Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
The Effects of Enamel Matrix Derivative and Transforming Growth Factor-ß1 on Connective Tissue Growth Factor in Human Periodontal Ligament Fibroblasts Nora H.M. Heng, BDS, MDS*, Janine Zahlten, DVD‡, Valerie Cordes, DMD§, Marianne M-A Ong, BDS, MSc†, Bee Tin Goh, BDS, MDS*, Philippe D. N’Guessan, MD, MPH‡, Nicole Pischon, DMD, PhD§ * Clinical Research, National Dental Centre, Singapore. † Dept. of Restorative Dentistry, National Dental Centre, Singapore. ‡ Dept. of Infectious Diseases and Respiratory Medicine, Charite University Medicine of Berlin, Berlin, Germany. § Dept. of Periodontology, Charite University Medicine of Berlin, Berlin, Germany. Background Enamel matrix derivative (EMD) is suggested to stimulate transforming growth factor-beta (TGF-ß) production. Connective tissue growth factor (CTGF) is a downstream mediator of TGF-ß. The present study explores the effects of EMD and TGF-ß1 on CTGF in periodontal ligament (PDL) fibroblasts and their interactions in PDL proliferation and development. Methods Human PDL cells were stimulated with EMD. To explore the effects of EMD and TGF-ß1 on CTGF expression, cells were treated with and without TGF-ß inhibitor and CTGF protein levels were then assayed by Western Blot analysis. To study the role of CTGF in PDL development, cells were treated with CTGF inhibitor. Deoxyribonucleic acid (DNA) synthesis was analyzed by Bromodeoxyuridine (BrdU) enzyme-linked immunosorbent assay (ELISA). Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed to examine messenger ribonucleic acid (mRNA) expression of PDL osteoblastic differentiation markers: type I collagen, alkaline phosphatase (ALP) and osteocalcin (OC). Results EMD induced a concentration-dependent increase of CTGF protein expression in PDL cells. EMDand TGF-ß1- stimulated CTGF expression was significantly reduced in the presence of TGF-ß inhibitor. CTGF inhibition down-regulated both EMD- and TGF-ß1- induced DNA synthesis. The effect of CTGF and EMD on osteoblastic mRNA expression in PDL cells is not obvious. Conclusion EMD stimulates CTGF expression in human PDL cells, which is modulated by the TGF-ß pathway. CTGF can affect EMD- and TGF-ß1- induced PDL cell proliferation but its effects on PDL towards the osteoblastic differentiation remains inconclusive. The results provide novel insights in the EMD-CTGF interaction in PDL cells.
KEY WORDS: EMDOGAIN, connective tissue growth factor, transforming growth factor beta, periodontal ligament
Enamel matrix proteins, secreted by the Hertwig’s epithelial root sheath, have been implicated to play an important role in cementogenesis and in the development of periodontal attachment apparatus.1 A derivative of enamel matrix proteins, enamel matrix derivative (EMD), enhances cell growth and differentiation of mesenchymal cells and EMD has been suggested to support periodontal healing.2,3,4 The commercial product of EMD, EMDOGAIN, is available for the treatment of periodontal defects since 1997. It is derived from a purified acidic extract of developing embryonal enamel from six-month-old piglets, premixed with a propylene glycol ester of alginate (PGA) to improve its viscosity. Expression profiling of human periodontal 1
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
ligament (PDL) cells stimulated with EMD by complementary deoxyribonucleic acid (cDNA) microarray technology revealed that most of up-regulated genes belong to growth factors and growth factor receptors.5 Besides the postulation that EMD functions as an insoluble matrix to promote cells to produce growth factors, there is another hypothesis that bioactive molecules released from EMD are also responsible for the tissue regenerative activity of EMD. EMD is found to stimulate the production and release of growth factors crucial for periodontal tissue regeneration, such as transforming growth factor (TGF-ß).4-8 Also, the presence of TGF-ß or TGF-ß-like proteins was found in EMD gel.9,10 Connective tissue growth factor (CTGF), a cysteine-rich protein with a molecular weight of 36 - 38 kDa, is a member of a ctgf/cyr61/nov (CCN) gene family.11 The members of the CCN family exhibit significant role in cell development, such as adhesion, migration, proliferation and differentiation, and in biological processes such as angiogenesis and chondrogenesis.12 CTGF is believed to be a chemotactic and mitogenic factor for fibroblast-like cells and has been known to increase the expression of extracellular matrix molecules such as type I collagen, fibronectin, and integrin.13 It was overexpressed in fibroblasts in the dermis of patients with scleroderma or other fibrotic disorders.14 These findings suggest that CTGF plays an important role in cell proliferation and matrix synthesis in connective tissue. There has been increasing evidence of the role of CTGF in tooth development. During odontogenesis, CTGF gene expression was found in the dental mesenchyme as well as in the dental epithelium up to the stage of enamel secretion.15,16 During experimental tooth movement, there was a strong stimulation of CTGF expression in osteoblasts around the periodontal ligament.17 These findings indicate the role of CTGF in periodontal tissue development and regeneration. TGF-ß is widely known to regulate an extensive array of cellular processes, such as proliferation, differentiation, extra-cellular matrix (ECM) production, angiogenesis, immune responses, and cell death in many cell types including osteoblasts.18, 19 TGF-ß1, 2 and 3, members of the TGF-ß superfamily are known to stimulate mesenchymal cells to proliferate, produce ECM and induce a fibrotic response in various tissues in vivo, including PDL fibroblasts.20,21 CTGF is proposed to be a downstream mediator of TGF-ß and is strongly postulated to mediate its cell stimulatory actions in fibroblastic cells.22-24 For example, TGF-ßstimulated collagen production was antagonized by anti-CTGF antibodies or antisense oligonucleotides in rat kidney fibroblastic cells and human foreskin fibroblasts.25 In another study, CTGF specific antibodies and antisense CTGF were able to inhibit TGF-ß-induced proliferation. This effect was reversed when the fibroblastic cells were co-stimulated with both TGF-ß and CTGF, suggesting the requirement for interactions between both CTGF and TGF-ßdependent pathways to elicit the cell proliferation.26 Our previous study showed that EMD stimulates CTGF expression in human osteoblasts.27 Periodontal ligament (PDL) cells are one of the critical cell types in periodontal tissue regeneration.28,29 The interaction between EMD and TGF-ß1 on PDL fibroblastic development has been described, but the interaction of EMD and CTGF is still unknown. Therefore, the effects of EMD and TGF-ß1 on CTGF expression in PDL cells, as well as the impact of CTGF in EMD and TGF-ß1- induced PDL cell development are investigated.
2
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
MATERIAL AND METHODS Cell Culture Human PDL fibroblasts were obtained from healthy patients without periodontal disease ranging in age from 18 to 45 years. All patients had received printed information and signed a written consent according to the guidelines of the Central German Ethics Committee’s referral, focusing on the use of body materials in medical research.30 All teeth samples were placed in 50 ml tissue culture tubes containing Dulbecco’s modified Eagle’s medium (DMEM)|| supplemented with 200 U/mL penicillin/streptomycin||, 200 U/mL amphotericin B|| and 10 % inactivated fetal calf serum (iFCS).|| PDL explanted cultures were cultured using the method as previously described.31,32 Briefly, PDL fragments were harvested from the middle third of the root of extracted teeth. The fragments were washed and cultured in DMEM containing 10 % iFCS, 100 U/mL penicillin/streptomycin, 100 U/mL amphotericin B and 50 µg/mL ascorbic acid, at 37 oC and 5% CO2 in air atmosphere. When the PDL cells reached confluence, they were trypsinized with 0.25 % trypsin¶ for the second culture. For the experiments, cells between the 3rd and 7th passages were used. Dissolution of EMD EMD# was prepared by dissolving 0.7 ml of sterile EMD (30 mg/ml) in sterile Hank’s solution without calcium and magnesium to yield a 1 mg/ml stock solution. The solution was stored in the refrigerator for no longer than 3 weeks. To Examine CTGF Protein Expression by EMD Stimulation in ConcentrationDependent Experiment Cells were subcultured in 60 mm diameter plates at a density of 2.5 x 105 cells per plate. Upon reaching confluency, cells were serum starved for 24 h prior to treatment. Concentrationdependent experiments were first performed with 0, 25, 50 and 100 µg/ml EMD for 48 h. The cultures were then processed for Western Blot analysis. To Examine CTGF Protein Expression of EMD-Stimulated Cells With Anti-TGF-ß Antibody Based on results of the concentration-dependent experiment mentioned earlier, we next studied the effects of EMD and anti-TGF antibody on CTGF protein expression. Cells were treated with each of the following experimental mediums: (A) Serum-free DMEM. Cells treated in this medium serve as negative control. Out of this treatment group, half was subsequently treated with 5 µg/ml of monoclonal anti-TGF-ß1,ß2, ß3 antibody† for 48 h, while another half was not being treated. (B) Serum-free DMEM containing 100 µg/ml EMD. Cells treated in this medium serve to see the treatment effect of EMD. Similar to (A), half was subsequently treated with 5 µg/ml of monoclonal anti-TGF-ß1,ß2, ß3 antibody† for 48 h, while another half was not being treated. 3
