J. vet. Pharmacol. Therap. 37, 406--412. doi: 10.1111/jvp.12109.
Effects of dietary sodium butyrate on hepatic biotransformation and pharmacokinetics of erythromycin in chickens G. CSIK O* G. NAGY* † G. M ATIS † Z. NEOGR ADY † A. KULCS AR
JERZSELE* A. K. SZEK ER* & P. G ALFI* *Department of Pharmacology and Toxicology, Faculty of Veterinary Science, Szent Istvan University, Budapest, Hungary; † Department of Physiology and Biochemistry, Faculty of Veterinary Science, Szent Istvan University, Budapest, Hungary
Szeker, Csik o, G., Nagy, G., M atis, G., Neogr ady, Z., Kulcs ar, A., Jerzsele, A., K., G alfi, P. Effects of dietary sodium butyrate on hepatic biotransformation and pharmacokinetics of erythromycin in chickens. J. vet. Pharmacol. Therap. 37, 406–412. Butyrate, a commonly applied feed additive in poultry nutrition, can modify the expression of certain genes, including those encoding cytochrome P450 (CYP) enzymes. In comparative in vitro and in vivo experiments, the effect of butyrate on hepatic CYP genes was examined in primary cultures of chicken hepatocytes and in liver samples of chickens collected from animals that had been given butyrate as a feed additive. Moreover, the effect of butyrate on the biotransformation of erythromycin, a marker substance for the activity of enzymes of the CYP3A family, was investigated in vitro and in vivo. Butyrate increased the expression of the avian-specific CYP2H1 both in vitro and in vivo. In contrast, the avian CYP3A37 expression was decreased in hepatocytes following butyrate exposure, but not in the in vivo model. CYP1A was suppressed by butyrate in the in vitro experiments, and overexpressed in vivo in butyrate-fed animals. The concomitant incubation of hepatocytes with butyrate and erythromycin led to an increased CYP2H1 expression and a less pronounced inhibition of CYP3A37. In in vivo pharmacokinetic experiments, butyrate-fed animals given a single i.m. injection of erythromycin, a slower absorption phase (longer Thalf-abs and delayed Tmax) but a rapid elimination phase of this marker substrate was observed. Although these measurable differences were detected in the pharmacokinetics of erythromycin, it is unlikely that a concomitant application of sodium butyrate with erythromycin or other CYP substrates will cause clinically significant feed-drug interaction in chickens. (Paper received 1 July 2013; accepted for publication 12 January 2014) Gy€orgy Csiko, Department of Pharmacology and Toxicology, Faculty of Veterinary Science, Szent Istvan University, Istvan utca 2, Budapest H-1078, Hungary. E-mail: [email protected]
INTRODUCTION The short-chain fatty acid (n-)butyrate is produced in high quantities by microbial fermentation of carbohydrates in the forestomachs of ruminants and in the large intestine of monogastric mammals and birds. As butyrate has a selective antimicrobial effect on most enteral pathogens, it plays a critical role in maintaining gut health by improving the balance of the intestinal microflora (van Immerseel et al., 2005; Fern andez-Rubio et al., 2008). In addition, it serves as a predominant energy source for the gastrointestinal epithelial cells as a substrate for oxidative pathways. Butyrate is a potent regulator of the cell cycle as well, influencing proliferation and differentiation of the epithelium in the gastrointestinal tract (G alfi & Neogr ady, 2001). Due to these beneficial actions, butyrate can 406
increase daily weight gain and is commonly applied (mainly as its sodium salt) as a nutritional supplement in the poultry and pig operations (Le Gall et al., 2009; Zhang et al., 2011). The application of butyrate is of special interest because of the ban of antibiotics as growth promoters within the European Union. Butyrate is intensively metabolized by intestinal epithelial cells (Vel azquez et al., 1997), but the absorbed amount can be considered as a remarkable butyrate supply for the liver. It serves the oxidative metabolism of hepatocytes. In turn, it might also influence hepatic metabolic processes as an effector molecule (Beauvieux et al., 2001), being involved in the regulation and inhibition of histone deacetylase (HDAC). HDAC is an epigenetic regulator of gene expression and determines among others the expression and activity of certain hepatic microsomal cytochrome P450 (CYP) monooxygenases, playing © 2014 John Wiley & Sons Ltd
Effect of dietary butyrate on erythromycin kinetics in chickens 407
