoria et al. (2010) showed that JIP3 restricted axon branching in the cerebellar cortex through the GSK3/DCX signaling pathway rather than through a JNK-dependent pathway. In
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
NSC 16258
No. of Pages 11
25 May 2015
2 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
contrast, another report showed that JIP3 enhanced axon elongation in primary hippocampal neurons and cortical neurons in vivo in a JNK-dependent pathway (Sun et al., 2013). Because of the pleiotropic roles of JIP3 in vitro, its physiological functions in vivo are difficult to determine. In this study, we investigated the effect of JIP3 on TLE and on a kainic acid (KA)-induced seizure model. First, we examined JIP3 protein expression in TLE patients and in mice with KA-induced seizures. Then, by knocking down JIP3 in the hippocampus in adult mice, we investigated the effect of underexpression of JIP3 on behavioral activity as well as hippocampus damage in 3 days following KA treatment. We also assessed the effect of the underexpression of JIP3 on a kindling model.
EXPERIMENTAL PROCEDURES
77 78
Human brain tissue samples
79
A total of 30 brain tissue samples from patients (17 males and 13 females; mean age 20.17 ± 8.76; range 4–40 years) undergoing surgery for medically intractable TLE were randomly chosen from our brain tissue bank. All procedures and experiments complied with The Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments involving humans and were approved by the National Institutes of Health and the Committee on Human Research at Chongqing Medical University. All TLE patients were refractory to three or more AEDs at the maximal doses. Presurgical assessment consisted of a detailed medication history, neurological examination, interictal and ictal electroencephalogram, neuropsychological testing and neuroradiological studies. Informed written consent for the use of the tissue in research was obtained before the surgery. TLE patients who underwent surgical removal of the epileptogenic zone were for strictly therapeutic purpose. The typical surgical method was anterior temporal neocortex resection. Table 1 summarizes the clinical features of TLE patients. For comparison, we obtained 10 histological normal temporal neocortex samples from individuals (six males and four females; mean age 20.00 ± 6.37 years; range 15–36 years) who were treated for increased intracranial pressure due to head trauma without apparent signs of central nervous system disease or exposure to AEDs. The samples from these patients were obtained only for treatment purpose. There were no significant differences in the age and sex between TLE and control patients (p > 0.05). Table 2 shows the clinical features of the controls.
80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
111
Mice
112
For this study, 6–8-week-old male C57BL/6 mice weighing 18–22 g were obtained from the Experimental Animal Centre of Chongqing Medical University. All animals were housed in a humidity- and temperaturecontrolled room with a 12-h light/dark cycle. Water and food were available ad libitum. The experiment procedures were conducted in compliance with the
113 114 115 116 117 118
Ethics of Experiments on Animals Commission of Chongqing Medical University and were in complete compliance with international standards.
119
Kainic acid-induced seizures
122
Kainic acid (KA, Sigma, USA) was dissolved in 0.9% saline in a volume of 10 ml/kg. Due to the inconsistent and relatively large difference in KA doses administered via intraperitoneal injections in mice described in previous reports (Brecht et al., 2005; Avignone et al., 2008; Szaroma et al., 2012; Zelano et al., 2013), we performed a preliminary dose–response trial. KA was administered at doses of 15, 20 and 25 mg/kg body weight. The dose of 20 mg/kg was established as being sufficient to trigger seizures with lower mortality and was chosen as the optimal dose. Behavioral assessment of seizure severity was scored according to a modified Racine scale as reported previously (Monory et al., 2006): 0-no response; 1-immobility; 2-myoclonic jerks; 3-forelimb clonus and/or Straub tail; 4-forelimb clonus with rearing; 5-continuous rearing and fall; 6-severe clonic-tonic seizures; and 7-death. Mice were scored every 5 min for 60 min after KA injection. The highest score during each 5-min period was recorded by an observer who was blinded to the treatment. To minimize suffering and prevent mortality, we intraperitoneally injected diazepam (5 mg/kg) to blocked epileptic seizures 60 min after KA administration.
123
Pentylenetetrazole (PTZ) kindling
146
A subconvulsive dose of PTZ (Sigma–Aldrich, USA, 35 mg/kg, i.p.) was administered on alternating days. After each PTZ injection, the mice were kept in a Plexiglas chamber and were observed for 30 min. The seizure intensity was scored as follows (Mishra and Goel, 2012): 0-no response; 1-hyperactivity, restlessness and vibrissae twitching; 2-head nodding, head clonus and myoclonic jerks; 3-unilateral or bilateral limb clonus; 4forelimb clonic seizures; 5-generalized tonic-clonic seizures with falling; 6-hind limb extensor; and 7-death.