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
(C) Serum-free DMEM containing 5 ng/ml human TGF-ß1‡. Cells treated in this medium serve as positive control. Subsequent treatment was also done in a similar way as mentioned previously in (A) and (B). Thereafter from treatment (A), (B) and (C), Western blot analysis was done. Western Blot Analysis For Western Blot analysis, cells were first harvested with cold lysis buffer comprising 1 % (vol/vol) Triton X-100, 50 mM Tris-Hydrochloride (Tris-HCl) (pH 7.4), 0.25 mM ethylenediaminetetracetic acid (EDTA), 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 µM antipain, leupeptin and pepstatin A each. Protein concentration was determined using Bradford method33 with a protein assay reagent**. Protein samples were resuspended in Laemmli buffer**.34 Protein extract (80 µg/lane) was separated by sodium dodecyl sulfate 12.5 % polyacrylamide gel electrophoresis (SDS-PAGE) and then blotted onto a blotting membrane††. The membranes were blocked with a blocking buffer‡‡ for 1 h at room temperature and then incubated overnight at 4 oC with blocking buffer containing rabbit polyclonal CTGF antibody§§ and mouse monoclonal extracellular signal-regulated kinase (ERK2) antibody|||| at a dilution of 1:2000 each. Anti-ERK2 antibody was used to confirm equal protein load. The next day, the membranes were washed thoroughly with washing buffer containing phosphate buffered saline (PBS) and 0.1 % Tween 20. Membranes were then incubated for 1 h at room temperature with blocking buffer containing fluorochrome-conjugated secondary antibodies, CY5.5 conjugated anti-mouse immunoglobulin G (IgG) and infra-red dye of conjugated anti-rabbit IgG¶¶, at a dilution of 1:2000 each. Proteins were visualized by using an infrared imaging system##. Protein sizes (CTGF: 38kDa, ERK-2: 44 kDa) were confirmed by comparison with protein molecular weight marker SDS-PAGE standards##. Relevant band intensities were quantified by densitometric analysis***. To Examine the Role of CTGF in PDL Cell Proliferation (DNA Synthesis) PDL cells were seeded onto 96-well plates§§§ at a density of 2.5 x 103 cells/well at 37 oC for 48 hours. Cells were then treated with each of the following experimental mediums: (a) 2% iFCS DMEM; (b) 2% iFCS DMEM containing 100 µg/ml EMD; (c) 2% iFCS DMEM containing 5 ng/ml human TGF-ß1. Half of each medium group was treated with 2.5 µg/ml anti-CTGF antibody|||||| and the other half was not being treated with the antibody. Nucleic acid synthesis was assessed by 5-Bromo-2’-Deoxyuridine Incorporation (BrdU) Proliferation Immunoassay¶¶¶ as described before.27,31 The assay is based on measuring BrdU Incorporation (2 h labeling time) in place of thymidine into newly synthesized deoxyribonucleic acid (DNA) of replicating cells by ELISA. Optical densities (OD) were measured using a microplate reader### at 405 nm. To Examine a Role of CTGF in Osteoblastic Differentiation of PDL Cells Cells were subcultured in 6-well plates**** at a density of 2 x 105 cells per well. Upon reaching confluency, cells were serum starved for 24 hours prior to treatment. Cells were then cultivated with each of the following experimental mediums, similar to those used for Western Blot analysis: (A) serum-free DMEM; (B) serum-free DMEM containing 100 µg/ml EMD; (C) serum-free DMEM containing 5 ng/ml human TGF-ß1. Half of each medium group was treated with 2.5 µg/ml anti-CTGF and the other half was left untreated. They were cultivated for 16 days 4
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
and from day 8 of culture, 5 mmol/l β-glycerophosphate was added. The cultures were then processed for RNA Extraction and Reverse Transcription-Polymerase Chain Reaction Analysis (RT-PCR). For the RT-PCR procedure, total RNA was isolated by using the RNeasy Mini Kit†††† and then reverse transcribed using avian myeloblastosis virus reverse transcriptase‡‡‡‡. Generated cDNA was amplified by RT-PCR using primers designed with computer software assistance§§§§ and synthesized accordingly||||||||. Their genetic sequences and the conditions needed are shown in Table 1. The genes examined were collagen type I, alkaline phosphatase (ALP) and osteocalcin (OC). In brief, collagen type I plays an important role in the formation of bone extra-cellular matrix. It is often considered as an early indicator of osteoblastic differentiation. ALP is a ubiquitous cellular protein. It is an important component in hard tissue formation, especially during the matrix maturation stage. OC is one of the few osteoblast specific genes and is one of the most abundant proteins present in bone. It is thought to play an important role in the later stage of osteoblastic differentiation and mineralization.35 Glyceraldehyde-3-phosphate (GAPDH) mRNA ensured equivalent DNA loading. The RT-PCR products were analyzed on 1.5 % agarose gels, stained with ethidium bromide. Fragment sizes were confirmed by comparison with a 1-kb DNA ladder molecular weight marker¶¶¶¶. The intensity of the bands on agarose gels resembling the RT-PCR products was then measured. Statistical Analysis Results were expressed as means ± SD. Data were analyzed by one-way ANOVA, using Bonferroni’s modification for post-hoc testing. Comparisons between 2 individual groups were made using 2-tailed unpaired Student’s t-test. A p < 0.05 was considered statistically significant.
Results Effect of EMD on CTGF Protein Levels The effect of EMD on CTGF protein expression in serum-free medium with and without various concentrations of EMD (0-100 µg/ml) stimulated for 48 h was examined by Western Blot analysis. A concentration-dependent increase of CTGF protein expression with a statistically significant increase of CTGF protein levels at 50 µg/ml EMD and 100 µg/ml EMD was found (Figure 1). Effect of Anti-TGF-ß Antibody on CTGF Expression To assess whether EMD-induced CTGF expression is modulated by TGF-ß, we examined the effects of anti-TGF-ß antibody on EMD-induced CTGF protein expression. Human PDL cells were incubated for 48 h with 100 µg/ml EMD or 5 ng/ml TGF-ß1, with and without 5 µg/ml anti-TGF-ß1,ß2,ß3 antibody. Untreated and TGF-ß1-treated groups serve as negative and positive controls respectively. Both EMD and TGF-ß1 groups exhibit a significant CTGF protein levels as compared to the untreated group (Figure 2). Unlike the untreated group, the antibody significantly inhibited EMD-induced CTGF protein production (2.5 fold versus 1.1 fold). Similarly, the addition of the 5
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
antibody clearly neutralized the effects of TGF-ß1 on CTGF expression (1.7 fold versus 0.1 fold). Effect of CTGF on PDL Cell Proliferation (DNA synthesis) Present data revealed an increase of CTGF protein by EMD in PDL cells. We next wished to examine the role of EMD- and TGF-ß1- induced CTGF expression on PDL DNA synthesis. A statistically significant increase of BrdU incorporation following treatment with 100 µg/ml EMD and TGF-ß1 compared to control was found (Figure 3). In contrast to the control group, the antiCTGF antibody statistically inhibited BrdU incorporation in both TGF-ß and EMD-treated groups. Effect of CTGF on mRNA Expression of Osteoblastic Differentiation in PDL Cells Besides studying cell proliferation, we next investigated the effects of CTGF inhibition on osteoblastic differentiation markers (Figure 4). With regards to collagen I and ALP mRNA expressions, change in mRNA expression was generally not obvious (Figure 4B and 4C), More obvious difference was noticed in OC mRNA expression, where the addition of anti-CTGF antibody showed more inhibition of OC expression in TGF- ß1 group and EMD groups. (Figure 4D). However in this experiment, we noticed that the change of mRNA level ratio was within a range of 0.8-1.2 compared to the untreated control. Although there were some significant differences between groups, such differences may not reflect the real clinical value. As such, we consider the results inconclusive.
