Reprod Dom Anim doi: 10.1111/rda.12487 ISSN 0936–6768
Effects of Co-culture of Cumulus Oocyte Complexes with Denuded Oocytes During In Vitro Maturation on the Developmental Competence of Cloned Bovine Embryos A-N Ha1, M Fakruzzaman1, K-L Lee1, J-I Bang1, G-K Deb2, Z Wang3 and I-K Kong1,4 1 Department of Animal Science, Division of Applied Life Science (BK21 Plus), Gyeongsang National University, Jinju, Korea; 2Biotechnology Division, Bangladesh Livestock Research Institute, Savar, Dhaka, Bangladesh; 3Department of Animal, Dairy, and Veterinary Sciences, Utah State University, Logan, UT, USA; 4Institute of Agriculture and Life Science, Gyeongsang National University, Jinju, Korea
Contents This study evaluated the effects of co-culture of immature cumulus oocyte complexes (COCs) with denuded immature oocytes (DO) during in vitro maturation on the developmental competence and quality of cloned bovine embryos. We demonstrated that developmental competence, judged by the blastocyst formation rate, was significantly higher in the co-cultured somatic cell nuclear transfer (SCNT+DO, 37.1 1.1%) group than that in the non-co-cultured somatic cell nuclear transfer (SCNT-DO, 25.1 0.9%) group and was very similar to that in the control IVF (IVF, 38.8 2.8%) group. Moreover, the total cell number per blastocyst in the SCNT+DO group (101.7 6.2) was higher than that in the SCNT-DO group (81.7 4.3), while still less than that in the IVF group (133.3 6.0). Furthermore, our data showed that mRNA levels of the methylation-related genes DNMT1 and DNMT3a in the SCNT+DO group were similar to that in the IVF group, while they were significantly higher in the SCNT-DO group. Similarly, while the mRNA levels of the deacetylation-related genes HDAC2 and HDAC3 were significantly higher in the SCNTDO group, they were comparable between the IVF and SCNT+DO groups. However, the mRNA levels of HDAC1 and DNMT3B were significantly higher in the SCNT+DO group than in the other groups. In conclusion, the present study demonstrated that co-culture of COCs with DO improves the in vitro developmental competence and quality of cloned embryos, as evidenced by increased total cell number.
Introduction Somatic cell nuclear transfer (SCNT) in mammalian species has rapidly advanced since the successful birth of a cloned lamb in 1997 (Wilmut et al. 1997). However, the overall efficiency of mammalian cloning by SCNT is low with 2–10% of reconstructed embryos typically develop to term (Young 2003). Embryos produced by SCNT tend to have a lower blastocyst formation rate, a lower number of blastomeres and higher incidence of apoptosis than those produced by fertilization either in vitro or in vivo (Vajta and Gjerris 2006; Prather 2007). Moreover, SCNT-derived embryos tend to lead to greater rates of foetal mortality and stillbirth (Hill et al. 2000; Farin et al. 2004; Beyhan et al. 2007b). These developmental problems associated with SCNT may be partly caused by incomplete epigenetic reprogramming of the somatic nuclei (Ng and Gurdon 2005; Vajta and Gjerris 2006). Aberrant expression of several imprinted and nonimprinted genes is associated with compromised
© 2015 Blackwell Verlag GmbH
development of cloned embryos (Kang et al. 2002; Beyhan et al. 2007b). Most notably, cloned embryos show aberrant expression of genes related to DNA methylation (Sanfins et al. 2004) and histone modification (Beyhan et al. 2007a), with the level of misregulation of these genes inversely correlated the developmental competence of the cloned embryos. In addition to the epigenetic state of donor cells, the quality of recipient oocytes may influence reprogramming efficiency in cloned embryos (Zhou et al. 2009; Ju and Rui 2012). Bi-directional communication between the oocyte and its surrounding cumulus cells (CCs) through gap junctions supports and nurtures the oocytes in ovarian follicles. Oocyte growth, meiotic resumption, and promotion of cytoplasmic and nuclear maturation via paracrine factors, and various other functions are regulated by CCs (Albertini et al. 2001). Consequently, healthy CCs are important for appropriate embryonic development in vitro (Li 2002). Equally important, the health of CCs is maintained by oocyte-secreted factors (OSFs) (Gilchrist et al. 2008). Supplementation of OSFs (denuded oocytes (DO) or growth differentiation factor 9 (GDF9) and/or bone morphogenetic protein (BMP15) during in vitro maturation (IVM) improves the developmental competence and quality of in vitro-produced embryos by increasing the cytoplasmic and nuclear maturation of oocytes (Gilchrist et al. 2008). OSFs also regulate oxidative stress, maintain zona characteristics and increase sperm penetration (Younis and Brackett 1991; Dey et al. 2011). However, the effect of OSFs on the developmental potential and quality of cloned embryos has not been evaluated. DNA methylation and histone modification are two vital factors for successful cloning outcomes (Shi et al. 2003). The mRNA levels of genes related to reprogramming during cloning might positively affect cloning success. Members of the DNA methyl-transferase (DNMT) family are essential for maintaining DNA methylation (DNMT1) during chromosome replication and for de novo methylation (DNMT3a and DNMT3b) during cell lineage specifications. Histone deacetylases (HDACs) are responsible for histone deacetylation, which in turn modifies chromatin structure and defines the epigenetic state of a cell, such as establishing the totipotency of early embryos (Zhou et al. 2009).