147
Lentivirus product and stereotaxic injection
157
JIP3 siRNA was designed and synthesized with the following sequences: rat and mice JIP3, CACCGTGATGCTGTCAAATT (Bilimoria et al., 2010). The lentiviral vector backbone was Mu6-MCS-Ubi-EGFP. The same backbone expressing GFP alone was used as a negative control. Lentiviral vector construction (LV-JIP3-RNAi and LV-GFP) and lentivirus product were completed by Shanghai GeneChem Co. Ltd., China. The titer of the lentivirus was 1.2E + 9TU/ml. Stereotaxic intra-hippocampus injection has been described in our previous study (Zhang et al., 2013). Briefly, mice were deeply anesthetized with an intraperitoneal injection of 3.5% chloral hydrate (1 ml/100 g), then fixed in a stereotaxic instrument (Stoelting Co. Ltd., USA). A volume of 2-ll LV-JIP3-RNAi (n = 21) and LV-GFP (n = 21) were infused through a glass pipette (0.2 ll/min) bilaterally into the hippocampus ( 2.0 mm AP, ±2.0 mm
158
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
120 121
124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145
148 149 150 151 152 153 154 155 156
159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174
NSC 16258
No. of Pages 11
25 May 2015
3
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx Table 1. Clinical characteristics of TLE patients Subjects
Gender (M/F)
Age (year)
Course (year)
AEDs before the surgery
Resection tissue
Pathological diagnosis
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
F M F M M F F F M M M F M M M F M F F M M F F M M M F F M M
25 21 13 9 24 22 33 24 6 29 19 6 19 23 24 23 21 24 19 4 31 21 40 5 8 18 19 31 19 25
10 14 12 7 21 21 9 20 5 28 17 5 15 2 2 10 3 17 13 3 20 10 20 4 7 13 15 27 18 13
CBZ, TPM, OXT VPA, CBZ, LTG CBZ, TPM, CZP VPA, TPM, LTG, LEV PHT, VPA, CBZ, TPM VPA, PHT, TPM, LEV VPA, OXT, LTG CBZ, OXT, LEV, PB OXT, LTG, LEV VPA, CBZ, PHT, LTG, PB VPA, CBZ, LTG, OXT VPA, LTG, LEV CBZ, TPM, LTG VPA, LTG, LEV OXT, LEV, PB CBZ, OXT, LTG VPA, LTG, LEV VPA, CBZ, OXT,LEV VPA, OXT, LTG OXT, LTG, LEV CBZ, PHT, TPM, LTG CBZ, LTG, CZP CBZ, PHT, LTG, TPM, LTG, LEV, PB VPA, TPM, OXT VPA, CBZ, LEV CBZ, VPA, LTG, OXT VPA, CBZ, LEV, CZP VPA, TPM, LTG, LEV VPA, CBZ, LTG, PB
TNl TNr TNr TNr TNr TNl TNl TNr TNl TNr TNr TNl TNl TNl TNr TNr TNr TNl TNl TNl TNl TNl TNl TNl TNr TNl TNr TNr TNl TNl
NL, NL, NL NL, NL NL, NL G NL NL NL NL NL NL G NL, NL, NL, G G G NL, NL, G NL, NL, NL, NL, NL NL
G G G G
G G G
G G G G G G
P, patients; C, control; M, male; F, female; AEDs, antiepileptic drugs; CBZ, carbamazepine; TPM, topiramate; OXC, oxcarba-zepine; VPA, valproate; LTG, lamotrigine; CZP, clonazepam; LEV, Levetiracetam; PHT, phenytoin; PB, phenobarbital; TN, temporal neocortex; l, left; r, right; NL, neuron loss; G, Gliosis.
Table 2. Clinical characteristics of TLE patients Subjects
Gender (F/M)
Age (year)
Etiology diagnosis
Resection tissue
Tissue pathology
1 2 3 4 5 6 7 8 9 10
F F F F M M M M M M
30 17 23 26 36 21 15 19 25 28
Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma Trauma
TNr TNr TNr TNl TNl TNr TNl TNl TNl TNr
N N N N N N N N N N
F, female; M, male; l, left; r, right; TN, temporal neocortex; N, normal.
179
ML, 2.0 mm DV from bregma). The pipette was kept in place for 5 min and retracted stepwise to minimize backflux. All mice were allowed 2 weeks to recover from surgery and for the lentivirus to reach maximal expression; then, the behavioral study was performed.
180
Tissue preparation
175 176 177 178
181 182 183 184
Human. One part of the resected brain tissue samples was immediately stored in liquid nitrogen for western blot analysis. Another part of the tissues samples was fixed in 4% paraformaldehyde for 48 h. Then, the tissues
were either processed for paraffin embedding (sectioned into 5 lm for immunohistochemistry analysis) or frozen for cryostat sectioning (10-lm-thick sections for immunofluorescence analysis).
185
Mice. Samples were obtained 2, 4, 8 and 24 h (n = 4 in each) after seizure induction. At various time points, the mice were sacrificed by decapitation after an i.p. injection of a lethal dose of chloral hydrate. The removed brains were dissected to collect hippocampus and then placed in liquid nitrogen for western bolt analysis. The mice used for the morphological and immunofluorescence
189
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
186 187 188
190 191 192 193 194 195
NSC 16258
No. of Pages 11
25 May 2015
4
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
209
studies were deeply anesthetized and intracardially perfused with 0.9% saline, followed by 0.4% paraformaldehyde. The brains were removed and postfixed in the same fixative overnight. The subsequent procedures after fixation were the same for the human samples. To determine the distribution of GFP and the expression of JIP3 in the lentivirus-injected mice, LVJIP3-RNAi mice (n = 3) and LV-GFP mice (n = 3) were sacrificed by decapitation after an i.p. administration of a lethal dose of chloral hydrate. Then, the brain tissues were sectioned immediately at 20 lm at 20 °C and mounted on polylysine-coated slides for laser confocal analysis. The tissues used for western blot were prepared as described above.