an important role in the biotransformation of xenobiotics and drugs as well as in steroid metabolism. On the basis of these findings, we hypothesized that butyrate may also alter the expression of CYP enzymes in poultry, having an impact on drug metabolism in hepatocytes. An altered metabolism may influence the efficacy and toxicity of drugs, as well as the duration of the withdrawal period in food-producing animals. Little data are available on the effect of drugs on CYP enzymes in avian species. In chickens, the CYP1A subfamily consists of different isoenzymes, for example 1A4 and 1A5. CYP1A gene expression is induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and polycyclic aromatic hydrocarbons (PAH). The chicken CYP3A37 gene is considered to be ortholog to the human CYP3A4 (Ourlin et al., 2000). CYP3A isoforms play a pivotal role in the metabolism of about 50% of all therapeutics in human medicine including various antimicrobials, sedatives, dysrhythmics, calcium channel antagonists and protease inhibitors and antihistamines (Zhang et al., 2010). Genes of the CYP2H1 (homolog to rodent CYP2B) and CYP3A enzymes can be induced not only by phenobarbital but also by dexamethasone (Handschin & Meyer, 2003). The aim of this study was to examine the effect of butyrate on the gene expression of selected drug-metabolizing enzymes such as CYP1A, CYP2H1, and CYP3A37 in primary cultures of chicken hepatocytes. These enzymes are regarded as major drug-metabolizing enzymes in chickens (Goriya et al., 2005; Zhang et al., 2010). The second goal of the study was to evaluate the possible metabolic interaction between butyrate and erythromycin. This macrolide antibiotic is intensively metabolized in the liver, mostly by the CYP3A subfamily (Yamazaki et al., 1996) and serves as a marker substrate to quantify enzyme activity. MATERIALS AND METHODS Chemicals Chemicals were purchased from Sigma-Aldrich (Munich, Germany), except when otherwise specified. Sodium butyrate (No 303410, purity: 98%, molecular weight: 110.09) and erythromycin (No E5389, potency: >850 lg/mg, molecular weight: 733.93) were purchased from Sigma-Aldrich. For cell culture studies, sodium butyrate was dissolved in phosphatebuffered saline (PBS) and sterilized by filtration; the concentration of the stock solution was 2 M. The applied butyrate concentrations were collected from the stock solution by multistep dilution with the culture medium. Similarly, 73.4 mg of erythromycin was dissolved in 10 mL DMSO to prepare a stock solution, which was sterilized by filtration and finally diluted to the required concentrations. In vitro experiments Isolation and culture of chicken hepatocytes. Three male, clinically healthy broiler chickens of the Ross 308 strain, collected from © 2014 John Wiley & Sons Ltd
a commercial hatchery, were housed and fed ad libitum according to the requirements of the Ross (2009) technology. At the age of 7 weeks, animals were anesthetized by intramuscular application (into the pectoral muscle) of a combination of xylazine (10 mg/kgBW), zolazepam (50 mg/ kgBW), and tiletamine (50 mg/kgBW). The hepatic portal system was cannulated via the pancreaticoduodenal vein, and the liver was exsanguinated using 200 mL EGTA-free Hanks buffer. The perfusion was continued with 200 mL Hanks buffer containing 0.5 mM EGTA and then again with 200 mL of the same buffer solution as in the first step. Finally, 150 mL EGTA-free Hanks buffer, supplemented with 100 mg of collagenase Type IV, 7 mM MgCl2 and 7 mM CaCl2, was applied and recirculated to disintegrate the hepatocytes. All solutions applied for perfusion were prewarmed at 40 °C and oxygenated previously with Carbogen (95% O2, 5% CO2, 1 L/min, purchased from Linde Gas, Repcelak, Hungary). The velocity of the perfusion was set at 30 mL/min. After digestion with collagenase, the liver was excised, the capsule was disrupted and the digested parenchyma was filtered through a nylon mesh with 100-lm pore size (Millipore, Volketswil, Switzerland) to eliminate cell aggregates and adherent tissue residues. Hepatocyte-enriched fractions were isolated and washed by low-speed centrifugation (50 g, 3 min), first in BSA (2.5%) containing Hanks buffer and then twice in Williams’ Medium E, supplemented previously with 50 mg/L gentamicin, 2 mM glutamine, 5% fetal bovine serum (FBS), 4 lg/L dexamethasone, 20 IU/L insulin, and 0.22% sodium bicarbonate. Cell viability was assessed by the trypan blue exclusion test and it consistently exceeded 90% in all isolations. The yield of hepatocytes was determined by cell counting in a B€ urker chamber, and cell concentration was adjusted to 106/mL. Hepatocytes (1.5 mL cell suspension/well) were seeded on 6-well Costar TC cell culture dishes (well diameter: 34.8 mm; Corning International, Corning, NY, USA), previously coated by collagen Type I (10 lg/cm2) according to the manufacturer’s instructions. Cell cultures were incubated at 37 °C in a humid atmosphere with 10% CO2. The culture medium was changed for the first time 4 h after plating. A confluent monolayer of hepatocytes was gained after 24 h of incubation. After one-day cultivation, cells were treated for 24 h according to the following protocol: cell culture media (without FBS) contained six different concentrations of sodium butyrate (0, 1, 2.5, 5, 7.5, 10 mM), and each butyrate concentration was combined with the following concentrations of erythromycin: 0, 10, 50, and 100 lM, respectively. Butyrate and erythromycin concentrations were chosen by taking the concentrations most commonly applied in cell culture studies (G alfi & Neogr ady, 2001; Domokos et al., 2010). Hepatocytes originating from three different chickens were treated according to this protocol, and each incubation was conducted in triplo. RNA extraction. Total RNA was isolated from control and butyrate-treated cells (106 cells/well with 34.8 mm diameter) using a protocol based on TRIzol reagent (Invitrogen, Paisley,