2
A-N Ha, M Fakruzzaman, K-L Lee, J-I Bang, G-K Deb, Z Wang and I-K Kong
The present study evaluated the effects of co-culture of cumulus oocyte complexes (COCs) with DO during IVM on the developmental competence and quality of cloned bovine embryos. The quality of cloned embryos was evaluated by the numbers of total and apoptotic cells per blastocyst, as well as by the mRNA levels of the genes that are involved in epigenetic reprogramming.
Materials and Methods Chemicals and ethics All chemicals and media were purchased from Sigma Chemical Co. (St. Louis, MO, USA), unless otherwise stated. The experiments were approved by the Gyeongsang National University Association for the Accreditation of Laboratory Animal Care (approval no. GNU-140922-T0049). Experimental groups and IVM The overall experimental flowchart was shown in Fig. 1. Experimental groups were IVF (in vitro fertilization), SCNT-DO (SCNT of cultured COCs only without DO) and SCNT+DO (SCNT of co-cultured COCs with DO). Immature oocytes that had an uniform cytoplasmic configuration and over three layers cumulus cells were selected as first grade COCs, of which were denuded by vortexing for 4 min and then passed repeatedly through a fine-bore, fire-polished, glass pipette in TL-HEPES to remove any remaining CCs (Hussein et al. 2006). DO were washed in IVM medium and transferred to IVM medium droplets possessing intact immature COCs at a ratio of 1 : 5 (COCs+DO, Fig. 1). The IVM protocol of oocytes obtained from abattoir ovaries of Korean Native Cattle (Hanwoo) of unknown reproductive
health status has been described previously (Dey et al. 2011). In brief, COCs with more than three layers of compact CCs and an uniform cytoplasm were selected in TL-HEPES medium (114 mM sodium chloride, 3.2 mM potassium chloride, 2 mM sodium bicarbonate, 10 mM HEPES, 1 ll/ml phenol red, 100 IU/ml penicillin, and 0.1 mg/ml streptomycin) under a stereomicroscope. Then, oocytes were cultured in IVM medium (TCM199) supplemented with 10% (v/v) foetal bovine serum (FBS), 1 lg/ml estradiol-17b, 10 lg/ml folliclestimulating hormone (FSH), 0.6 mM cysteine and 0.2 mM Na-pyruvate. Thereafter, oocytes were transferred to a well of a 4-well dish containing 700 ll of IVM medium in 5% CO2 at 38.5°C with maximum humidity for 23–24 h. After maturation, COCs were fertilized as described previously (Dey et al. 2011) for production of embryos in vitro or were subjected to SCNT for production of cloned embryos. Nuclear transfer procedure Holstein primary foetal cells of 3–5 passages were used as donor cell for SCNT. Donor cells were cultured in DMEM supplemented with 10% FBS to approximately 80% confluence and then dissociated with 0.25% trypsin–EDTA for using SCNT. Matured COCs with a first polar body were selected for subsequent SCNT, which was conducted as described previously (Lee et al. 2010). We selected MII oocytes that had extruded the first polar body by visually determined using an inverted microscopy (Olympus, Tokyo, Japan). The reconstructed oocytes were fused by the Sendai virus (SV)-mediated method. The donor nuclei were immersed in SV solution as described previously (Song et al. 2011) for 1 min and then transferred to the perivitelline space of enucleated oocytes. After fusion, the reconstructed oocytes were activated by incubation in 5 mM ionomycin for 5 min followed by incubation in 2 mM 6-Dimethylaminopyridine (DMAP) in 5% CO2 at 38.5°C with maximum humidity for 4 h. Culture of cloned embryos After activation, the cloned embryos were placed in modified CR1aa medium supplemented with 44 lg/ml Na-pyruvate, 14.6 lg/ml glutamine, 100 IU/ml penicillin, 100 lg/ml streptomycin sulphate, 3 mg/ml bovine serum albumin (BSA) and 310 lg/ml glutathione for 3 days (IVC-I) (Deb et al. 2011). Thereafter, the cloned embryos were cultured until Day 8 in the same medium, except that BSA was replaced with 10% (v/v) FBS (IVC-II). The embryos were cultured in 5% CO2 at 38.5°C with maximum humidity.