210
Western blot
211
241
Tissues samples were homogenized in Lysis Buffer that included phosphatase inhibitors, protease inhibitors and phenyl-methylsulfonyl fluoride (PMSF) (KeyGen Biotech, Nanjing, China). Then, the homogenates were centrifuged at 12000g for 15 min at 4 °C. The supernatants were collected, and the protein concentration was determined using a bicinchoninic acid protein (BCA) assay kit (Beyotime Institute of Biotechnology, China). Samples were stored at 80 °C until analysis. Protein (50 lg per lane) was separated by 8% SDS–PAGE and electrotransferred onto polyvinylidene difluoride membranes (Millipore, MA, USA). After blocking with 5% BSA for 1 h at 37 °C, the membranes were incubated at 4 °C overnight with relevant primary antibodies: rabbit anti-JIP3 (1:200, Santa Cruz biotechnology, USA), rabbit anti-GAPDH (1:2000, Proteintech, Wuhan, China), rabbit antiphosphorylated JNK and rabbit anti-JNK (1:1000, Cell Signaling Technology, USA). Both GAPDH and t-JNK are as loading controls. Then, the membranes were washed and incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (1:5000, Zhongshan Golden Bridge Inc., China) for 1 h at 37 °C. The membranes were visualized using an ECL substrate (Beyotime Institute of Biotechnology, China). The mean optical density (OD) values of bands were measured with Quantity One 1-D Analysis software (Bio-Rad Laboratories, Hercules, USA) and were normalized to loading controls separately. Experiments were carried out in the same condition and repeated three times. The final OD values were averaged from three independent experiments.
242
Double immunofluorescence labeling
243
Frozen sections were air dried at room temperature at least for half an hour. After antigen retrieval, the sections was permeabilized with 0.5% Triton X-100 and incubated in 5% goat serum for 1 h at room temperature. Sections were then incubated with a mixture of rabbit anti-JIP3 antibody (1:50, Santa Cruz Biotechnology) and mouse anti-microtubule-associated protein-2 (MAP2) antibody (Boster Biological Technology, Wuhan, China), or with a mixture of rabbit anti-JIP3 antibody and mouse anti-glial fibrillary acidic protein (GFAP) antibody (Boster Biological Technology)
196 197 198 199 200 201 202 203 204 205 206 207 208
212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240
244 245 246 247 248 249 250 251 252 253
at 4 °C overnight. Sections were washed and incubated with fluorescein isothiocyanate (FITC) goat anti-rabbit IgG (1:200, Zhongshan Golden Bridge Inc. BeiJing, China) and tetraethyl rhodamine isothiocyanate (TRITC)-conjugated goat anti-mouse IgG (1:200, Zhongshan Golden Bridge Inc.) in the dark for 60 min at 37 °C, Then, the sections were washed with PBS and mounted in 1:1 glycerol/PBS. Fluorescent images were acquired by laser scanning confocal microscopy (Leica Microsystems Heidelberg GmbH, Germany ) on an Olympus IX 70 inverted microscope (Olympus, Japan).
254
Immunohistochemistry
265
Ten slides were cut from each sample (30 and 10 samples from TLE patients and controls, respectively), and three slides were randomly selected from each sample for immunohistochemical analysis. All the experiments were carried out in the same condition and repeated three times. Sections were deparaffinized, rehydrated, and antigen recovery was performed as for immunofluorescence. Then, the sections were incubated with primary rabbit anti-JIP3 (1:50, Santa Cruz Biotechnology) at 4 °C overnight, followed by incubation with secondary goat anti-rabbit antibody (Zhongshan Golden Bridge Inc.) for 30 min at 37 °C. Sections were treated with ABC working solution (Zhongshan Golden Bridge Inc.) for 30 min and incubated with 3,3diaminobenzidine (DAB; Zhongshan Golden Bridge Inc.) for 5 min. Counterstaining was carried out with Harris’s hematoxylin. Cell with buffy stain in cytoplasm was considered to be positive. Ten visualfields for each sample were randomly chosen under a LEICA DM600B automatic microscope (Leica Microsystems Heidelberg GmbH, Germany). Image-Pro plus 6.0 software (Media Cybemetrics, USA) was used for the quantitative analysis of JIP3 expression. Mean OD of each visionfield was automatically measured by computer. The final OD values were averaged from three independent experiments.
266
Cresyl Violet and TUNEL staining
292
Cresyl Violet staining was used to detect morphological changes and neuron destruction in the hippocampus, particularly in the CA3 region. The sections (5 lm) from three days after the KA treatment were soaked in a solution containing 0.1% Cresyl Violet (Sigma–Aldrich, MO, USA). TUNEL analysis was performed to measure the degree of apoptosis in the tissue using an in situ Cell Death Detection Kit (Roche Molecular Biochemicals, Mannheim, Germany) according to the manufacturer’s protocol. TUNEL-positive cells in the CA3 region of each section were counted by observers who were blinded to the treatment conditions.