408 G. Csiko et al.
UK) according to the manufacturer’s instructions with slight modifications. Shortly, cells grown in monolayer were lyzed directly in the culture dish by adding the TRIzol reagent (1 mL/well) and passing the cell lysate through a pipette several times. The cell lysate was transferred immediately to microfuge tubes and was incubated at 4 °C for 5 min. Next, 200 lL ice-cold chloroform (Reanal, Budapest, Hungary) per 1 mL of TRIzol reagent was added to each sample, which was shaken vigorously for 15 sec and placed on ice at 4 °C for 5 min. The homogenate was centrifuged at 12 000 g (4 °C) for 15 min, and the upper, aqueous phase was transferred to a fresh microfuge tube, and then, the chloroform extraction step was repeated once again. In the next step, equal volume (400 lL) of ice-cold isopropanol (Merck, Darmstadt, Germany) was added to the aqueous phase. The sample was stored for 1 h at 80 °C and then centrifuged at 12 000 g (4 °C) for 10 min. The supernatant was removed, and RNA pellet was washed twice with 75% ice-cold ethanol [1 mL of 75% ethanol (Merck)/1 mL initial solution used] by vortexing and subsequent centrifugation for 5 min at 7500 g (4 °C). Finally, the pellet was dried under a laminar box for 10–15 min, and then dissolved in 50 lL molecular biology grade water (Eppendorf, Hamburg, Germany). The integrity of the extracted RNA was checked by electrophoresis in 1% agarose gel containing 1 lg/mL ethidium bromide (Fluka, Buchs, Switzerland). Two microliter of the RNA sample was mixed with 3 lL loading dye and was electrophoresed at constant voltage 80 V for 25 min in 19 TBE buffer. The resulting bands were visualized and scanned by the InGenius LHR Gel Documentation and Analysis System (Syngene, Cambridge, UK). Quantity and purity of the RNA samples were determined using a NanoDrop ND-1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA).
cytochrome P450 1A (CYP1A), cytochrome P450 2H1 (CYP2H1), and cytochrome P-450 3A37 (CYP3A37). As a reference (housekeeping) gene b-actin was selected. Primer oligonucleotides were designed by Primer3 software (http:// frodo.wi.mit.edu/) and were purchased from Sigma-Aldrich. Primer sequences are listed in Table 1. For each PCR, 2.5 lL cDNA was added directly to a PCR mixture set to a final volume of 25 lL, containing 19 concentrated iQ SYBR Green Supermix and 0.2 lM of the appropriate primers. The thermal profile for all reactions was 2 min at 95 °C, then 30 cycles of 10 sec at 95 °C, 20 sec at 56 °C, and 10 sec at 72 °C. The fluorescence monitoring was performed at the end of each cycle for 10 sec. Each reaction was completed with a melting curve analysis to ensure the specificity of the reaction. The PCR amplicons were separated by electrophoresis through a 1.5% agarose gel at a constant voltage 60 V for 35 min in 19 TBE buffer. The resulting bands were visualized and scanned by the InGenius LHR Gel Documentation and Analysis System and quantified by the GeneTools Software (Syngene). The relative expression ratio for CYP1A, CYP2H1, and CYP3A37 was determined by the relative expression software tool (REST) (Pfaffl et al., 2002) available at http://www. gene-quantification.de/rest.html. Relative gene expression of target genes was calculated by REST, using the formula R ¼ ðE ÞDCPtarget ðsamplecontrolÞ =ðE ÞDCPref ðsamplecontrolÞ ,
Reverse transcription. Prior to the synthesis of the first strand of cDNA, the RNA samples were treated with deoxyribonuclease I (DNase I) to remove double- and single-stranded DNA. After DNase I treatment, reverse transcription of 4 lL total RNA (approx. 500 ng) was achieved using a RevertAid H Minus First Strand cDNA Synthesis kit (Fermentas, St. Leon-Roth, Germany) according to the manufacturer’s instructions, using the random hexamer as a priming method. In brief, 4 lL of RNA was mixed with 1 lL of random hexamer and 7 lL of molecular biology grade water, and then incubated at 70 °C for 5 min. Four microliter of 59 reaction buffer, 1 lL of RiboLock RNase Inhibitor and 2 lL of dNTP mix were mixed in a separate microfuge tube then added to the RNA and incubated at 25 °C for 5 min. Finally, 1 lL of reverse transcriptase was added to the reaction. The thermal profile for reverse transcription was 25 °C for 10 min, then 42 °C for 1 h, and 70 °C for 10 min.
Animals and feeding. Twenty one-day-old broiler chicks of the Ross 308 strain (mixed gender), collected from a commercial hatchery (B abolna Tetra Company, Urai ujfalu, Hungary), were included in the experiment. Broilers were kept together in metal pens (five birds per pen) with a floor area of 1.5 m2. The light programme and the climatic circumstances were adjusted according to the requirements of the Ross technology (Ross, 2009). Birds were fed with a normal stock diet, free from any medications or chemical additives, with or without sodium butyrate supplementation (1.5 g/kg diet), n = 10/group. Feed and drinking water were provided ad libitum. The applied concentration of sodium butyrate was chosen regarding the most commonly administered dose of sodium butyrate as a feed additive in poultry nutrition (Hu & Guo, 2007).