DISCUSSION EMD has been shown to promote periodontal regeneration by inducing formation of PDL and alveolar bone.36,37 It has been suggested that EMD adsorbs to denuded root surfaces and periodontal bony defects and forms an insoluble scaffold complex, which promotes recolonization of periodontal cells, inducing periodontal regeneration.6,38 Besides providing a matrix for cell re-colonization, it is proposed that EMD induces the production and action of growth factors.6,39 TGF-ß1 plays an important role in the modulation of extracellular periodontal matrix formation and is postulated to be a potential candidate of mediating the effects of EMD.4,6-7,27,39-40 CTGF, a downstream mediator of TGF-ß11,22 is a crucial growth factor regulating cellular activities in fibrogenesis.23-24 In fact, it is believed that many of the properties of TGF-ß in fibrogenesis including fibroblastic cell growth, differentiation and expression of extracellular matrix proteins are CTGF-related.23 Therefore, the interactions between EMD and CTGF expression in human PDL cells were investigated in the present study. The presented data shows that EMD significantly up-regulates CTGF protein expression in primary human PDL cells. A concentration-dependent stimulation with maximal CTGF protein expression at EMD concentrations of 50-100 µg/ml was observed. These data are in accordance to previous results found in a human osteoblastic cell line (Saos-2) with a maximal CTGF expression at 50-100 µg/ml EMD.27 Studies have found that increasing EMD concentrations lead to increasing amounts of TGF-ß.5,9-10 In the present study, the addition of anti-TGF-ß1, ß2, ß3 antibody significantly lowered EMD-induced CTGF protein expression, which suggests that EMD-induced CTGF expression is mediated via TGF-ß pathway in PDL cells. 6
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
Similar to many studies,2,4,7,31 we found an increased DNA synthesis following EMD stimulation in PDL cells. We also found that TGF-ß1-induced DNA synthesis is inhibited by anti-CTGF antibody, indicating that CTGF plays a significant role in TGF-ß1 stimulatory effects in PDL cell proliferation. Studies have shown a stimulatory role of CTGF in fibroblastic cell proliferation and differentiation.11,23 It has been postulated that proliferative responses to TGF-ß can be induced by CTGF-dependent pathways in fibroblastic cells.23,41 We also found that the proliferative effect of EMD on PDL cells is significantly inhibited by anti-CTGF antibody. This indicates that the proliferative action of EMD on PDL cells may be directly affected via CTGFdependent pathways. Further studies are needed to study in greater detail, the association of CTGF and EMD on fibroblastic proliferation. Successful periodontal regeneration can be achieved by selective migration, proliferation and differentiation of cells from the periodontal ligament.29,42 PDL cells were shown to exhibit osteoblastic properties.28,42 The transition in the developmental sequence occurs when proliferation ceases and expression of genes related to the differentiated phenotype of osteoblasts is initiated. We chose a 16-day stimulation period for it would provide sufficient time for the gene expression of osteoblastic differentiated markers after the proliferative period. Collagen 1 is a marker of early differentiation or late proliferative stage.35 ALP represents the matrix maturation stage. It is postulated that the post-proliferative period is from day 12 onwards with the peak levels of ALP gene expression on day 16.35 OC has high affinity for bone mineral constituents and it plays a major role in bone mineralization during periodontal regeneration.3 It is an osteoblastic marker for late stage of maturation or mineralization stage. Studies indicate that the maximal expression of osteocalcin is found to be between day 16 to 20.43-44 Studies show that EMD affects genes related to mineralization and supports PDL cell differentiation towards an osteoblastic phenotype.2,4-5 EMD studies done on PDL cultures, showed controversial results on early markers such as type I collagen but stimulating effects on later markers of osteoblastic differentiation in PDL cells.2,45-48 CTGF studies done on osteoblasts have suggested that CTGF promotes the synthesis of markers of osteoblastic differentiation and mineralization such as type I collagen, ALP, OPN and OC.11,49-50 However, in our study on the effect of CTGF and EMD on osteoblastic mRNA expression in PDL cells, our results are inconclusive due to the narrow range of differences noticed between groups. This may be due to the heterogeneous nature of the PDL cells derived from fresh samples. There are 2 areas in this study that can be further refined: the cell type and the modification of biochemical pathway under study. Firstly, PDL has stromal stem cells that possess the multipotential to differentiate into various types of cells, such as fibroblasts, osteoblast-like cells, adipocytes and chondrocytes and neurocytes. These cells also have the unique potential to form cementum- and PDL-like tissues. However a small and varying number of such stem cells are usually present in PDL tissue. For the convenience and consistency of analyses, it would be better to use characterized immortalized PDL cell line instead of using primary PDL cultures from freshly extracted adult teeth to minimize the inclusion of other cell types, such as gingival cells. Secondly, CTGF has an established role in promoting fibrogenesis13, 14, 24 and its effects are TGF-related. Compared to its role in osteogenesis, there is more evidence to show that CTGF directs mesenchymal or stroma stem cells to differentiate into fibroblasts. Given the concrete evidence and clinical applications involving CTGF in fibrogensis, it would be useful to examine the role of CTGF in PDL, which is mostly a fibroblastic nature. This study provides us the first insight of the effects of CTGF in EMD- and TGF- ß1- stimulated PDL cells with regards to the 7
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
osteoblastic phenotype. More studies are needed to elucidate in greater detail of such interactions in PDL cells and the biochemical pathways involved.
CONCLUSION The present results showed that EMD stimulates CTGF expression in PDL cells and EMD affects CTGF expression via TGF-ß pathway. CTGF affects both EMD- and TGF-ß1- induced PDL cell proliferation but its effects on PDL towards osteoblastic differentiation remains inconclusive. Further studies are needed to study in greater detail, the association of CTGF and EMD on PDL development. ACKNOWLEDGEMENTS The authors wish to sincerely thank the following people: Dr. Andrew B.G. Tay (former Research Director of National Dental Centre [NDC], Singapore) for his kind and tremendous support for this project; and Mrs. Verena Kanitz (Dept. of Periodontology, Charite University Medicine of Berlin, Berlin, Germany) for her technical expertise. This work was financially supported by grants of the German Research Foundation (DFG) GK 325/2-00, Bonn, Germany and a habilitation grant from the Charite University Medicine of Berlin, awarded to A/Prof Nicole Pischon; as well as Singhealth Foundation Grant for Clinician Scientist, Singapore (SHF/FG336S/2007) awarded to Dr. Nora Heng; and the National Dental Centre of Singapore (NDCS) Research Fund. All involved in the study report no conflict of interest related to this study.
REFERENCES 1.
Hammarström L. The role of enamel matrix proteins in the development of cementum and periodontal tissues. Ciba Found Symp 1997;205:246-255.
2.
Gestrelius S, Andersson C, Lidström D, Hammarström L, Somerman M. In vitro studies on periodontal ligament cells and enamel matrix derivative. J Clin Periodontol 1997;24:685-692.
3.
Weishaupt P, Bernimoulin JP, Trackman P, Hägewald S. Stimulation of osteoblasts with Emdogain increases the expression of specific mineralization markers. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2008;106:304-308.
4.
Bosshardt DD. Biological mediators and periodontal regeneration: a review of enamel matrix proteins at the cellular and molecular levels. J Clin Periodontol 2008;35:87-105.
5.
Brett PM, Parkar M, Olsen I, Tonetti M. Expression profiling of periodontal ligament cells stimulated with enamel matrix proteins in vitro: a model for tissue regeneration. J Dent Res 2002;81:776-783.
6.
Lyngstadaas SP, Lundberg E, Ekdahl H, Andersson C, Gestrelius S. Autocrine growth factors in human periodontal ligament cells cultured on enamel matrix derivative. J Clin Periodontol 2001;28:181-188.
7.
Van der Pauw MT, Van den Bos T, Everts V, Beertsen W. Enamel matrix-derived protein stimulates attachment of periodontal ligament fibroblasts and enhances alkaline phosphatase activity and transforming growth factor β1 release of periodontal ligament and gingival fibroblasts. J Periodontol 2000;71:31-43.
8.
Parkar MH, Tonetti M. Gene expression profiles of periodontal ligament cells treated with enamel matrix proteins in vitro: analysis using cDNA arrays. J Periodontol 2004;75:1539-1546.
9.
Kawase T, Okuda K, Momose M, Kato Y, Yoshie H, Burns DM. Enamel matrix derivative (EMDOGAIN) rapidly stimulates phosphorylation of the MAP kinase family and nuclear accumulation of smad2 in both oral epithelial and fibroblastic human cells. J Periodontal Res 2001;36:367-376.
10. Suzuki S, Nagano T, Yamakoshi Y, et al. Enamel matrix derivative gel stimulates signal transduction of BMP and TGF-beta. J Dent Res 2005;84:510-514. 11. Moussad EE, Brigstock DR. Connective tissue growth factor: what's in a name? Mol Genet Metab 2000;71:276292.
8
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
12. Takigawa M, Nakanishi T, Kubota S, Nishida T. The role of CTGF/ Hcs24/ecogenin in skeletal growth control. J Cell Physiol 2003;194:256-266. 13. Frazier KS, Williams S, Kothepelli D, Klapper H, Groendorst GR. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J Invest Dermatol 1996;107:404-411. 14. Igarashi A, Nashiro K, Kikuchi K, et al. Connective tissue growth factor gene expression in tissue sections from localized scleroderma, keloid, and other fibrotic skin disorders. J Invest Dermatol 1996;106:729-733. 15. Shimo T, Wu , Billings PC, et al. Expression, gene regulation, and roles of Fisp12/ CTGF in developing tooth germs. Dev Dyn 2002;224:267-278. 16. Yamaai T, Nakanishi T, Asano M, et al. Gene expression of connective tissue growth factor (CTGF/CCN2) in calcifying tissue of normal and cbfa1-null mutant mice in late stage of embryonic development. J Bone Miner Metab 2005;23:280-288. 17. Yamashiro T, Fukunaga T, Kobashi N, et al. Mechanical stimulation induces CTGF expression in rat osteocytes. J Dent Res 2001;80:461-465. 18. Bonewald LF, Dallas SL. Role of active and latent transforming growth factor beta in bone formation. J Cell Biochem 1994;55:350-357. 19. Centrella M, Horowitz MC, Wozney JM, McCarthy TL. Transforming growth factor-beta gene family members and bone. Endocr Rev 1994;15:27-39. 20. McCartney-Francis NL, Frazier-Jessen M, Wahl SM. TGF-beta: a balancing act. Int Rev Immunol 1998;16:553580. 21. Massagu J. TGF-beta signal transduction. Annu Rev Biochem 1998;67:753-791. 22. Grotendorst GR, Okochi H, Hayashi N. A novel transforming growth factor beta response element controls the expression of the connective tissue growth factor gene. Cell Growth Differ 1996;7:469-480. 23. Grotendorst GR. Connective tissue growth factor: a mediator of TGF-beta action on fibroblasts. Cytokine Growth Factor Rev 1997;8:171-179. 24. Leask A, Holmes A, Abraham DJ. Connective tissue growth factor: a new and important player in the pathogenesis of fibrosis. Curr Rheumatol Rep 2002;4:136-142. 25. Duncan MR, Frazier KS, Abramson S, et al. Connective tissue growth factor mediates transforming growth factor beta-induced collagen synthesis: down-regulation by cAMP. FASEB J 1999;13:1774-1786. 26. Kothapalli D, Frazier KS, Welply A, Segarini PR, Grotendorst GR. Transforming growth factor beta induces anchorage-independent growth of NRK fibroblasts via a connective tissue growth factor-dependent signaling pathway. Cell Growth Differ 1997;8:61-68. 27. Heng NH, N'Guessan PD, Kleber BM, Bernimoulin JP, Pischon N. Enamel matrix derivative induces connective tissue growth factor expression in human osteoblastic cells. J Periodontol 2007;78:2369-2379. 28. Somerman MJ, Foster RA, Imm GM, Sauk JJ, Archer SY. Periodontal ligament cells and gingival fibroblasts respond differently to attachment factors in vitro. J Periodontol 1989;60:73-77. 29. Melcher AH. Role of the periosteum in repair of wounds of the parietal bone of the rat. Arch Oral Biol 1969;14:1101-1109. 30. Zentrale Ethikkommission bei der Bundeszahnärztekammer. The use of human body materials for purposes of medical research. Available at http://www.zentrale-ethikkommission.de/page.asp?his=0.1.22. Accessed October 16, 2012. 31. Pischon N, Zimmermann B, Bernimoulin JP, Hägewald S. Effects of an enamel matrix derivative on human osteoblasts and PDL cells grown in organoid cultures. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;102:551-557.