293
Statistical analysis
306
All data are presented as mean ± SE. Statistical analysis of the results were performed using the unpaired t-test for comparisons of the two groups, and a one-way analysis of variance (ANOVA) ANOVA followed by Dunnett’s test for
307
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
255 256 257 258 259 260 261 262 263 264
267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291
294 295 296 297 298 299 300 301 302 303 304 305
308 309 310
NSC 16258
No. of Pages 11
25 May 2015
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx 311 312 313 314
315
multigroup comparisons. A repeated measures ANOVA was used for estimating the group differences in seizure severity and kindling acquisition. A value of p < 0.05 was considered statistically significant.
RESULTS
5
study showed that JIP3 expression was significantly higher in 25 of 30 samples in the temporal neocortex of TLE patients than that in controls (1.213 ± 0.1041 in patients with TLE and 0.6035 ± 0.07080 in control, P < 0.01, Fig. 2A, B). Immunohistochemical study showed that neuronal JIP3 immunoreactivity was stronger in patients with TLE (Fig. 2D) than in controls (Fig. 2C), which were significantly different (0.1303 ± 0.01487 in TLE and 0.05089 ± 0.006938 in control, P < 0.01; Fig. 2E). JIP3 expression was significantly increased in 24 of the 30 samples compared with controls.
325
337
340
316
Location of JIP3 in human and mice brain
317
321
JIP3 was expressed exclusively in neurons and mainly localized in the cytoplasm in TLE patients and mice post-seizure. JIP3 was colocalized with the dendritic marker MAP2 (Fig. 1A–C, G–I), but not with the astrocytic marker GFAP (Fig. 1D–F, J–I).
322
Overexpressed JIP3 in patients with TLE
Increased expression of JIP3 and the phosphorylation of JNK (p-JNK) in the hippocampus of KA-induced seizure mice model
323
Then, we investigated the expression of JIP3 in 30 TLE patients and 10 non-epileptic controls. Western blotting
Given the limitations of human studies, we used animal models of acute seizure trigged by KA administration.
318 319 320
324
Fig. 1. Immunofluorescent labeling of JIP3 in the cortex. JIP3 (green) and MAP2 (red) are colocalized in the temporal neocortex of a TLE patient (A–C) and in an epileptic mouse 3 days post seizures (G–I). JIP3 (green) and GFAP (red) are not colocalized in the temporal neocortex of a TLE patient (D–F) and in an epileptic mouse 3 days post seizures (J–L). The scale bar is 75 lm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
326 327 328 329 330 331 332 333 334 335 336
338 339
341
NSC 16258
No. of Pages 11
25 May 2015
6
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 2. Western blotting and immunohistochemistry analysis of the expression of JIP3 in the temporal neocortex of TLE patients. (A) Representative images of JIP3 expression in the temporal neocortex from the control and TLE group. (B) Comparison of the intensity ratio indicates significantly higher expression of JIP3 in patients with TLE than in controls. (**p < 0.01, unpaired t test, n = 30 in TLE group and n = 10 in control group). (C) Weak immunoreactive staining of JIP3 in the temporal neocortex of a control. (D) Relatively strong immunoreactive staining of JIP3 in a patient with TLE. (E) Comparison of the mean OD value indicates a significantly higher expression of JIP3 in the TLE group than in the control group (**p < 0.01, unpaired t test, n = 30 in TLE group and n = 10 in control group). The scale bar is 50 lm.
342 343 344 345 346 347 348 349 350 351 352 353 354 355 356
357 358 359 360 361 362 363 364 365
Prolonged seizure was triggered by intraperitoneally injected KA (20 mg/kg) in mice. KA administration induced a rapid and prominent increase in JIP3 in the hippocampus, increasing as early as 2 h following SE and reaching a peak at 8 h and maintaining a relatively high level thereafter (*P < 0.05 compared with control; Fig. 3A, B). Because JIP3 controls the efficiency of the JNK signaling pathway, we simultaneously measured pJNK expression which was used as an indication of the JNK activation state. We found that the dynamics of pJNK (46 kDa) is parallel to JIP3 expression after the induction of seizures (*P < 0.05 compared with control; Fig. 3A, B). p-JNK (54 kDa) and t-JNK levels were also investigated. However, p-JNK (54 kDa), t-JNK (46 kDa or 54 kDa) level remained unchanged.
Analysis of JIP3 expression after injection of recombinant lentivirus LV-JIP3-RNAi and LV- GFP were injected into the hippocampus as described above. We detected the transfection efficiency 14 days after lentivirus injection. LV bearing GFP was observed in the entire hippocampus and almost none was found in other tissues (Fig. 3C). Furthermore, the expression of JIP3 was significantly decreased in the LV-JIP3-RNAi group
compared with the LV-GFP group 14 days after the LV injection (*p < 0.05; Fig. 3D, E).