Quantitative real-time PCR. Quantitative real-time PCR (qPCR) was performed using the iQ SYBR Green Supermix kit (BioRad, Hercules, CA, USA) on the MiniOpticon System (BioRad). The cDNA was diluted twofold before equal amounts were added to duplicate qPCRs . The tested genes of interest were the avian
target
ref
where R represents the relative gene expression ratio of the target gene, E stands for PCR efficiency, DCP is the crossing point difference of a sample vs. an untreated control, and ref represents the reference gene b-actin. PCR efficiency was calculated by the following formula: E = 10(1/s)–1, where s is the slope of the standard curve. In vivo experiments
Liver sampling. After 3 weeks of the feeding period, the coelom was aseptically opened in general anesthesia as described before, and the liver was exsanguinated with chilled physiological saline solution through the portal vein. The organ was removed and a 1-g piece per chick was cut and lyzed in 1 mL TRIzol reagent (Invitrogen, Paisley, UK) for further PCR examinations on CYP gene expression. © 2014 John Wiley & Sons Ltd
Effect of dietary butyrate on erythromycin kinetics in chickens 409 Table 1. Sequences of primers Gene
Accession number
Sequence (5′–3′)
Efficiency
Length (bp)
Forward: CCGTGACAACCGCCCTGTCC Reverse: AGCCGTGGTCTCCTCTCCCG
0.912
115
CYP2H1
NM_205146.1 (CYP1A1) NM_205147.1 (CYP1A4) X99454.1 (CYP1A5) NM_001001616.1
0.921
206
CYP3A37
NM_001001751.1
0.826
160
b-actin
NM_205518.1
Forward: ACAACCAGCACCACACTGAG Reverse: GCATGTGGAACATTAAGGGG Forward: TGGTTACCTGGCTTACCAGC Reverse: ATAGAGCCGGAGGGTTTCAT Forward: GTCCACCTTCCAGCAGATGT Reverse: ATAAAGCCATGCCAATCTCG
0.956
169
CYP1A*
*CYP1A primers recognize gene sequences of CYP1A1, CYP1A4, and CYP1A5.
Investigations on CYP gene expression. The expression of hepatic CYP1A, CYP2H, and CYP3A37 genes was assayed by qRT PCR. RNA isolation, reverse transcription, and qRT PCR examination were conducted as described previously in the in vitro trials. Effect of butyrate on pharmacokinetics of erythromycin in chickens Animals and feeding. Twenty broiler chickens of the same strain were housed and fed, randomized into two groups, with or without sodium butyrate supplementation (1.5 g/kg diet), as described previously. At the end of the 6-week-long feeding period, chickens were treated with a single intramuscular (i.m.) dose (30 mg/kgBW, pectoral muscle) of erythromycin (Gallimycinâ; Ceva, Libourne, France) injection. As the aim of the study was to evaluate the metabolic interaction of orally applied butyrate with concomitantly administered drugs, and feed additives may interact with oral drug utilization (Kanzawa et al., 2001), parenteral (i.m.) erythromycin application was chosen. Blood samples were collected at 0.0, 0.5, 1, 1.5, 2, 3, 4, 8, and 12 h after the injection. Samples were taken by puncture of the brachial vein and collected in test tubes containing heparin as anticoagulant. Plasma samples were separated from whole blood by centrifugation (1300 g; 10 min; GR412; Jouan; Thermo Fisher Scientific, Hudson, NH, USA) and stored at –80 °C until analysis. Erythromycin determination. Plasma levels of erythromycin were determined by validated high-performance liquid chromatography (HPLC) using a sample derivatization method on a Merck-Hitachi LaCrom Elite HPLC system combined with a Nucleosil C18 5 lm, 25 9 0.46 column. Before extracting 0.2 mL of plasma sample with 4 mL dichloromethane (Merck, Darmstadt, Germany), first 600 lL 0.1 M Na2HPO4 solution was added, the pH was adjusted (8.8–9.3), and the sample was mixed using a vortex mixer twice for one minute each. Then, the dichloromethane phase was evaporated to dryness with RotaDest at 40–45 °C. The dry substance was redissolved with 200 lL acetonitrile by ultrasonication and vortex mixing. In the derivatization procedure, to each 200 lL sample, 125 lL 0.1 M phosphate buffer [0.8709 g K2HPO4 (Merck) per 50 mL UPW, H = 7.5] and 125 lL 10 mg/mL 9-fluorenylmethyl chloroformate (Merck) were added and mixed with a vortex © 2014 John Wiley & Sons Ltd
mixer. The reaction was performed at 50 °C for 60 min, and then, the samples were cooled to room temperature. Finally, 150 lL of diluting solvent (50/50 acetonitrile/0.03 M phosphate buffer pH = 7.0) was added to each sample. The injection volume was 50 lL. The mobile phase contained 70 (V/V)% acetonitrile (Merck) and 30 (V/V)% 0.03 M K2HPO4 (Merck)-based phosphate buffer (pH = 7.0). The flow rate was constant, 1 mL/min. UV detection method was applied with an excitation wavelength of 260 nm and an emission wavelength of 315 nm. The limit of quantification of the method was 0.002 lg/mL, and the linearity range was from 0.002 to 5 lg/mL. Intraassay and interassay coefficients of variation were 3% and 3.5%, respectively, at a concentration of 0.004 lg/mL and 2.3% and 3.1%, respectively, at a concentration of 2.5 lg/mL. Statistical analysis and calculation of pharmacokinetic parameters. Statistical analysis was performed by R-2.14.1 software. Differences were considered significant if the P-value was