9
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
32. Somerman MJ, Archer SY, Imm GR, Foster RA. A comparative study of human periodontal ligament cells and gingival fibroblasts in vitro. J Dent Res 1988;67:66-70. 33. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248-254. 34. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680-685. 35. Lian JB, Stein GS. Development of the osteoblast phenotype: molecular mechanisms mediating osteoblast growth and differentiation. Iowa Orthop J 1995;15:118-140. 36. Sculean A, Alessandri R, Miron RJ, Salvi G, Bosshard DD. Enamel matrix proteins and periodontal wound healing and regeneration. Clin Adv Periodontics 2011;1:101-117. 37. Gkranias ND, Graziani F, Sculean A, Donos N. Wound healing following regenerative procedures in furcation degree III defects: histomorphometric outcomes. Clin Oral Investig 2012; 6:239-249. 38. Heijl L. Periodontal regeneration with enamel matrix derivative in one human experimental defect. A case report. J Clin Periodontol 1997;24:693-696. 39. Kawase T, Okuda K, Yoshie H, Burns DM. Anti-TGF-beta antibody blocks enamel matrix derivative-induced upregulation of p21WAF1/cip1 and prevents its inhibition of human oral epithelial cell proliferation. J Periodontal Res 2002;37:255-262. 40. Miron RJ, Bosshardt DD, Zhang Y, Buser D, Sculean A. Gene array of primary human osteoblasts exposed to enamel matrix derivative in combination with a natural bone mineral. Clin Oral Investig [serial online]. May 3, 2012. Accessed September 18, 2012. 41. Kothapalli D, Frazier KS, Welply A, Segarini PR, Grotendorst GR. Transforming growth factor beta induces anchorage-independent growth of NRK fibroblasts via a connective tissue growth factor-dependent signaling pathway. Cell Growth Differ 1997;8:61-68. 42. Nagatomo K, Komaki M, Sekiya I, et al. Stem cell properties of human periodontal ligament cells. J Periodontal Res 2006;41:303-310. 43. Thomas GP, Baker SUK, Eisman JA, Gardiner EM. Changing RANKL/OPG mRNA expression in differentiating murine primary osteoblasts. J Endocinol 2001;170:451-460. 44. Stein GS, Lian JB. Molecular mechanisms mediating proliferation/differentiation interrelationships during progressive development of the osteoblast phenotype. Endocr Rev 1993;14:424–442. 45. Palioto DB, Coletta RD, Graner E, Joly JC, de Lima AF. The influence of enamel matrix derivative associated with insulin-like growth factor-I on periodontal ligament fibroblasts. J Periodontol 2004;75:498-504. 46. Hägewald S, Pischon N, Jawor P, Bernimoulin JP, Zimmermann B. Effects of enamel matrix derivative on proliferation and differentiation of primary osteoblasts. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;98:243-249. 47. Nagano T, Iwata T, Ogata Y, et al. Effect of heat treatment on bioactivities of enamel matrix derivatives in human periodontal ligament (HPDL) cells. J Periodontal Res 2004;39:249-256. 48. Rincon JC, Haase HR, Bartold PM. Effect of Emdogain on human periodontal fibroblasts in an in vitro woundhealing model. J Periodontal Res 2003;38:290-295. 49. Safadi FF, Xu J, Smock SL, et al. Expression of connective tissue growth factor in bone: its role in osteoblast proliferation and differentiation in vitro and bone formation in vivo. J Cell Physiol 2003;196:51-62. 50. Nishida T, Nakanishi T, Asano M, Shimo T, Takigawa M. Effects of CTGF/Hcs24, a hypertrophic chondrocyte-specific gene product, on the proliferation and differentiation of osteoblastic cells in vitro. J Cell Physiol 2000;184:197-206.
10
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
Correspondence: Dr. Nora Heng, National Dental Centre Singapore, 5 Second Hospital Avenue, 168938 Singapore, Tel. +65 97703996, Fax +65 63248900, Email: [email protected] Submitted July 07, 2012; accepted for publication November 05, 2014. Figure 1. Concentration-dependent stimulation of CTGF protein expression by EMD Cells were incubated in serum free media containing EMD for 48 h. A) One representative blot of four experiments is shown. ERK 2 (44kDa) served as loading control. CTGF (38 kDa) protein amount was normalized to the amount of ERK 2. B) The graph shown is the ratio of treated cultures compared to untreated control (relative expression=1). *p < 0.05, compared to untreated control. Figure 2. Inhibition of EMD-stimulated CTGF protein expressions by anti-TGF-ß antibody Cells were incubated in serum free media, with EMD or TGF-ß1, with and without anti-TGF-ß antibody for 48 h. Cells treated in untreated medium and medium with TGF-ß1 serve as negative and positive controls respectively. A) One representative blot from four experiments is shown. The CTGF levels were normalized to the amount of ERK2 and the ratio of treated cultures to untreated control were compared. B) The graph shown is the ratio of treated cultures to untreated control (relative expression = 1). *p < 0.05 compared to untreated control. **p < 0.05 with and without antibody. Figure 3. Effects of CTGF on EMD-induced BrdU incorporation. Cells were incubated in 2 % iFCS-containing media for 48 h with EMD or TGF-ß1, with and without anti-CTGF antibody. Cells treated in untreated medium and medium with TGF-ß1 serve as negative and positive controls respectively. Data shown represents the mean ± SD of four independent experiments. *p < 0.05 compared to untreated control. **p < 0.05 with and without antibody. Figure 4. Effects of CTGF on mRNA expression of genes related to the differentiated phenotype of PDL cells Cells were incubated in 2 % iFCS-containing media, with EMD or TGF-ß1, with and without anti-CTGF antibody for 16 days. Gene expression was analyzed by RT-PCR. Cells treated in untreated medium and medium with TGFß1 serve as negative and positive controls respectively. (A) One representative gel of each gene of 3 blots is shown. (B to D) Graphs represent the mean ± SD of three independent experiments of each gene. Table 1. Primer sequences Primer Name
Sequence sense Sequence antisense CCCAAGGACAAGAGGCAT
Collagen I
GCAGTGGTAGGTGATGTTCTG AGAAAGAGAAAGACCCCAAGTA
ALP
TTCACCCCACACAGGTAG AGCGAGGTAGTGAAGAGACCC
Osteocalcin
CCTGGAGAGGAGCAGAACTG
11
PCR fragment length
Temp oC
Cycles
159
60
28
300
58
36
228
65
36
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
ACCCAGAAGACTGTGGATGG GADPH
TGTGAGGGAGATGCTCAGTG
279
60
26
Grant support: Grant of the German Research Foundation (DFG) GK 325/2-00 and Habilitation grant of the Charite University Medicine of Berlin, Berlin, Germany to Dr. Nicole Pischon; Singhealth Foundation Grant for Clinician Scientist SHF/FG336S/2007 to Dr. Nora Heng and National Dental Centre of Singapore (NDCS) Research Fund. Key finding(s): EMD stimulates CTGF expression in PDL cells and CTGF affects EMD- and TGF-ß1- induced PDL cell proliferation. || Biochrom AG, Berlin, Germany. ¶ Biochrom AG, Berlin, Germany. # Emdogain, Straumann, Waldenburg, Switzerland. † R&D Systems, Minneapolis, US. ‡ Austral Biologicals, San Ramon, California, USA. ** Bio-Rad, Hercules, California, USA. †† Hybond-ECL, Amersham, Dreieich, Germany. ‡‡ Odyssey LICOR Inc., Bad Hamburg, Germany. §§ Abcam, Cambridge, UK. |||| Santa Cruz Biotechnologies, Santa Cruz, California, USA. ¶¶ Rockland Immunochemicals, Gilbertsville, Pennsylvania, USA. ## Bio-Rad, Hercules, California, USA. *** Odyssey LICOR Inc., Bad Hamburg, Germany. §§§ Nunc, Roskilde, Denmark. |||||| Abcam, Cambridge, UK. ¶¶¶ Roche, Basel, Switzerland ### Bio-Rad, Hercules, California, USA. **** Nunc, Roskilde, Denmark. †††† Qiagen, West Sussex, UK. ‡‡‡‡ Promega, Madison, Wisconsin, USA. §§§§ Primer 3, Whitehead Institute for Biomedical Research, Cambridge, Massachusetts, USA |||||||| TIB MOLBIOL, Berlin, Germany. ¶¶¶¶ Life Technologies, Darmstadt, Germany.