366
Underexpression of JIP3 attenuated acute seizures in mice after KA administration and inhibited the PTZinduced kindling seizure process
368
We first investigated the therapeutic potential of the underexpression of JIP3 in the hippocampus in KAinduced seizures. Mice were pretreated with LV-JIP3RNAi and LV-GFP 14 days before KA injection. LVJIP3-RNAi mice showed significantly attenuated seizure severity (P = 0.01; Fig. 4A), increased onset latency (P < 0.01; Fig. 4B) and decreased duration of seizures (P < 0.05; Fig. 4B) compared with LV-GFP mice treated with KA. Then, we detected whether down-regulation of JIP3 had a similar effect on another PTZ-induced kindling seizure model. The repeated administration of PTZ at 35 mg/kg produced chemical kindling by a progressive increase in the seizure score. No difference was noted in convulsive behavior with the first injection (Fig. 4C). Subsequently, when LV-GFP mice started to develop seizures, many LV-JIP3-RNAi animals remained insensitive to PTZ. LV-JIP3-RNAi mice eventually developed seizures with progressively increased score,
371
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
367
369 370
372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389
NSC 16258
No. of Pages 11
25 May 2015
7
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 3. Expression of JIP3, p-JNK and t-JNK in the hippocampus after systemic administration of KA and the expressions of green fluorescent protein (GFP) and JIP3 after injection of recombinant LV. (A) Representative Western Blots for the expression of JIP3, p-JNK, t-JNK at various time points after KA administration. (B) Comparison of the mean intensity ratio of JIP3 and p-JNK, t-JNK between control and epileptic mice at each time point after seizure induction, the expression of JIP3 and p-JNK (46 kDa) were significantly increased after KA induction (*p < 0.05 versus control. ANOVA followed by Dunnett’s test n = 4). (C) Immunofluorescent image showing GFP expression in the entire hippocampus. The scale bar is 500 lm. (D) Western blotting images showing JIP3 expressions after injection of LV-GFP and LV-JIP3-RNAi on day 14. (G) Comparison of the mean intensity ratio shows significantly decreased expression of JIP3 in the LV-JIP3-RNAi group compared with LV-GFP group (*p < 0.05, unpaired t test, n = 3).
390 391
392 393 394 395 396 397 398 399 400 401
402 403 404 405 406 407 408 409 410 411 412 413 414 415 416
but the seizures remained less severe than those in LVGFP mice (P < 0.05). Decreased p-JNK expression in the hippocampus in LV-JIP3-RNAi mice with KA-induced seizures We next investigated whether JIP3 contributes to the activation of JNK following KA-induced seizures. The expression of p-JNK was analyzed in the hippocampus of LV-JIP3-RNAi and LV-GFP mice 8 h after seizure induction. We found both JIP3 and p-JNK (46 kDa) expressions were significantly decreased in the hippocampus after seizures in the LV-JIP3-RNAi mice compared with the LV-GFP mice. (*p < 0.05, Fig. 4D, E). Underexpression of JIP3 produced neuronal protection in the hippocampus three days after KA treatment According to previous studies, the CA3 region of the hippocampus is the most vulnerable excitotoxic lesions caused by KA (Friedman et al., 1994; Park et al., 2008). Thus, we detected the CA3 region using Cresyl Violet and TUNEL staining. For the Cresyl Violet staining, photomicrographs of the negative control group (normal tissue) showed the integrity of the pyramidal cells with round and pale stained nuclei, while the pyramidal cells of the LV-GFP group treated with KA showed shrunken cells with pyknotic nuclei. However, we observed a large number of viable cells in the LV-JIP3-RNAi mice treated with KA demonstrating the protective effect of the
underexpression of JIP3 (Fig. 5A). TUNEL findings were consistent with Cresyl Violet staining results. There was a large increase in apoptotic cells in the LV-GFP mice after KA induction versus the control mice (***P < 0.001), whereas the LV-JIP3-RNAi mice showed no significant difference compared to the control group (p > 0.05) and significantly less apoptosis cells compared to LV-GFP mice treated with KA (#P < 0.05), as shown in Fig. 5B, C.
417
DISCUSSION
426
There is considerable evidence for the regulation of apoptosis signaling pathways in human TLE. Although it has been difficult to dissociate the consequences of epilepsy from its causes such as neuron death, preventing seizure-induced neuronal death is recognized as a potential therapeutic strategy for epileptogenesis (Henshall and Simon, 2005). It has been reported that JIP3 controls the efficiency and specificity of the JNK apoptotic signaling cascade (Borsello and Forloni, 2007). We hypothesized that JIP3 would be implicated in epileptic seizures and neuronal apoptosis. We perform our study in the TLE patients and the KA seizure model in adult mice. We chose this model because KA-induced seizure activity and brain damage are similar to human TLE (Ben-Ari and Cossart, 2000; Park et al., 2008). The present study reports the markedly increased JIP3 expression in TLE patients. We also found significantly increased JIP3 levels in the KA-induced seizure model, which suggests that an increased JIP3
427
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
418 419 420 421 422 423 424 425
428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445
NSC 16258
No. of Pages 11
25 May 2015
8
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 4. Effects of downexpressing JIP3 on KA-induced seizures and PTZ kindling process as well as expression of p-JNK after KA administration. (A) Graph showing Racine scores per 5 min period over 60 min after KA injection for LV-GFP group and LV-JIP3-RNAi group. Seizure response over time is more severe in the LV-JIP3-RNAi group (P = 0.01, repeated measures ANOVA: F(1,16) = 8.518; n = 9). (B) Bar graph showing the increased latency of first seizure (**p < 0.01) and deceased duration (*p < 0.05) in LV-JIP3-RNAi mice compared with LV-GFP mice after KA injection (unpaired t test, n = 9). (C) Development of PTZ kindling seizures evoked by repeated injection subthreshold dose (35 mg/kg). LV-JIP3RNAi mice shows significantly retarded kindling process compared with LV-GFP mice (p < 0.05; repeated measures ANOVA: F(1,16) = 5.490; n = 9). (D) Western blot analysis of the level of JIP3 and p-JNK in the hippocampus between the LV-GFP group and LV-JIP3-RNAi group in 8 h after KA administration. (E) Comparison of the intensity ratio showing significantly decreased JIP3 and p-JNK (46 kDa) expression in LV-JIP3-RNAi group compared with LV-GFP group (*p < 0.05, unpaired t test, n = 4). However, the p-JNK (54 kDa), t-JNK (46 kDa or 54 kDa) level were still unchanged.