Effects of dietary sodium butyrate on hepatic biotransformation and pharmacokinetics of erythromycin in chickens G. CSIK O* G. NAGY* † G. M ATIS † Z. NEOGR ADY † A. KULCS AR
JERZSELE* A. K. SZEK ER* & P. G ALFI* *Department of Pharmacology and Toxicology, Faculty of Veterinary Science, Szent Istvan University, Budapest, Hungary; † Department of Physiology and Biochemistry, Faculty of Veterinary Science, Szent Istvan University, Budapest, Hungary
Szeker, Csik o, G., Nagy, G., M atis, G., Neogr ady, Z., Kulcs ar, A., Jerzsele, A., K., G alfi, P. Effects of dietary sodium butyrate on hepatic biotransformation and pharmacokinetics of erythromycin in chickens. J. vet. Pharmacol. Therap. 37, 406–412. Butyrate, a commonly applied feed additive in poultry nutrition, can modify the expression of certain genes, including those encoding cytochrome P450 (CYP) enzymes. In comparative in vitro and in vivo experiments, the effect of butyrate on hepatic CYP genes was examined in primary cultures of chicken hepatocytes and in liver samples of chickens collected from animals that had been given butyrate as a feed additive. Moreover, the effect of butyrate on the biotransformation of erythromycin, a marker substance for the activity of enzymes of the CYP3A family, was investigated in vitro and in vivo. Butyrate increased the expression of the avian-specific CYP2H1 both in vitro and in vivo. In contrast, the avian CYP3A37 expression was decreased in hepatocytes following butyrate exposure, but not in the in vivo model. CYP1A was suppressed by butyrate in the in vitro experiments, and overexpressed in vivo in butyrate-fed animals. The concomitant incubation of hepatocytes with butyrate and erythromycin led to an increased CYP2H1 expression and a less pronounced inhibition of CYP3A37. In in vivo pharmacokinetic experiments, butyrate-fed animals given a single i.m. injection of erythromycin, a slower absorption phase (longer Thalf-abs and delayed Tmax) but a rapid elimination phase of this marker substrate was observed. Although these measurable differences were detected in the pharmacokinetics of erythromycin, it is unlikely that a concomitant application of sodium butyrate with erythromycin or other CYP substrates will cause clinically significant feed-drug interaction in chickens. (Paper received 1 July 2013; accepted for publication 12 January 2014) Gy€orgy Csiko, Department of Pharmacology and Toxicology, Faculty of Veterinary Science, Szent Istvan University, Istvan utca 2, Budapest H-1078, Hungary. E-mail: [email protected]
INTRODUCTION The short-chain fatty acid (n-)butyrate is produced in high quantities by microbial fermentation of carbohydrates in the forestomachs of ruminants and in the large intestine of monogastric mammals and birds. As butyrate has a selective antimicrobial effect on most enteral pathogens, it plays a critical role in maintaining gut health by improving the balance of the intestinal microflora (van Immerseel et al., 2005; Fern andez-Rubio et al., 2008). In addition, it serves as a predominant energy source for the gastrointestinal epithelial cells as a substrate for oxidative pathways. Butyrate is a potent regulator of the cell cycle as well, influencing proliferation and differentiation of the epithelium in the gastrointestinal tract (G alfi & Neogr ady, 2001). Due to these beneficial actions, butyrate can 406
increase daily weight gain and is commonly applied (mainly as its sodium salt) as a nutritional supplement in the poultry and pig operations (Le Gall et al., 2009; Zhang et al., 2011). The application of butyrate is of special interest because of the ban of antibiotics as growth promoters within the European Union. Butyrate is intensively metabolized by intestinal epithelial cells (Vel azquez et al., 1997), but the absorbed amount can be considered as a remarkable butyrate supply for the liver. It serves the oxidative metabolism of hepatocytes. In turn, it might also influence hepatic metabolic processes as an effector molecule (Beauvieux et al., 2001), being involved in the regulation and inhibition of histone deacetylase (HDAC). HDAC is an epigenetic regulator of gene expression and determines among others the expression and activity of certain hepatic microsomal cytochrome P450 (CYP) monooxygenases, playing © 2014 John Wiley & Sons Ltd
Effect of dietary butyrate on erythromycin kinetics in chickens 407
an important role in the biotransformation of xenobiotics and drugs as well as in steroid metabolism. On the basis of these findings, we hypothesized that butyrate may also alter the expression of CYP enzymes in poultry, having an impact on drug metabolism in hepatocytes. An altered metabolism may influence the efficacy and toxicity of drugs, as well as the duration of the withdrawal period in food-producing animals. Little data are available on the effect of drugs on CYP enzymes in avian species. In chickens, the CYP1A subfamily consists of different isoenzymes, for example 1A4 and 1A5. CYP1A gene expression is induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and polycyclic aromatic hydrocarbons (PAH). The chicken CYP3A37 gene is considered to be ortholog to the human CYP3A4 (Ourlin et al., 2000). CYP3A