12
13
14
15
16
DOI: 10.1902/jop.2015.120448
The Effects of Enamel Matrix Derivative and Transforming Growth Factor-ß1 on Connective Tissue Growth Factor in Human Periodontal Ligament Fibroblasts Nora H.M. Heng, BDS, MDS*, Janine Zahlten, DVD‡, Valerie Cordes, DMD§, Marianne M-A Ong, BDS, MSc†, Bee Tin Goh, BDS, MDS*, Philippe D. N’Guessan, MD, MPH‡, Nicole Pischon, DMD, PhD§ * Clinical Research, National Dental Centre, Singapore. † Dept. of Restorative Dentistry, National Dental Centre, Singapore. ‡ Dept. of Infectious Diseases and Respiratory Medicine, Charite University Medicine of Berlin, Berlin, Germany. § Dept. of Periodontology, Charite University Medicine of Berlin, Berlin, Germany. Background Enamel matrix derivative (EMD) is suggested to stimulate transforming growth factor-beta (TGF-ß) production. Connective tissue growth factor (CTGF) is a downstream mediator of TGF-ß. The present study explores the effects of EMD and TGF-ß1 on CTGF in periodontal ligament (PDL) fibroblasts and their interactions in PDL proliferation and development. Methods Human PDL cells were stimulated with EMD. To explore the effects of EMD and TGF-ß1 on CTGF expression, cells were treated with and without TGF-ß inhibitor and CTGF protein levels were then assayed by Western Blot analysis. To study the role of CTGF in PDL development, cells were treated with CTGF inhibitor. Deoxyribonucleic acid (DNA) synthesis was analyzed by Bromodeoxyuridine (BrdU) enzyme-linked immunosorbent assay (ELISA). Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed to examine messenger ribonucleic acid (mRNA) expression of PDL osteoblastic differentiation markers: type I collagen, alkaline phosphatase (ALP) and osteocalcin (OC). Results EMD induced a concentration-dependent increase of CTGF protein expression in PDL cells. EMDand TGF-ß1- stimulated CTGF expression was significantly reduced in the presence of TGF-ß inhibitor. CTGF inhibition down-regulated both EMD- and TGF-ß1- induced DNA synthesis. The effect of CTGF and EMD on osteoblastic mRNA expression in PDL cells is not obvious. Conclusion EMD stimulates CTGF expression in human PDL cells, which is modulated by the TGF-ß pathway. CTGF can affect EMD- and TGF-ß1- induced PDL cell proliferation but its effects on PDL towards the osteoblastic differentiation remains inconclusive. The results provide novel insights in the EMD-CTGF interaction in PDL cells.
KEY WORDS: EMDOGAIN, connective tissue growth factor, transforming growth factor beta, periodontal ligament
Enamel matrix proteins, secreted by the Hertwig’s epithelial root sheath, have been implicated to play an important role in cementogenesis and in the development of periodontal attachment apparatus.1 A derivative of enamel matrix proteins, enamel matrix derivative (EMD), enhances cell growth and differentiation of mesenchymal cells and EMD has been suggested to support periodontal healing.2,3,4 The commercial product of EMD, EMDOGAIN, is available for the treatment of periodontal defects since 1997. It is derived from a purified acidic extract of developing embryonal enamel from six-month-old piglets, premixed with a propylene glycol ester of alginate (PGA) to improve its viscosity. Expression profiling of human periodontal 1
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
ligament (PDL) cells stimulated with EMD by complementary deoxyribonucleic acid (cDNA) microarray technology revealed that most of up-regulated genes belong to growth factors and growth factor receptors.5 Besides the postulation that EMD functions as an insoluble matrix to promote cells to produce growth factors, there is another hypothesis that bioactive molecules released from EMD are also responsible for the tissue regenerative activity of EMD. EMD is found to stimulate the production and release of growth factors crucial for periodontal tissue regeneration, such as transforming growth factor (TGF-ß).4-8 Also, the presence of TGF-ß or TGF-ß-like proteins was found in EMD gel.9,10 Connective tissue growth factor (CTGF), a cysteine-rich protein with a molecular weight of 36 - 38 kDa, is a member of a ctgf/cyr61/nov (CCN) gene family.11 The members of the CCN family exhibit significant role in cell development, such as adhesion, migration, proliferation and differentiation, and in biological processes such as angiogenesis and chondrogenesis.12 CTGF is believed to be a chemotactic and mitogenic factor for fibroblast-like cells and has been known to increase the expression of extracellular matrix molecules such as type I collagen, fibronectin, and integrin.13 It was overexpressed in fibroblasts in the dermis of patients with scleroderma or other fibrotic disorders.14 These findings suggest that CTGF plays an important role in cell proliferation and matrix synthesis in connective tissue. There has been increasing evidence of the role of CTGF in tooth development. During odontogenesis, CTGF gene expression was found in the dental mesenchyme as well as in the dental epithelium up to the stage of enamel secretion.15,16 During experimental tooth movement, there was a strong stimulation of CTGF expression in osteoblasts around the periodontal ligament.17 These findings indicate the role of CTGF in periodontal tissue development and regeneration. TGF-ß is widely known to regulate an extensive array of cellular processes, such as proliferation, differentiation, extra-cellular matrix (ECM) production, angiogenesis, immune responses, and cell death in many cell types including osteoblasts.18, 19 TGF-ß1, 2 and 3, members of the TGF-ß superfamily are known to stimulate mesenchymal cells to proliferate, produce ECM and induce a fibrotic response in various tissues in vivo, including PDL fibroblasts.20,21 CTGF is proposed to be a downstream mediator of TGF-ß and is strongly postulated to mediate its cell stimulatory actions in fibroblastic cells.22-24 For example, TGF-ßstimulated collagen production was antagonized by anti-CTGF antibodies or antisense oligonucleotides in rat kidney fibroblastic cells and human foreskin fibroblasts.25 In another study, CTGF specific antibodies and antisense CTGF were able to inhibit TGF-ß-induced proliferation. This effect was reversed when the fibroblastic cells were co-stimulated with both TGF-ß and CTGF, suggesting the requirement for interactions between both CTGF and TGF-ßdependent pathways to elicit the cell proliferation.26 Our previous study showed that EMD stimulates CTGF expression in human osteoblasts.27 Periodontal ligament (PDL) cells are one of the critical cell types in periodontal tissue regeneration.28,29 The interaction between EMD and TGF-ß1 on PDL fibroblastic development has been described, but the interaction of EMD and CTGF is still unknown. Therefore, the effects of EMD and TGF-ß1 on CTGF expression in PDL cells, as well as the impact of CTGF in EMD and TGF-ß1- induced PDL cell development are investigated.
2
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
MATERIAL AND METHODS Cell Culture Human PDL fibroblasts were obtained from healthy patients without periodontal disease ranging in age from 18 to 45 years. All patients had received printed information and signed a written consent according to the guidelines of the Central German Ethics Committee’s referral, focusing on the use of body materials in medical research.30 All teeth samples were placed in 50 ml tissue culture tubes containing Dulbecco’s modified Eagle’s medium (DMEM)|| supplemented with 200 U/mL penicillin/streptomycin||, 200 U/mL amphotericin B|| and 10 % inactivated fetal calf serum (iFCS).|| PDL explanted cultures were cultured using the method as previously described.31,32 Briefly, PDL fragments were harvested from the middle third of the root of extracted teeth. The fragments were washed and cultured in DMEM containing 10 % iFCS, 100 U/mL penicillin/streptomycin, 100 U/mL amphotericin B and 50 µg/mL ascorbic acid, at 37 oC and 5% CO2 in air atmosphere. When the PDL cells reached confluence, they were trypsinized with 0.25 % trypsin¶ for the second culture. For the experiments, cells between the 3rd and 7th passages were used. Dissolution of EMD EMD# was prepared by dissolving 0.7 ml of sterile EMD (30 mg/ml) in sterile Hank’s solution without calcium and magnesium to yield a 1 mg/ml stock solution. The solution was stored in the refrigerator for no longer than 3 weeks. To Examine CTGF Protein Expression by EMD Stimulation in ConcentrationDependent Experiment Cells were subcultured in 60 mm diameter plates at a density of 2.5 x 105 cells per plate. Upon reaching confluency, cells were serum starved for 24 h prior to treatment. Concentrationdependent experiments were first performed with 0, 25, 50 and 100 µg/ml EMD for 48 h. The cultures were then processed for Western Blot analysis. To Examine CTGF Protein Expression of EMD-Stimulated Cells With Anti-TGF-ß Antibody Based on results of the concentration-dependent experiment mentioned earlier, we next studied the effects of EMD and anti-TGF antibody on CTGF protein expression. Cells were treated with each of the following experimental mediums: (A) Serum-free DMEM. Cells treated in this medium serve as negative control. Out of this treatment group, half was subsequently treated with 5 µg/ml of monoclonal anti-TGF-ß1,ß2, ß3 antibody† for 48 h, while another half was not being treated. (B) Serum-free DMEM containing 100 µg/ml EMD. Cells treated in this medium serve to see the treatment effect of EMD. Similar to (A), half was subsequently treated with 5 µg/ml of monoclonal anti-TGF-ß1,ß2, ß3 antibody† for 48 h, while another half was not being treated. 3