446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464
level is a common feature of seizure activity. Our study also supports an important functional role of JIP3 in seizures because the underexpression of JIP3 results in an anticonvulsive effect after KA administration. In addition, we detected a marked suppression of kindled seizure progression in response to repeated PTZ treatment in mice underexpressing JIP3. Therefore, our data indicate that JIP3 contributes to epileptic seizures, although the specific mechanism is unclear. We next showed that JIP3 mediates JNK activation and neuron apoptosis in KA-induced seizures. As expected, increased JNK activation is inversed in the LV-JIP3-RNAi group after KA treatment, which is consistent with previous studies that showed knockdown of JIP3 inhibits the activation of JNK in neonate brains (Ha et al., 2005) as well as in cells treated with LPS or following IR (Matsuguchi et al., 2003; Xu et al., 2010). A previous study showed that c-Jun (a nuclear substrate of JNK) mutant could not be phosphorylated on serine 63
and 73, and this lack of phosphorylation inhibited neuronal cell apoptosis after administration (Behrens et al., 1999). Moreover, recent reports have demonstrated that JNK inhibitors, such as SP600125 and D-JNKI-1, can efficiently block JNK activation and protect against neuronal death induced by seizures (Chen et al., 2010; Spigolon et al., 2010). In this study, the reduced expression of JIP3 significantly decreased JNK activation 8 h after KA administration, and mice underexpressing JIP3 exhibited less structural damage and neuronal apoptosis in the CA3 region of the hippocampus 3 days after KA treatment. These data indicate that the underexpression of JIP3 reduces the translocation of activated JNK into the nucleus, which ultimately results in decreased apoptosis. The effect of the underexpression of JIP3 on a PTZ kindling seizure model, was also investigated in our study. Previous studies revealed that knockdown JNK3 or c-Jun mutant mice exhibited no difference in seizure time course and severity compared with wild mice in a
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483
NSC 16258
No. of Pages 11
25 May 2015
9
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
Fig. 5. Effect of underexpressing JIP3 on KA-induced hippocampus cell apoptosis. (A, B) Representative photomicrographs showing Cresyl Violet staining and TUNEL staining in the CA3 region of the hippocampus in 3 days after KA treatment. (C) Decreased TUNEL-positive cells in the LVJIP3-RNAi group (***p < 0.001 compared with control; #p < 0.05, compared with LV-GFP group; no difference between LV-JIP3-RNAi group and control group, ANOVA followed by Dunnett’s test, n = 4). The scale bar is 100 lm and the insets are 10-fold. 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508
PTZ-induced acute seizure model (Yang et al., 1997; Behrens et al., 1999). However, our study found that the underexpression of JIP3 significantly slowed down the PTZ kindling seizure process. This discrepancy may be due to the different methods of PTZ administration. Unlike a single bolus injection in PTZ-induced acute seizures, we used repeated administration of a subthreshold dose and the entire kindling process lasts a relative long time. Another possible mechanism is that JIP3 may be implicated in other mechanisms except for the JNK cascades. For example, JIP3 can potentiate axon branching (Sun et al., 2013), and network rearrangement caused by axonal sprouting may be involved in epileptogenesis (Perez et al., 1996; Tang and Loke, 2010). This study also has some limitations. First, we are not able to equally compare JIP3 expression between TLE patients (from the neocortex) and KA-induced epileptic seizure mice (from hippocampus) as we cannot obtain hippocampus samples from individual controls due to practical and ethical reasons. Second, we investigated the effect of knockdown of JIP3 but did not study the effect of overexpression of JIP3 on seizures. Nonetheless, the expression of JIP3 is enriched in brain tissue itself and is significantly increased in both TLE patients and epileptic seizure mice model, the
significance of overexpression of JIP3 may be rather limited. Third, although our study found that JIP3 protected hippocampus neuron from excitotoxic stimulation might be through the inhibition of JNK activation, however, the exact mechanism of why loss of jip3 results in neuron protections or whether there are other mechanisms need further study in the coming years.
509
CONCLUSION
516
Our study demonstrates the increased expression of JIP3 in the temporal neocortex of TLE patients and in the experimental model of epileptic seizures. The underexpression of JIP3 substantially decreases seizure activity, inhibits JNK activation and diminishes seizureinduced hippocampus neuronal death in KA-induced acute seizure model. Furthermore, the underexpression of JIP3 significantly retards the PTZ kindling seizure process. The above findings provide evidence that JIP3 is involved in epileptic seizures and the regulation of neuronal response to excitotoxic stress.
517
UNCITED REFERENCES
528
Qureshi and Mehler (2010) and Li et al. (2013).