isoforms play a pivotal role in the metabolism of about 50% of all therapeutics in human medicine including various antimicrobials, sedatives, dysrhythmics, calcium channel antagonists and protease inhibitors and antihistamines (Zhang et al., 2010). Genes of the CYP2H1 (homolog to rodent CYP2B) and CYP3A enzymes can be induced not only by phenobarbital but also by dexamethasone (Handschin & Meyer, 2003). The aim of this study was to examine the effect of butyrate on the gene expression of selected drug-metabolizing enzymes such as CYP1A, CYP2H1, and CYP3A37 in primary cultures of chicken hepatocytes. These enzymes are regarded as major drug-metabolizing enzymes in chickens (Goriya et al., 2005; Zhang et al., 2010). The second goal of the study was to evaluate the possible metabolic interaction between butyrate and erythromycin. This macrolide antibiotic is intensively metabolized in the liver, mostly by the CYP3A subfamily (Yamazaki et al., 1996) and serves as a marker substrate to quantify enzyme activity. MATERIALS AND METHODS Chemicals Chemicals were purchased from Sigma-Aldrich (Munich, Germany), except when otherwise specified. Sodium butyrate (No 303410, purity: 98%, molecular weight: 110.09) and erythromycin (No E5389, potency: >850 lg/mg, molecular weight: 733.93) were purchased from Sigma-Aldrich. For cell culture studies, sodium butyrate was dissolved in phosphatebuffered saline (PBS) and sterilized by filtration; the concentration of the stock solution was 2 M. The applied butyrate concentrations were collected from the stock solution by multistep dilution with the culture medium. Similarly, 73.4 mg of erythromycin was dissolved in 10 mL DMSO to prepare a stock solution, which was sterilized by filtration and finally diluted to the required concentrations. In vitro experiments Isolation and culture of chicken hepatocytes. Three male, clinically healthy broiler chickens of the Ross 308 strain, collected from © 2014 John Wiley & Sons Ltd
a commercial hatchery, were housed and fed ad libitum according to the requirements of the Ross (2009) technology. At the age of 7 weeks, animals were anesthetized by intramuscular application (into the pectoral muscle) of a combination of xylazine (10 mg/kgBW), zolazepam (50 mg/ kgBW), and tiletamine (50 mg/kgBW). The hepatic portal system was cannulated via the pancreaticoduodenal vein, and the liver was exsanguinated using 200 mL EGTA-free Hanks buffer. The perfusion was continued with 200 mL Hanks buffer containing 0.5 mM EGTA and then again with 200 mL of the same buffer solution as in the first step. Finally, 150 mL EGTA-free Hanks buffer, supplemented with 100 mg of collagenase Type IV, 7 mM MgCl2 and 7 mM CaCl2, was applied and recirculated to disintegrate the hepatocytes. All solutions applied for perfusion were prewarmed at 40 °C and oxygenated previously with Carbogen (95% O2, 5% CO2, 1 L/min, purchased from Linde Gas, Repcelak, Hungary). The velocity of the perfusion was set at 30 mL/min. After digestion with collagenase, the liver was excised, the capsule was disrupted and the digested parenchyma was filtered through a nylon mesh with 100-lm pore size (Millipore, Volketswil, Switzerland) to eliminate cell aggregates and adherent tissue residues. Hepatocyte-enriched fractions were isolated and washed by low-speed centrifugation (50 g, 3 min), first in BSA (2.5%) containing Hanks buffer and then twice in Williams’ Medium E, supplemented previously with 50 mg/L gentamicin, 2 mM glutamine, 5% fetal bovine serum (FBS), 4 lg/L dexamethasone, 20 IU/L insulin, and 0.22% sodium bicarbonate. Cell viability was assessed by the trypan blue exclusion test and it consistently exceeded 90% in all isolations. The yield of hepatocytes was determined by cell counting in a B€ urker chamber, and cell concentration was adjusted to 106/mL. Hepatocytes (1.5 mL cell suspension/well) were seeded on 6-well Costar TC cell culture dishes (well diameter: 34.8 mm; Corning International, Corning, NY, USA), previously coated by collagen Type I (10 lg/cm2) according to the manufacturer’s instructions. Cell cultures were incubated at 37 °C in a humid atmosphere with 10% CO2. The culture medium was changed for the first time 4 h after plating. A confluent monolayer of hepatocytes was gained after 24 h of incubation. After one-day cultivation, cells were treated for 24 h according to the following protocol: cell culture media (without FBS) contained six different concentrations of sodium butyrate (0, 1, 2.5, 5, 7.5, 10 mM), and each butyrate concentration was combined with the following concentrations of erythromycin: 0, 10, 50, and 100 lM, respectively. Butyrate and erythromycin concentrations were chosen by taking the concentrations most commonly applied in cell culture studies (G alfi & Neogr ady, 2001; Domokos et al., 2010). Hepatocytes originating from three different chickens were treated according to this protocol, and each incubation was conducted in triplo. RNA extraction. Total RNA was isolated from control and butyrate-treated cells (106 cells/well with 34.8 mm diameter) using a protocol based on TRIzol reagent (Invitrogen, Paisley,