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
(C) Serum-free DMEM containing 5 ng/ml human TGF-ß1‡. Cells treated in this medium serve as positive control. Subsequent treatment was also done in a similar way as mentioned previously in (A) and (B). Thereafter from treatment (A), (B) and (C), Western blot analysis was done. Western Blot Analysis For Western Blot analysis, cells were first harvested with cold lysis buffer comprising 1 % (vol/vol) Triton X-100, 50 mM Tris-Hydrochloride (Tris-HCl) (pH 7.4), 0.25 mM ethylenediaminetetracetic acid (EDTA), 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 µM antipain, leupeptin and pepstatin A each. Protein concentration was determined using Bradford method33 with a protein assay reagent**. Protein samples were resuspended in Laemmli buffer**.34 Protein extract (80 µg/lane) was separated by sodium dodecyl sulfate 12.5 % polyacrylamide gel electrophoresis (SDS-PAGE) and then blotted onto a blotting membrane††. The membranes were blocked with a blocking buffer‡‡ for 1 h at room temperature and then incubated overnight at 4 oC with blocking buffer containing rabbit polyclonal CTGF antibody§§ and mouse monoclonal extracellular signal-regulated kinase (ERK2) antibody|||| at a dilution of 1:2000 each. Anti-ERK2 antibody was used to confirm equal protein load. The next day, the membranes were washed thoroughly with washing buffer containing phosphate buffered saline (PBS) and 0.1 % Tween 20. Membranes were then incubated for 1 h at room temperature with blocking buffer containing fluorochrome-conjugated secondary antibodies, CY5.5 conjugated anti-mouse immunoglobulin G (IgG) and infra-red dye of conjugated anti-rabbit IgG¶¶, at a dilution of 1:2000 each. Proteins were visualized by using an infrared imaging system##. Protein sizes (CTGF: 38kDa, ERK-2: 44 kDa) were confirmed by comparison with protein molecular weight marker SDS-PAGE standards##. Relevant band intensities were quantified by densitometric analysis***. To Examine the Role of CTGF in PDL Cell Proliferation (DNA Synthesis) PDL cells were seeded onto 96-well plates§§§ at a density of 2.5 x 103 cells/well at 37 oC for 48 hours. Cells were then treated with each of the following experimental mediums: (a) 2% iFCS DMEM; (b) 2% iFCS DMEM containing 100 µg/ml EMD; (c) 2% iFCS DMEM containing 5 ng/ml human TGF-ß1. Half of each medium group was treated with 2.5 µg/ml anti-CTGF antibody|||||| and the other half was not being treated with the antibody. Nucleic acid synthesis was assessed by 5-Bromo-2’-Deoxyuridine Incorporation (BrdU) Proliferation Immunoassay¶¶¶ as described before.27,31 The assay is based on measuring BrdU Incorporation (2 h labeling time) in place of thymidine into newly synthesized deoxyribonucleic acid (DNA) of replicating cells by ELISA. Optical densities (OD) were measured using a microplate reader### at 405 nm. To Examine a Role of CTGF in Osteoblastic Differentiation of PDL Cells Cells were subcultured in 6-well plates**** at a density of 2 x 105 cells per well. Upon reaching confluency, cells were serum starved for 24 hours prior to treatment. Cells were then cultivated with each of the following experimental mediums, similar to those used for Western Blot analysis: (A) serum-free DMEM; (B) serum-free DMEM containing 100 µg/ml EMD; (C) serum-free DMEM containing 5 ng/ml human TGF-ß1. Half of each medium group was treated with 2.5 µg/ml anti-CTGF and the other half was left untreated. They were cultivated for 16 days 4
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
and from day 8 of culture, 5 mmol/l β-glycerophosphate was added. The cultures were then processed for RNA Extraction and Reverse Transcription-Polymerase Chain Reaction Analysis (RT-PCR). For the RT-PCR procedure, total RNA was isolated by using the RNeasy Mini Kit†††† and then reverse transcribed using avian myeloblastosis virus reverse transcriptase‡‡‡‡. Generated cDNA was amplified by RT-PCR using primers designed with computer software assistance§§§§ and synthesized accordingly||||||||. Their genetic sequences and the conditions needed are shown in Table 1. The genes examined were collagen type I, alkaline phosphatase (ALP) and osteocalcin (OC). In brief, collagen type I plays an important role in the formation of bone extra-cellular matrix. It is often considered as an early indicator of osteoblastic differentiation. ALP is a ubiquitous cellular protein. It is an important component in hard tissue formation, especially during the matrix maturation stage. OC is one of the few osteoblast specific genes and is one of the most abundant proteins present in bone. It is thought to play an important role in the later stage of osteoblastic differentiation and mineralization.35 Glyceraldehyde-3-phosphate (GAPDH) mRNA ensured equivalent DNA loading. The RT-PCR products were analyzed on 1.5 % agarose gels, stained with ethidium bromide. Fragment sizes were confirmed by comparison with a 1-kb DNA ladder molecular weight marker¶¶¶¶. The intensity of the bands on agarose gels resembling the RT-PCR products was then measured. Statistical Analysis Results were expressed as means ± SD. Data were analyzed by one-way ANOVA, using Bonferroni’s modification for post-hoc testing. Comparisons between 2 individual groups were made using 2-tailed unpaired Student’s t-test. A p < 0.05 was considered statistically significant.
Results Effect of EMD on CTGF Protein Levels The effect of EMD on CTGF protein expression in serum-free medium with and without various concentrations of EMD (0-100 µg/ml) stimulated for 48 h was examined by Western Blot analysis. A concentration-dependent increase of CTGF protein expression with a statistically significant increase of CTGF protein levels at 50 µg/ml EMD and 100 µg/ml EMD was found (Figure 1). Effect of Anti-TGF-ß Antibody on CTGF Expression To assess whether EMD-induced CTGF expression is modulated by TGF-ß, we examined the effects of anti-TGF-ß antibody on EMD-induced CTGF protein expression. Human PDL cells were incubated for 48 h with 100 µg/ml EMD or 5 ng/ml TGF-ß1, with and without 5 µg/ml anti-TGF-ß1,ß2,ß3 antibody. Untreated and TGF-ß1-treated groups serve as negative and positive controls respectively. Both EMD and TGF-ß1 groups exhibit a significant CTGF protein levels as compared to the untreated group (Figure 2). Unlike the untreated group, the antibody significantly inhibited EMD-induced CTGF protein production (2.5 fold versus 1.1 fold). Similarly, the addition of the 5
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
antibody clearly neutralized the effects of TGF-ß1 on CTGF expression (1.7 fold versus 0.1 fold). Effect of CTGF on PDL Cell Proliferation (DNA synthesis) Present data revealed an increase of CTGF protein by EMD in PDL cells. We next wished to examine the role of EMD- and TGF-ß1- induced CTGF expression on PDL DNA synthesis. A statistically significant increase of BrdU incorporation following treatment with 100 µg/ml EMD and TGF-ß1 compared to control was found (Figure 3). In contrast to the control group, the antiCTGF antibody statistically inhibited BrdU incorporation in both TGF-ß and EMD-treated groups. Effect of CTGF on mRNA Expression of Osteoblastic Differentiation in PDL Cells Besides studying cell proliferation, we next investigated the effects of CTGF inhibition on osteoblastic differentiation markers (Figure 4). With regards to collagen I and ALP mRNA expressions, change in mRNA expression was generally not obvious (Figure 4B and 4C), More obvious difference was noticed in OC mRNA expression, where the addition of anti-CTGF antibody showed more inhibition of OC expression in TGF- ß1 group and EMD groups. (Figure 4D). However in this experiment, we noticed that the change of mRNA level ratio was within a range of 0.8-1.2 compared to the untreated control. Although there were some significant differences between groups, such differences may not reflect the real clinical value. As such, we consider the results inconclusive.