Fig. 1. Flowchart of experiments
Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) staining On Day 8, blastocysts were washed once in TL-HEPES and transferred to a well of a 4-well dish containing © 2015 Blackwell Verlag GmbH
COC/DO Co-culture for Cloning of Bovine Embryos
3
700 ll of Dulbecco’s phosphate-buffered saline (D-PBS) containing 4% (v/v) paraformaldehyde at room temperature for 1 h before being stored at 4°C. Thereafter, the total number of cells and the number of apoptotic cells per blastocyst were calculated. TUNEL was performed as described previously (Deb et al. 2011). Embryos were randomly selected from a pooled population of each group. The TUNEL assay was performed according to the manufacturer’s protocol using the In Situ Cell Death Detection Kit (Fluorescein; Roche Diagnostics Corp., Indianapolis, IN, USA). TUNELstained embryos were washed in PBS-PVP (PBS with polyvinylpyrrolidone; PVP) and counterstained with 10 lg/ml of Hoechst 33342 prepared in PBS-PVP for 10 min at room temperature in the dark to label all nuclei. The total number of cells per blastocyst was counted using an epifluorescence microscope (Olympus IX71) equipped with a mercury lamp. The number of apoptotic cells was determined by red fluorescence, and the total number of cells was determined by green/blue fluorescence.
72°C for 30 s, and a final extension at 72°C for 5 min. Fluorescence was measured after the annealing/extension step of each cycle. Amplification was followed by a melting curve analysis step, in which the temperature was raised from 65 to 95°C at a rate of 0.5°C per second and fluorescence was measured continuously. A negative control was performed for each mRNA during each qPCR experiment. In negative reactions, ultrapure water (ML019-02; WelGene, Daegu, Korea) was added instead of cDNA. The target genes were quantified by the DDCT method using CFX MANAGER v1.1 software (Bio-Rad Laboratories). Gene expression data were normalized against that of the reference gene GAPDH, which was evaluated alongside the target mRNA. The efficiency of qPCR was calculated for each gene using relative calibration curves prepared from bovine uterine cDNA using a 10-fold dilution series in five points. The standard curves yielded correlation coefficients >0.98 and reaction efficiencies of 90–110%. The mean of at least three biological replicates was used for statistical analysis.
Gene expression analysis For analysis of mRNA levels, blastocysts at Day 8 (five per tube per group) were transferred to a 1.5-ml Eppendorf tube, after which they were snap-frozen in liquid nitrogen and stored at 80°C. Quantitative reverse transcription PCR (qPCR) was conducted as described previously (Deb et al. 2011). The gene-specific primer sequences, which were designed using PRIMER3 software (http://frodo.wi.mit.edu/), are presented in Table 1. The specificity of each primer was tested by BLAST analysis of the genomic NCBI database. Primer sequences for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were previously published (Deb et al. 2011). qPCR was performed in duplicate in a CFX98 instrument (Bio-Rad Laboratories, Hercules, CA, USA) in a 10-ll reaction volume, which contained 0.2 mM of each bovine-specific primer, 19 iQ SYBR Green Supermix (iQ SYBR Green Supermix Kit; Bio-Rad Laboratories), and 1.5 ll diluted cDNA. The PCR protocol involved a denaturation step at 95°C for 3 min, followed by 44 cycles at 95°C for 15 s, 57°C for 20 s and
Statistical analysis Results were expressed as means SE, and p < 0.05 was considered to be statistically significant unless otherwise stated. Data were analysed using one-way ANOVA (SPSS Inc., Chicago, IL, USA). Significant differences between groups were detected using t-test or Duncan’s multiple range test.