408 G. Csiko et al.
UK) according to the manufacturer’s instructions with slight modifications. Shortly, cells grown in monolayer were lyzed directly in the culture dish by adding the TRIzol reagent (1 mL/well) and passing the cell lysate through a pipette several times. The cell lysate was transferred immediately to microfuge tubes and was incubated at 4 °C for 5 min. Next, 200 lL ice-cold chloroform (Reanal, Budapest, Hungary) per 1 mL of TRIzol reagent was added to each sample, which was shaken vigorously for 15 sec and placed on ice at 4 °C for 5 min. The homogenate was centrifuged at 12 000 g (4 °C) for 15 min, and the upper, aqueous phase was transferred to a fresh microfuge tube, and then, the chloroform extraction step was repeated once again. In the next step, equal volume (400 lL) of ice-cold isopropanol (Merck, Darmstadt, Germany) was added to the aqueous phase. The sample was stored for 1 h at 80 °C and then centrifuged at 12 000 g (4 °C) for 10 min. The supernatant was removed, and RNA pellet was washed twice with 75% ice-cold ethanol [1 mL of 75% ethanol (Merck)/1 mL initial solution used] by vortexing and subsequent centrifugation for 5 min at 7500 g (4 °C). Finally, the pellet was dried under a laminar box for 10–15 min, and then dissolved in 50 lL molecular biology grade water (Eppendorf, Hamburg, Germany). The integrity of the extracted RNA was checked by electrophoresis in 1% agarose gel containing 1 lg/mL ethidium bromide (Fluka, Buchs, Switzerland). Two microliter of the RNA sample was mixed with 3 lL loading dye and was electrophoresed at constant voltage 80 V for 25 min in 19 TBE buffer. The resulting bands were visualized and scanned by the InGenius LHR Gel Documentation and Analysis System (Syngene, Cambridge, UK). Quantity and purity of the RNA samples were determined using a NanoDrop ND-1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA).
cytochrome P450 1A (CYP1A), cytochrome P450 2H1 (CYP2H1), and cytochrome P-450 3A37 (CYP3A37). As a reference (housekeeping) gene b-actin was selected. Primer oligonucleotides were designed by Primer3 software (http:// frodo.wi.mit.edu/) and were purchased from Sigma-Aldrich. Primer sequences are listed in Table 1. For each PCR, 2.5 lL cDNA was added directly to a PCR mixture set to a final volume of 25 lL, containing 19 concentrated iQ SYBR Green Supermix and 0.2 lM of the appropriate primers. The thermal profile for all reactions was 2 min at 95 °C, then 30 cycles of 10 sec at 95 °C, 20 sec at 56 °C, and 10 sec at 72 °C. The fluorescence monitoring was performed at the end of each cycle for 10 sec. Each reaction was completed with a melting curve analysis to ensure the specificity of the reaction. The PCR amplicons were separated by electrophoresis through a 1.5% agarose gel at a constant voltage 60 V for 35 min in 19 TBE buffer. The resulting bands were visualized and scanned by the InGenius LHR Gel Documentation and Analysis System and quantified by the GeneTools Software (Syngene). The relative expression ratio for CYP1A, CYP2H1, and CYP3A37 was determined by the relative expression software tool (REST) (Pfaffl et al., 2002) available at http://www. gene-quantification.de/rest.html. Relative gene expression of target genes was calculated by REST, using the formula R ¼ ðE ÞDCPtarget ðsamplecontrolÞ =ðE ÞDCPref ðsamplecontrolÞ ,
Reverse transcription. Prior to the synthesis of the first strand of cDNA, the RNA samples were treated with deoxyribonuclease I (DNase I) to remove double- and single-stranded DNA. After DNase I treatment, reverse transcription of 4 lL total RNA (approx. 500 ng) was achieved using a RevertAid H Minus First Strand cDNA Synthesis kit (Fermentas, St. Leon-Roth, Germany) according to the manufacturer’s instructions, using the random hexamer as a priming method. In brief, 4 lL of RNA was mixed with 1 lL of random hexamer and 7 lL of molecular biology grade water, and then incubated at 70 °C for 5 min. Four microliter of 59 reaction buffer, 1 lL of RiboLock RNase Inhibitor and 2 lL of dNTP mix were mixed in a separate microfuge tube then added to the RNA and incubated at 25 °C for 5 min. Finally, 1 lL of reverse transcriptase was added to the reaction. The thermal profile for reverse transcription was 25 °C for 10 min, then 42 °C for 1 h, and 70 °C for 10 min.
Animals and feeding. Twenty one-day-old broiler chicks of the Ross 308 strain (mixed gender), collected from a commercial hatchery (B abolna Tetra Company, Urai ujfalu, Hungary), were included in the experiment. Broilers were kept together in metal pens (five birds per pen) with a floor area of 1.5 m2. The light programme and the climatic circumstances were adjusted according to the requirements of the Ross technology (Ross, 2009). Birds were fed with a normal stock diet, free from any medications or chemical additives, with or without sodium butyrate supplementation (1.5 g/kg diet), n = 10/group. Feed and drinking water were provided ad libitum. The applied concentration of sodium butyrate was chosen regarding the most commonly administered dose of sodium butyrate as a feed additive in poultry nutrition (Hu & Guo, 2007).