DISCUSSION EMD has been shown to promote periodontal regeneration by inducing formation of PDL and alveolar bone.36,37 It has been suggested that EMD adsorbs to denuded root surfaces and periodontal bony defects and forms an insoluble scaffold complex, which promotes recolonization of periodontal cells, inducing periodontal regeneration.6,38 Besides providing a matrix for cell re-colonization, it is proposed that EMD induces the production and action of growth factors.6,39 TGF-ß1 plays an important role in the modulation of extracellular periodontal matrix formation and is postulated to be a potential candidate of mediating the effects of EMD.4,6-7,27,39-40 CTGF, a downstream mediator of TGF-ß11,22 is a crucial growth factor regulating cellular activities in fibrogenesis.23-24 In fact, it is believed that many of the properties of TGF-ß in fibrogenesis including fibroblastic cell growth, differentiation and expression of extracellular matrix proteins are CTGF-related.23 Therefore, the interactions between EMD and CTGF expression in human PDL cells were investigated in the present study. The presented data shows that EMD significantly up-regulates CTGF protein expression in primary human PDL cells. A concentration-dependent stimulation with maximal CTGF protein expression at EMD concentrations of 50-100 µg/ml was observed. These data are in accordance to previous results found in a human osteoblastic cell line (Saos-2) with a maximal CTGF expression at 50-100 µg/ml EMD.27 Studies have found that increasing EMD concentrations lead to increasing amounts of TGF-ß.5,9-10 In the present study, the addition of anti-TGF-ß1, ß2, ß3 antibody significantly lowered EMD-induced CTGF protein expression, which suggests that EMD-induced CTGF expression is mediated via TGF-ß pathway in PDL cells. 6
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
Similar to many studies,2,4,7,31 we found an increased DNA synthesis following EMD stimulation in PDL cells. We also found that TGF-ß1-induced DNA synthesis is inhibited by anti-CTGF antibody, indicating that CTGF plays a significant role in TGF-ß1 stimulatory effects in PDL cell proliferation. Studies have shown a stimulatory role of CTGF in fibroblastic cell proliferation and differentiation.11,23 It has been postulated that proliferative responses to TGF-ß can be induced by CTGF-dependent pathways in fibroblastic cells.23,41 We also found that the proliferative effect of EMD on PDL cells is significantly inhibited by anti-CTGF antibody. This indicates that the proliferative action of EMD on PDL cells may be directly affected via CTGFdependent pathways. Further studies are needed to study in greater detail, the association of CTGF and EMD on fibroblastic proliferation. Successful periodontal regeneration can be achieved by selective migration, proliferation and differentiation of cells from the periodontal ligament.29,42 PDL cells were shown to exhibit osteoblastic properties.28,42 The transition in the developmental sequence occurs when proliferation ceases and expression of genes related to the differentiated phenotype of osteoblasts is initiated. We chose a 16-day stimulation period for it would provide sufficient time for the gene expression of osteoblastic differentiated markers after the proliferative period. Collagen 1 is a marker of early differentiation or late proliferative stage.35 ALP represents the matrix maturation stage. It is postulated that the post-proliferative period is from day 12 onwards with the peak levels of ALP gene expression on day 16.35 OC has high affinity for bone mineral constituents and it plays a major role in bone mineralization during periodontal regeneration.3 It is an osteoblastic marker for late stage of maturation or mineralization stage. Studies indicate that the maximal expression of osteocalcin is found to be between day 16 to 20.43-44 Studies show that EMD affects genes related to mineralization and supports PDL cell differentiation towards an osteoblastic phenotype.2,4-5 EMD studies done on PDL cultures, showed controversial results on early markers such as type I collagen but stimulating effects on later markers of osteoblastic differentiation in PDL cells.2,45-48 CTGF studies done on osteoblasts have suggested that CTGF promotes the synthesis of markers of osteoblastic differentiation and mineralization such as type I collagen, ALP, OPN and OC.11,49-50 However, in our study on the effect of CTGF and EMD on osteoblastic mRNA expression in PDL cells, our results are inconclusive due to the narrow range of differences noticed between groups. This may be due to the heterogeneous nature of the PDL cells derived from fresh samples. There are 2 areas in this study that can be further refined: the cell type and the modification of biochemical pathway under study. Firstly, PDL has stromal stem cells that possess the multipotential to differentiate into various types of cells, such as fibroblasts, osteoblast-like cells, adipocytes and chondrocytes and neurocytes. These cells also have the unique potential to form cementum- and PDL-like tissues. However a small and varying number of such stem cells are usually present in PDL tissue. For the convenience and consistency of analyses, it would be better to use characterized immortalized PDL cell line instead of using primary PDL cultures from freshly extracted adult teeth to minimize the inclusion of other cell types, such as gingival cells. Secondly, CTGF has an established role in promoting fibrogenesis13, 14, 24 and its effects are TGF-related. Compared to its role in osteogenesis, there is more evidence to show that CTGF directs mesenchymal or stroma stem cells to differentiate into fibroblasts. Given the concrete evidence and clinical applications involving CTGF in fibrogensis, it would be useful to examine the role of CTGF in PDL, which is mostly a fibroblastic nature. This study provides us the first insight of the effects of CTGF in EMD- and TGF- ß1- stimulated PDL cells with regards to the 7
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
osteoblastic phenotype. More studies are needed to elucidate in greater detail of such interactions in PDL cells and the biochemical pathways involved.
CONCLUSION The present results showed that EMD stimulates CTGF expression in PDL cells and EMD affects CTGF expression via TGF-ß pathway. CTGF affects both EMD- and TGF-ß1- induced PDL cell proliferation but its effects on PDL towards osteoblastic differentiation remains inconclusive. Further studies are needed to study in greater detail, the association of CTGF and EMD on PDL development. ACKNOWLEDGEMENTS The authors wish to sincerely thank the following people: Dr. Andrew B.G. Tay (former Research Director of National Dental Centre [NDC], Singapore) for his kind and tremendous support for this project; and Mrs. Verena Kanitz (Dept. of Periodontology, Charite University Medicine of Berlin, Berlin, Germany) for her technical expertise. This work was financially supported by grants of the German Research Foundation (DFG) GK 325/2-00, Bonn, Germany and a habilitation grant from the Charite University Medicine of Berlin, awarded to A/Prof Nicole Pischon; as well as Singhealth Foundation Grant for Clinician Scientist, Singapore (SHF/FG336S/2007) awarded to Dr. Nora Heng; and the National Dental Centre of Singapore (NDCS) Research Fund. All involved in the study report no conflict of interest related to this study.
REFERENCES 1.
Hammarström L. The role of enamel matrix proteins in the development of cementum and periodontal tissues. Ciba Found Symp 1997;205:246-255.
2.
Gestrelius S, Andersson C, Lidström D, Hammarström L, Somerman M. In vitro studies on periodontal ligament cells and enamel matrix derivative. J Clin Periodontol 1997;24:685-692.
3.
Weishaupt P, Bernimoulin JP, Trackman P, Hägewald S. Stimulation of osteoblasts with Emdogain increases the expression of specific mineralization markers. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2008;106:304-308.
4.
Bosshardt DD. Biological mediators and periodontal regeneration: a review of enamel matrix proteins at the cellular and molecular levels. J Clin Periodontol 2008;35:87-105.
5.
Brett PM, Parkar M, Olsen I, Tonetti M. Expression profiling of periodontal ligament cells stimulated with enamel matrix proteins in vitro: a model for tissue regeneration. J Dent Res 2002;81:776-783.
6.
Lyngstadaas SP, Lundberg E, Ekdahl H, Andersson C, Gestrelius S. Autocrine growth factors in human periodontal ligament cells cultured on enamel matrix derivative. J Clin Periodontol 2001;28:181-188.
7.
Van der Pauw MT, Van den Bos T, Everts V, Beertsen W. Enamel matrix-derived protein stimulates attachment of periodontal ligament fibroblasts and enhances alkaline phosphatase activity and transforming growth factor β1 release of periodontal ligament and gingival fibroblasts. J Periodontol 2000;71:31-43.
8.
Parkar MH, Tonetti M. Gene expression profiles of periodontal ligament cells treated with enamel matrix proteins in vitro: analysis using cDNA arrays. J Periodontol 2004;75:1539-1546.
9.
Kawase T, Okuda K, Momose M, Kato Y, Yoshie H, Burns DM. Enamel matrix derivative (EMDOGAIN) rapidly stimulates phosphorylation of the MAP kinase family and nuclear accumulation of smad2 in both oral epithelial and fibroblastic human cells. J Periodontal Res 2001;36:367-376.
10. Suzuki S, Nagano T, Yamakoshi Y, et al. Enamel matrix derivative gel stimulates signal transduction of BMP and TGF-beta. J Dent Res 2005;84:510-514. 11. Moussad EE, Brigstock DR. Connective tissue growth factor: what's in a name? Mol Genet Metab 2000;71:276292.
8
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
12. Takigawa M, Nakanishi T, Kubota S, Nishida T. The role of CTGF/ Hcs24/ecogenin in skeletal growth control. J Cell Physiol 2003;194:256-266. 13. Frazier KS, Williams S, Kothepelli D, Klapper H, Groendorst GR. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J Invest Dermatol 1996;107:404-411. 14. Igarashi A, Nashiro K, Kikuchi K, et al. Connective tissue growth factor gene expression in tissue sections from localized scleroderma, keloid, and other fibrotic skin disorders. J Invest Dermatol 1996;106:729-733. 15. Shimo T, Wu , Billings PC, et al. Expression, gene regulation, and roles of Fisp12/ CTGF in developing tooth germs. Dev Dyn 2002;224:267-278. 16. Yamaai T, Nakanishi T, Asano M, et al. Gene expression of connective tissue growth factor (CTGF/CCN2) in calcifying tissue of normal and cbfa1-null mutant mice in late stage of embryonic development. J Bone Miner Metab 2005;23:280-288. 17. Yamashiro T, Fukunaga T, Kobashi N, et al. Mechanical stimulation induces CTGF expression in rat osteocytes. J Dent Res 2001;80:461-465. 18. Bonewald LF, Dallas SL. Role of active and latent transforming growth factor beta in bone formation. J Cell Biochem 1994;55:350-357. 19. Centrella M, Horowitz MC, Wozney JM, McCarthy TL. Transforming growth factor-beta gene family members and bone. Endocr Rev 1994;15:27-39. 20. McCartney-Francis NL, Frazier-Jessen M, Wahl SM. TGF-beta: a balancing act. Int Rev Immunol 1998;16:553580. 21. Massagu J. TGF-beta signal transduction. Annu Rev Biochem 1998;67:753-791. 22. Grotendorst GR, Okochi H, Hayashi N. A novel transforming growth factor beta response element controls the expression of the connective tissue growth factor gene. Cell Growth Differ 1996;7:469-480. 23. Grotendorst GR. Connective tissue growth factor: a mediator of TGF-beta action on fibroblasts. Cytokine Growth Factor Rev 1997;8:171-179. 24. Leask A, Holmes A, Abraham DJ. Connective tissue growth factor: a new and important player in the pathogenesis of fibrosis. Curr Rheumatol Rep 2002;4:136-142. 25. Duncan MR, Frazier KS, Abramson S, et al. Connective tissue growth factor mediates transforming growth factor beta-induced collagen synthesis: down-regulation by cAMP. FASEB J 1999;13:1774-1786. 26. Kothapalli D, Frazier KS, Welply A, Segarini PR, Grotendorst GR. Transforming growth factor beta induces anchorage-independent growth of NRK fibroblasts via a connective tissue growth factor-dependent signaling pathway. Cell Growth Differ 1997;8:61-68. 27. Heng NH, N'Guessan PD, Kleber BM, Bernimoulin JP, Pischon N. Enamel matrix derivative induces connective tissue growth factor expression in human osteoblastic cells. J Periodontol 2007;78:2369-2379. 28. Somerman MJ, Foster RA, Imm GM, Sauk JJ, Archer SY. Periodontal ligament cells and gingival fibroblasts respond differently to attachment factors in vitro. J Periodontol 1989;60:73-77. 29. Melcher AH. Role of the periosteum in repair of wounds of the parietal bone of the rat. Arch Oral Biol 1969;14:1101-1109. 30. Zentrale Ethikkommission bei der Bundeszahnärztekammer. The use of human body materials for purposes of medical research. Available at http://www.zentrale-ethikkommission.de/page.asp?his=0.1.22. Accessed October 16, 2012. 31. Pischon N, Zimmermann B, Bernimoulin JP, Hägewald S. Effects of an enamel matrix derivative on human osteoblasts and PDL cells grown in organoid cultures. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006;102:551-557.