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
510 511 512 513 514 515
518 519 520 521 522 523 524 525 526 527
529
NSC 16258
No. of Pages 11
25 May 2015
10
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx
537
Acknowledgments—This work was supported by National Nature Science Foundation of China (No. 81271445). We appreciate the patients and their families for their participation in this study. The authors sincerely thank Tiantan Hospital and Xuanwu Hospital of the Capital Medical University for providing the brain tissues, and the National Institutes of Health of China and the Ethics Committee on Human Research of Chongqing Medical University for their support.
538
REFERENCES
539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596
Akechi M, Ito M, Uemura K, Takamatsu N, Yamashita S, Uchiyama K, Yoshioka K, Shiba T (2001) Expression of JNK cascade scaffold protein JSAP1 in the mouse nervous system. Neurosci Res 39:391–400. Avignone E, Ulmann L, Levavasseur F, Rassendren F, Audinat E (2008) Status epilepticus induces a particular microglial activation state characterized by enhanced purinergic signaling. J Neurosci 28:9133–9144. Banerjee PN, Filippi D, Allen Hauser W (2009) The descriptive epidemiology of epilepsy-a review. Epilepsy Res 85:31–45. Behrens A, Sibilia M, Wagner EF (1999) Amino-terminal phosphorylation of c-Jun regulates stress-induced apoptosis and cellular proliferation. Nat Genet 21:326–329. Ben-Ari Y, Cossart R (2000) Kainate, a double agent that generates seizures: two decades of progress. Trends Neurosci 23:580–587. Bilimoria PM, de la Torre-Ubieta L, Ikeuchi Y, Becker EB, Reiner O, Bonni A (2010) A JIP3-regulated GSK3beta/DCX signaling pathway restricts axon branching. J Neurosci 30:16766–16776. Borsello T, Forloni G (2007) JNK signalling: a possible target to prevent neurodegeneration. Curr Pharm Des 13:1875–1886. Brecht S, Kirchhof R, Chromik A, Willesen M, Nicolaus T, Raivich G, Wessig J, Waetzig V, Goetz M, Claussen M, Pearse D, Kuan C-Y, Vaudano E, Behrens A, Wagner E, Flavell RA, Davis RJ, Herdegen T (2005) Specific pathophysiological functions of JNK isoforms in the brain. Eur J Neurosci 21:363–377. Chen X, Wu J, Hua D, Shu K, Wang JZ, Li L, Lei T (2010) The c-Jun N-terminal kinase inhibitor SP600125 is neuroprotective in amygdala kindled rats. Brain Res 1357:104–114. Davis RJ (2000) Signal transduction by the JNK group of MAP kinases. Cell 103:239–252. French JA (2007) Refractory epilepsy: clinical overview. Epilepsia 48(Suppl. 1):3–7. Friedman LK, Pellegrini-Giampietro DE, Sperber EF, Bennett MV, Moshe SL, Zukin RS (1994) Kainate-induced status epilepticus alters glutamate and GABAA receptor gene expression in adult rat hippocampus: an in situ hybridization study. J Neurosci 14:2697–2707. Ha HY, Cho IH, Lee KW, Song JY, Kim KS, Yu YM, Lee JK, Song JS, Yang SD, Shin HS, Han PL (2005) The axon guidance defect of the telencephalic commissures of the JSAP1-deficient brain was partially rescued by the transgenic expression of JIP1. Dev Biol 277:184–199. Henshall DC, Simon RP (2005) Epilepsy and apoptosis pathways. J Cereb Blood Flow Metab 25:1557–1572. Kelkar N, Gupta S, Dickens M, Davis RJ (2000) Interaction of a mitogen-activated protein kinase signaling module with the neuronal protein JIP3. Mol Cell Biol 20:1030–1043. Koushika SP (2008) ‘‘JIP’’ing along the axon: the complex roles of JIPs in axonal transport. Bioessays 30:10–14. Li Y, Xiao D, Yang S, Zhang L (2013) Promoter methylation represses AT2R gene and increases brain hypoxic-ischemic injury in neonatal rats. Neurobiol Dis 60:32–38. Matsuguchi T, Masuda A, Sugimoto K, Nagai Y, Yoshikai Y (2003) JNK-interacting protein 3 associates with Toll-like receptor 4 and is involved in LPS-mediated JNK activation. EMBO J 22:4455–4464. Matsuura H, Nishitoh H, Takeda K, Matsuzawa A, Amagasa T, Ito M, Yoshioka K, Ichijo H (2002) Phosphorylation-dependent
530 531 532 533 534 535 536