Results The developmental competence of cloned embryos was then evaluated both by the cleavage rates and blastocyst formation rates. While there was no significant difference in cleavage rate among the groups, significant differences were found for blastocyst formation rate among them. Specifically, the blastocyst formation rate in the SCNT-DO group (25.1 0.9%) was found to be significantly lower than that in the SCNT+DO and IVF groups, but was found very similar between the SCNT+DO and IVF groups (37.1 1.1% vs 38.8 2.8%) (Table 2). Furthermore, total number of
Table 1. qPCR primer sequences used in this study
Genes DNMT1 DNMT3a DNMT3b HDAC1 HDAC2 HDAC3 GAPDH
Accession number
Forward primer (50 - 30 )
Reverse primer (50 - 30 )
Product size
Annealing temperature (°C)
AY244709 AY271298 AY244710 NM001037444 NM001075146 NM0012062431 NM_173979
agggagacgtggagatgctg agacatgtgggttgaacccg caggatgggaaggagtttgga acctttatcccacaacccttca ttattacggacagggtcatc aagtttgaggcttctggttt attttgaatggacagccatc
catggagcgcttgaaggag ggctcccacaagagatgcag caccaaaccactggacccac tcccttttacccagtacccatt ccgacattaaatctctgcat gactcggtcagtgaggtaga tgtacaggaaagccctgact
194 188 151 201 225 150 120
57 58 56 60 60 60 57
DNMT1, DNA methyl-transferase 1; DNMT3a, DNA methyl-transferase 3a; DNMT3b, DNA methyl-transferase 3b; HDAC1, Histone deacetylation 1; HDAC2, Histone deacetylation 2; HDAC3, Histone deacetylation 3; °C, Temperature in degree Celsius unit; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.
© 2015 Blackwell Verlag GmbH
4
A-N Ha, M Fakruzzaman, K-L Lee, J-I Bang, G-K Deb, Z Wang and I-K Kong
Table 2. Effect of coculture of COCs with DO on the developmental competence of cloned embryos (mean SE)
Groups
No. of presumed zygotes in IVC-1 (replicated)
No. of oocytes enucleated (replicated)
No. and (%) of fused embryos
No. and (%) of cleaved embryos
No. and (%) of blastocysts
237 (4)
– 247 (4) 198 (4)
– 203 (82.1 2.5) 140 (70.7 1.6)
179 (75.5 1.7) 178 (87.7 3.1) 108 (77.1 1.3)
92 (38.8 2.8)A 51 (25.1 0.9)B 52 (37.1 1.1)A
IVF SCNT-DOa SCNT+DOa
a The fusion rates are calculated from the number of oocytes enucleated. Cleavage and blastocyst development rates were calculated from the number of fused embryos. SCNT-DO, SCNT of cultured COCs only without DO; SCNT+DO, SCNT of co-cultured COCs with DO. A,B Values with different superscripts in the same column were significantly different (p < 0.05).
cells per blastocyst was higher in the SCNT+DO group (101.7 6.2) than in the SCNT-DO group (81.7 4.3) even though being still lower (p < 0.05) than in the IVF group (133.3 6.0) (Table 3; Fig. 2). Apoptotic number of cells per blastocyst was not significantly different among three groups (5.9 0.7, 7.1 1.1 and 4.7 0.8). The mRNA levels of six reprogramming-related genes were also investigated in this study (Fig. 3). Gene expression values were normalized against that of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The mRNA levels of the methylation-related genes DNMT1 and DNMT3a were found to be not significantly differ between the SCNT+DO and IVF groups (DNMT1: 1.0 vs 1.4; DNMT3a: 1.0 vs 1.1), while the SCNT-DO group showed significantly higher levels than the IVF group (DNMT1: 2.2 vs 1.4; DNMT3a: 1.3 vs 1.1) did. However, the mRNA level of DNMT3b was significantly higher in the SCNT+DO group than in the SCNT-DO and IVF groups (2.3 vs 1.6 and 1.0). The mRNA levels of the deacetylation-related genes HDAC2 and HDAC3 did not significantly differ between the SCNT+DO and IVF groups (HDAC2: 1.3 and 1.0; HDAC3: 1.8 and 1.0), while their expression levels were significantly higher in the SCNT-DO group than in the IVF group (HDAC2: 1.0 vs 2.6; HDAC3: 1.0 vs 2.5). However, the mRNA level of HDAC1 was significantly higher in the SCNT+DO group than in the SCNT-DO and IVF groups (2.1 vs 1.8 and 1.0).