9
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
32. Somerman MJ, Archer SY, Imm GR, Foster RA. A comparative study of human periodontal ligament cells and gingival fibroblasts in vitro. J Dent Res 1988;67:66-70. 33. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248-254. 34. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680-685. 35. Lian JB, Stein GS. Development of the osteoblast phenotype: molecular mechanisms mediating osteoblast growth and differentiation. Iowa Orthop J 1995;15:118-140. 36. Sculean A, Alessandri R, Miron RJ, Salvi G, Bosshard DD. Enamel matrix proteins and periodontal wound healing and regeneration. Clin Adv Periodontics 2011;1:101-117. 37. Gkranias ND, Graziani F, Sculean A, Donos N. Wound healing following regenerative procedures in furcation degree III defects: histomorphometric outcomes. Clin Oral Investig 2012; 6:239-249. 38. Heijl L. Periodontal regeneration with enamel matrix derivative in one human experimental defect. A case report. J Clin Periodontol 1997;24:693-696. 39. Kawase T, Okuda K, Yoshie H, Burns DM. Anti-TGF-beta antibody blocks enamel matrix derivative-induced upregulation of p21WAF1/cip1 and prevents its inhibition of human oral epithelial cell proliferation. J Periodontal Res 2002;37:255-262. 40. Miron RJ, Bosshardt DD, Zhang Y, Buser D, Sculean A. Gene array of primary human osteoblasts exposed to enamel matrix derivative in combination with a natural bone mineral. Clin Oral Investig [serial online]. May 3, 2012. Accessed September 18, 2012. 41. Kothapalli D, Frazier KS, Welply A, Segarini PR, Grotendorst GR. Transforming growth factor beta induces anchorage-independent growth of NRK fibroblasts via a connective tissue growth factor-dependent signaling pathway. Cell Growth Differ 1997;8:61-68. 42. Nagatomo K, Komaki M, Sekiya I, et al. Stem cell properties of human periodontal ligament cells. J Periodontal Res 2006;41:303-310. 43. Thomas GP, Baker SUK, Eisman JA, Gardiner EM. Changing RANKL/OPG mRNA expression in differentiating murine primary osteoblasts. J Endocinol 2001;170:451-460. 44. Stein GS, Lian JB. Molecular mechanisms mediating proliferation/differentiation interrelationships during progressive development of the osteoblast phenotype. Endocr Rev 1993;14:424–442. 45. Palioto DB, Coletta RD, Graner E, Joly JC, de Lima AF. The influence of enamel matrix derivative associated with insulin-like growth factor-I on periodontal ligament fibroblasts. J Periodontol 2004;75:498-504. 46. Hägewald S, Pischon N, Jawor P, Bernimoulin JP, Zimmermann B. Effects of enamel matrix derivative on proliferation and differentiation of primary osteoblasts. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;98:243-249. 47. Nagano T, Iwata T, Ogata Y, et al. Effect of heat treatment on bioactivities of enamel matrix derivatives in human periodontal ligament (HPDL) cells. J Periodontal Res 2004;39:249-256. 48. Rincon JC, Haase HR, Bartold PM. Effect of Emdogain on human periodontal fibroblasts in an in vitro woundhealing model. J Periodontal Res 2003;38:290-295. 49. Safadi FF, Xu J, Smock SL, et al. Expression of connective tissue growth factor in bone: its role in osteoblast proliferation and differentiation in vitro and bone formation in vivo. J Cell Physiol 2003;196:51-62. 50. Nishida T, Nakanishi T, Asano M, Shimo T, Takigawa M. Effects of CTGF/Hcs24, a hypertrophic chondrocyte-specific gene product, on the proliferation and differentiation of osteoblastic cells in vitro. J Cell Physiol 2000;184:197-206.
10
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
Correspondence: Dr. Nora Heng, National Dental Centre Singapore, 5 Second Hospital Avenue, 168938 Singapore, Tel. +65 97703996, Fax +65 63248900, Email: [email protected] Submitted July 07, 2012; accepted for publication November 05, 2014. Figure 1. Concentration-dependent stimulation of CTGF protein expression by EMD Cells were incubated in serum free media containing EMD for 48 h. A) One representative blot of four experiments is shown. ERK 2 (44kDa) served as loading control. CTGF (38 kDa) protein amount was normalized to the amount of ERK 2. B) The graph shown is the ratio of treated cultures compared to untreated control (relative expression=1). *p < 0.05, compared to untreated control. Figure 2. Inhibition of EMD-stimulated CTGF protein expressions by anti-TGF-ß antibody Cells were incubated in serum free media, with EMD or TGF-ß1, with and without anti-TGF-ß antibody for 48 h. Cells treated in untreated medium and medium with TGF-ß1 serve as negative and positive controls respectively. A) One representative blot from four experiments is shown. The CTGF levels were normalized to the amount of ERK2 and the ratio of treated cultures to untreated control were compared. B) The graph shown is the ratio of treated cultures to untreated control (relative expression = 1). *p < 0.05 compared to untreated control. **p < 0.05 with and without antibody. Figure 3. Effects of CTGF on EMD-induced BrdU incorporation. Cells were incubated in 2 % iFCS-containing media for 48 h with EMD or TGF-ß1, with and without anti-CTGF antibody. Cells treated in untreated medium and medium with TGF-ß1 serve as negative and positive controls respectively. Data shown represents the mean ± SD of four independent experiments. *p < 0.05 compared to untreated control. **p < 0.05 with and without antibody. Figure 4. Effects of CTGF on mRNA expression of genes related to the differentiated phenotype of PDL cells Cells were incubated in 2 % iFCS-containing media, with EMD or TGF-ß1, with and without anti-CTGF antibody for 16 days. Gene expression was analyzed by RT-PCR. Cells treated in untreated medium and medium with TGFß1 serve as negative and positive controls respectively. (A) One representative gel of each gene of 3 blots is shown. (B to D) Graphs represent the mean ± SD of three independent experiments of each gene. Table 1. Primer sequences Primer Name
Sequence sense Sequence antisense CCCAAGGACAAGAGGCAT
Collagen I
GCAGTGGTAGGTGATGTTCTG AGAAAGAGAAAGACCCCAAGTA
ALP
TTCACCCCACACAGGTAG AGCGAGGTAGTGAAGAGACCC
Osteocalcin
CCTGGAGAGGAGCAGAACTG
11
PCR fragment length
Temp oC
Cycles
159
60
28
300
58
36
228
65
36
Journal of Periodontology; Copyright 2015
DOI: 10.1902/jop.2015.120448
ACCCAGAAGACTGTGGATGG GADPH
TGTGAGGGAGATGCTCAGTG
279
60
26
Grant support: Grant of the German Research Foundation (DFG) GK 325/2-00 and Habilitation grant of the Charite University Medicine of Berlin, Berlin, Germany to Dr. Nicole Pischon; Singhealth Foundation Grant for Clinician Scientist SHF/FG336S/2007 to Dr. Nora Heng and National Dental Centre of Singapore (NDCS) Research Fund. Key finding(s): EMD stimulates CTGF expression in PDL cells and CTGF affects EMD- and TGF-ß1- induced PDL cell proliferation. || Biochrom AG, Berlin, Germany. ¶ Biochrom AG, Berlin, Germany. # Emdogain, Straumann, Waldenburg, Switzerland. † R&D Systems, Minneapolis, US. ‡ Austral Biologicals, San Ramon, California, USA. ** Bio-Rad, Hercules, California, USA. †† Hybond-ECL, Amersham, Dreieich, Germany. ‡‡ Odyssey LICOR Inc., Bad Hamburg, Germany. §§ Abcam, Cambridge, UK. |||| Santa Cruz Biotechnologies, Santa Cruz, California, USA. ¶¶ Rockland Immunochemicals, Gilbertsville, Pennsylvania, USA. ## Bio-Rad, Hercules, California, USA. *** Odyssey LICOR Inc., Bad Hamburg, Germany. §§§ Nunc, Roskilde, Denmark. |||||| Abcam, Cambridge, UK. ¶¶¶ Roche, Basel, Switzerland ### Bio-Rad, Hercules, California, USA. **** Nunc, Roskilde, Denmark. †††† Qiagen, West Sussex, UK. ‡‡‡‡ Promega, Madison, Wisconsin, USA. §§§§ Primer 3, Whitehead Institute for Biomedical Research, Cambridge, Massachusetts, USA |||||||| TIB MOLBIOL, Berlin, Germany. ¶¶¶¶ Life Technologies, Darmstadt, Germany.
12
13
14
15
16