scaffolding role of JSAP1/JIP3 in the ASK1-JNK signaling pathway. A new mode of regulation of the MAP kinase cascade. J Biol Chem 277:40703–40709. McNamara JO (1999) Emerging insights into the genesis of epilepsy. Nature 399:A15–A22. Mishra A, Goel RK (2012) Age dependent learning and memory deficit in Pentylenetetrazol kindled mice. Eur J Pharmacol 674:315–320. Monory K, Massa F, Egertova M, Eder M, Blaudzun H, Westenbroek R, Kelsch W, Jacob W, Marsch R, Ekker M, Long J, Rubenstein JL, Goebbels S, Nave KA, During M, Klugmann M, Wolfel B, Dodt HU, Zieglgansberger W, Wotjak CT, Mackie K, Elphick MR, Marsicano G, Lutz B (2006) The endocannabinoid system controls key epileptogenic circuits in the hippocampus. Neuron 51:455–466. Muresan Z, Muresan V (2005) C-Jun NH2-terminal kinase-interacting protein-3 facilitates phosphorylation and controls localization of amyloid-beta precursor protein. J Neurosci 25:3741–3751. Ongusaha PP, Qi HH, Raj L, Kim YB, Aaronson SA, Davis RJ, Shi Y, Liao JK, Lee SW (2008) Identification of ROCK1 as an upstream activator of the JIP-3 to JNK signaling axis in response to UVB damage. Sci Signal 1:ra14. Park HJ, Kim HJ, Ra J, Zheng LT, Yim SV, Chung JH (2008) Protective effect of topiramate on kainic acid-induced cell death in mice hippocampus. Epilepsia 49:163–167. Perez Y, Morin F, Beaulieu C, Lacaille JC (1996) Axonal sprouting of CA1 pyramidal cells in hyperexcitable hippocampal slices of kainate-treated rats. Eur J Neurosci 8:736–748. Qureshi IA, Mehler MF (2010) Epigenetic mechanisms underlying human epileptic disorders and the process of epileptogenesis. Neurobiol Dis 39:53–60. Schmidt D, Loscher W (2005) Drug resistance in epilepsy: putative neurobiologic and clinical mechanisms. Epilepsia 46:858–877. Song JJ, Lee YJ (2007) Differential activation of the JNK signal pathway by UV irradiation and glucose deprivation. Cell Signal 19:563–572. Spigolon G, Veronesi C, Bonny C, Vercelli A (2010) C-Jun N-terminal kinase signaling pathway in excitotoxic cell death following kainic acid-induced status epilepticus. Eur J Neurosci 31:1261–1272. Sun T, Yu N, Zhai LK, Li N, Zhang C, Zhou L, Huang Z, Jiang XY, Shen Y, Chen ZY (2013) C-Jun NH2-terminal kinase (JNK)interacting protein-3 (JIP3) regulates neuronal axon elongation in a kinesin- and JNK-dependent manner. J Biol Chem 288:14531–14543. Szaroma W, Dziubek K, Gren A, Kreczmer B, Kapusta E (2012) Influence of the kainic acid on antioxidant status in the brain, liver and kidneys of the mouse. Acta Physiol Hung 99:447–459. Takino T, Nakada M, Miyamori H, Watanabe Y, Sato T, Gantulga D, Yoshioka K, Yamada KM, Sato H (2005) JSAP1/JIP3 cooperates with focal adhesion kinase to regulate c-Jun N-terminal kinase and cell migration. J Biol Chem 280:37772–37781. Takino T, Yoshioka K, Miyamori H, Yamada KM, Sato H (2002) A scaffold protein in the c-Jun N-terminal kinase signaling pathway is associated with focal adhesion kinase and tyrosinephosphorylated. Oncogene 21:6488–6497. Tang FR, Loke WK (2010) Cyto-, axo- and dendro-architectonic changes of neurons in the limbic system in the mouse pilocarpine model of temporal lobe epilepsy. Epilepsy Res 89:43–51. Verhey KJ, Meyer D, Deehan R, Blenis J, Schnapp BJ, Rapoport TA, Margolis B (2001) Cargo of kinesin identified as JIP scaffolding proteins and associated signaling molecules. J Cell Biol 152:959–970. Waetzig V, Herdegen T (2005) Context-specific inhibition of JNKs: overcoming the dilemma of protection and damage. Trends Pharmacol Sci 26:455–461. Xu B, Zhou O K Y, Choy PC, Pierce GN, Siow YL (2010) Regulation of stress-associated scaffold proteins JIP1 and JIP3 on the c-Jun NH2-terminal kinase in ischemia-reperfusion. Can J Physiol Pharmacol 88:1084–1092. Yang DD, Kuan CY, Whitmarsh AJ, Rincon M, Zheng TS, Davis RJ, Rakic P, Flavell RA (1997) Absence of excitotoxicity-induced
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667
NSC 16258
No. of Pages 11
25 May 2015
Z. Wang et al. / Neuroscience xxx (2015) xxx–xxx 668 669 670 671 672 673 680 681 682
apoptosis in the hippocampus of mice lacking the Jnk3 gene. Nature 389:865–870. Zelano J, Halawa I, Clausen F, Kumlien E (2013) Hyponatremia augments kainic-acid induced status epilepticus in the mouse: a model for dysmetabolic status epilepticus. Epilepsy Res 106:29–34.
11
Zhang X, Chen G, Lu Y, Liu J, Fang M, Luo J, Cao Q, Wang X (2013) Association of mitochondrial Letm1 with epileptic seizures. Cereb Cortex. Zhao Y, Spigolon G, Bonny C, Culman J, Vercelli A, Herdegen T (2012) The JNK inhibitor D-JNKI-1 blocks apoptotic JNK signaling in brain mitochondria. Mol Cell Neurosci 49:300–310.
(Accepted 5 May 2015) (Available online xxxx)
Please cite this article in press as: Wang Z et al. Effects of JIP3 on epileptic seizures: Evidence from temporal lobe epilepsy patients, kainic-induced acute seizures and pentylenetetrazole-induced kindled seizures. Neuroscience (2015), http://dx.doi.org/10.1016/j.neuroscience.2015.05.008
674 675 676 677 678 679