Quantitative real-time PCR. Quantitative real-time PCR (qPCR) was performed using the iQ SYBR Green Supermix kit (BioRad, Hercules, CA, USA) on the MiniOpticon System (BioRad). The cDNA was diluted twofold before equal amounts were added to duplicate qPCRs . The tested genes of interest were the avian
target
ref
where R represents the relative gene expression ratio of the target gene, E stands for PCR efficiency, DCP is the crossing point difference of a sample vs. an untreated control, and ref represents the reference gene b-actin. PCR efficiency was calculated by the following formula: E = 10(1/s)–1, where s is the slope of the standard curve. In vivo experiments
Liver sampling. After 3 weeks of the feeding period, the coelom was aseptically opened in general anesthesia as described before, and the liver was exsanguinated with chilled physiological saline solution through the portal vein. The organ was removed and a 1-g piece per chick was cut and lyzed in 1 mL TRIzol reagent (Invitrogen, Paisley, UK) for further PCR examinations on CYP gene expression. © 2014 John Wiley & Sons Ltd
Effect of dietary butyrate on erythromycin kinetics in chickens 409 Table 1. Sequences of primers Gene
Accession number
Sequence (5′–3′)
Efficiency
Length (bp)
Forward: CCGTGACAACCGCCCTGTCC Reverse: AGCCGTGGTCTCCTCTCCCG
0.912
115
CYP2H1
NM_205146.1 (CYP1A1) NM_205147.1 (CYP1A4) X99454.1 (CYP1A5) NM_001001616.1
0.921
206
CYP3A37
NM_001001751.1
0.826
160
b-actin
NM_205518.1
Forward: ACAACCAGCACCACACTGAG Reverse: GCATGTGGAACATTAAGGGG Forward: TGGTTACCTGGCTTACCAGC Reverse: ATAGAGCCGGAGGGTTTCAT Forward: GTCCACCTTCCAGCAGATGT Reverse: ATAAAGCCATGCCAATCTCG
0.956
169
CYP1A*
*CYP1A primers recognize gene sequences of CYP1A1, CYP1A4, and CYP1A5.
Investigations on CYP gene expression. The expression of hepatic CYP1A, CYP2H, and CYP3A37 genes was assayed by qRT PCR. RNA isolation, reverse transcription, and qRT PCR examination were conducted as described previously in the in vitro trials. Effect of butyrate on pharmacokinetics of erythromycin in chickens Animals and feeding. Twenty broiler chickens of the same strain were housed and fed, randomized into two groups, with or without sodium butyrate supplementation (1.5 g/kg diet), as described previously. At the end of the 6-week-long feeding period, chickens were treated with a single intramuscular (i.m.) dose (30 mg/kgBW, pectoral muscle) of erythromycin (Gallimycinâ; Ceva, Libourne, France) injection. As the aim of the study was to evaluate the metabolic interaction of orally applied butyrate with concomitantly administered drugs, and feed additives may interact with oral drug utilization (Kanzawa et al., 2001), parenteral (i.m.) erythromycin application was chosen. Blood samples were collected at 0.0, 0.5, 1, 1.5, 2, 3, 4, 8, and 12 h after the injection. Samples were taken by puncture of the brachial vein and collected in test tubes containing heparin as anticoagulant. Plasma samples were separated from whole blood by centrifugation (1300 g; 10 min; GR412; Jouan; Thermo Fisher Scientific, Hudson, NH, USA) and stored at –80 °C until analysis. Erythromycin determination. Plasma levels of erythromycin were determined by validated high-performance liquid chromatography (HPLC) using a sample derivatization method on a Merck-Hitachi LaCrom Elite HPLC system combined with a Nucleosil C18 5 lm, 25 9 0.46 column. Before extracting 0.2 mL of plasma sample with 4 mL dichloromethane (Merck, Darmstadt, Germany), first 600 lL 0.1 M Na2HPO4 solution was added, the pH was adjusted (8.8–9.3), and the sample was mixed using a vortex mixer twice for one minute each. Then, the dichloromethane phase was evaporated to dryness with RotaDest at 40–45 °C. The dry substance was redissolved with 200 lL acetonitrile by ultrasonication and vortex mixing. In the derivatization procedure, to each 200 lL sample, 125 lL 0.1 M phosphate buffer [0.8709 g K2HPO4 (Merck) per 50 mL UPW, H = 7.5] and 125 lL 10 mg/mL 9-fluorenylmethyl chloroformate (Merck) were added and mixed with a vortex © 2014 John Wiley & Sons Ltd
mixer. The reaction was performed at 50 °C for 60 min, and then, the samples were cooled to room temperature. Finally, 150 lL of diluting solvent (50/50 acetonitrile/0.03 M phosphate buffer pH = 7.0) was added to each sample. The injection volume was 50 lL. The mobile phase contained 70 (V/V)% acetonitrile (Merck) and 30 (V/V)% 0.03 M K2HPO4 (Merck)-based phosphate buffer (pH = 7.0). The flow rate was constant, 1 mL/min. UV detection method was applied with an excitation wavelength of 260 nm and an emission wavelength of 315 nm. The limit of quantification of the method was 0.002 lg/mL, and the linearity range was from 0.002 to 5 lg/mL. Intraassay and interassay coefficients of variation were 3% and 3.5%, respectively, at a concentration of 0.004 lg/mL and 2.3% and 3.1%, respectively, at a concentration of 2.5 lg/mL. Statistical analysis and calculation of pharmacokinetic parameters. Statistical analysis was performed by R-2.14.1 software. Differences were considered significant if the P-value was