Discussion OSFs improve the in vitro developmental competence and quality of bovine oocytes when DO are added to the maturation medium (Hussein et al. 2006). This is likely Table 3. Effect of coculture of COCs with DO on the quality of cloned blastocysts (mean SE) Groups IVF SCNT-DO SCNT+DO
No. of blastocysts
No. of total cells
Apoptotic cells rate
15 15 15
133.3 6.0a 81.7 4.3c 101.7 6.2b
5.9 0.7 7.1 1.1 4.7 0.8
SCNT-DO, SCNT of cultured COCs only without DO; SCNT+DO, SCNT of cocultured COCs with DO. a–c Values with different superscripts in the same column were significantly different (p < 0.05).
to be the cumulative effects from improved nuclear and cytoplasmic maturation, zona hardening regulation and management of oxidative stress in oocytes (Dey et al. 2011). The present study demonstrated that OSFs also increase the developmental competence and quality of cloned bovine embryos. The beneficial effect of OSFs on oocyte developmental competence is mainly mediated through the regulation of CCs function. OSFs regulate gene expression patterns (Elvin et al. 1999; Varani et al. 2002; Dey et al. 2011), mucification and expansion (Dragovic et al. 2005), apoptosis (Hussein et al. 2006), glycolysis and amino acid uptake in CCs (Eppig et al. 1997, 2005; Sugiura and Eppig 2005), and the transfer of cAMP and energy substrates to oocytes (Sutton et al. 2003). The expression pattern of OSF-related genes in CCs correlates with the developmental competence of oocytes. Mucification and expansion of CCs is necessary for ovulation, sperm capacitation and fertilization (Tanghe et al. 2003). Considering these findings, the present study examined the hypothesis that OSFs may increase the developmental competence and quality of cloned bovine embryos. Co-culture of COCs with DO increased blastocyst formation rate and trophectoderm cell numbers, compared to culture COCs alone (Hussein et al. 2006), and also related to the expression of GPX1 (Dey et al. 2011). The total cell number and apoptotic index are important indicators for the assessment embryo quality. Embryos with a higher total number of cells and fewer apoptotic cells are more likely to implant and develop into live offspring (Albertini et al. 2001). One study showed that the total number of bovine SCNT embryos was lower than in the IVF embryos although there was no significant difference between the two groups (Koo et al. 2002). But another study reported that the total cell number of porcine SCNT blastocysts was significantly lower than in the parthenogenetic blastocysts (Uhm et al. 2009). These results demonstrated that SCNT+DO embryos increased the blastocysts development, although no significant difference was found compared to control. In this study, we also investigated the expression profiles of genes related to chromatin remodelling. DNA methylation modifies and regulates the chromatin structure and plays a crucial role in sustaining genomic stability, activating or suppressing gene expression, maintaining genomic imprinting, regulating X-chromosome inactivation and © 2015 Blackwell Verlag GmbH
COC/DO Co-culture for Cloning of Bovine Embryos
5
(a)
(a′)
(a′′)
(b)
(b′)
(b′′)
(c)
(c′)
(c′′)
Fig. 2. Representative image of blastocysts at Day 8 stained for detection of total and apoptotic cells. Hoechst 33342 staining to label all cells (blue) (a, b and c), TUNEL staining to label apoptotic cells (red) (a0 , b0 and c0 ) and merged images (a00 , b00 and c00 ). Blastocysts of the IVF (a,a0 and a00 ), SCNT-DO (b, b0 and b00 ) and SCNT+DO (c, c0 and c00 ) groups
Fig. 3. Expression of DNA transferase- and histone deacetylation-related mRNAs in SCNT blastocysts. Data show the mean values of three biological replicates. Within each column, values with different letters (a–c) are different (p < 0.05). The data are expressed as means SE
silencing repetitive elements (Xiong et al. 2005; Lan et al. 2010). Cloned bovine embryos tend to have aberrant methylation patterns when compared to in vitro-fertilized embryos, indicating inefficient reprogramming (Bourc’his et al. 2001; Dean et al. 2001; Kang et al. 2001). Consistent with such findings, pre-implantation cloned embryos display marked differences in gene expression, which affects the developmental competence of cloned embryos after implantation (Jang et al. 2005). Expression of chromatin remodelling proteins (DNMT1, DNMT3a, DNMT3b, HDAC1, HDAC2 and HDAC3) correlates with the © 2015 Blackwell Verlag GmbH
reprogramming efficiency of cloned embryos (Zhou et al. 2009; Wang et al. 2011). Based on these facts, we investigated the effect of co-culture of COCs with DO on the expression of these chromatin remodelling genes. We found that the expression of DNMT1, DNMT3a, HDAC2 and HDAC3 was comparable between the SCNT+DO and IVF groups but was significantly different from the SCNT-DO group. Such results indicate that coculture of COCs with DO may help to improve epigenetic reprogramming in bovine cloning. But the expression of HDAC1 and DNMT3B in SCNT+DO group was higher than in
6
A-N Ha, M Fakruzzaman, K-L Lee, J-I Bang, G-K Deb, Z Wang and I-K Kong
SCNT-DO and IVF groups. Controlled gene expression and cell proliferation are essential for the integrity and survival of all organisms. During the development of a fertilized embryo into a multicellular organism, cell fate decisions are made and cell lineage- or tissue-specific gene expression patterns have to be established and maintained (Zhou et al. 2009). DNMTs and HDACs play important roles in the regulation of gene transcription through chromatin remodelling. The present study demonstrated that coculture of COCs with DO has marked impacts on the expression of these epigenetic modifier genes. In conclusion, we identified several beneficial effects by co-culturing COCs with DO. First, we demonstrated that co-culture COCs with DO during IVM dramatically increased the blastocyst formation rates of cloned bovine embryos. Second, such co-culture treatment also increased the total number of cells in the clone bovine embryos. Third, coculture COCs with DO during IVM ‘normalized’ the mRNA levels of DNMT1, DMNT3A,
References Albertini DF, Combelles CM, Benecchi E, Carabatsos MJ, 2001: Cellular basis for paracrine regulation of ovarian follicle development. Reproduction 121, 647– 653. Beyhan Z, Forsberg EJ, Eilertsen KJ, Kent-First M, First NL, 2007a: Gene expression in bovine nuclear transfer embryos in relation to donor cell efficiency in producing live offspring. Mol Reprod Dev 74, 18–27. Beyhan Z, Ross PJ, Iager AE, Kocabas AM, Cunniff K, Rosa GJ, Cibelli JB, 2007b: Transcriptional reprogramming of somatic cell nuclei during preimplantation development of cloned bovine embryos. Dev Biol 305, 637–649. Bourc’his D, Le Bourhis D, Patin D, Niveleau A, Comizzoli P, Renard JP, Viegas-Pequignot E, 2001: Delayed and incomplete reprogramming of chromosome methylation patterns in bovine cloned embryos. Curr Biol 11, 1542–1546. Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik W, 2001: Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci USA 98, 13734–13738. Deb GK, Dey SR, Bang JI, Cho SJ, Park HC, Lee JG, Kong IK, 2011: 9-cis retinoic acid improves developmental competence and embryo quality during in vitro maturation of bovine oocytes through the inhibition of oocyte tumor necrosis factor-alpha gene expression. J Anim Sci 89, 2759–2767. Dey SR, Deb GK, Ha AN, Lee JI, Bang JI, Lee KL, Kong IK, 2011: Coculturing denuded oocytes during the in vitro maturation of bovine cumulus oocyte complexes exerts a synergistic effect on
HDAC2 and HDAC3 methylation- and histone acetylation-related genes. Acknowledgements This work was partly supported by the Next-Generation BioGreen 21 Program (Grant No. PJ009587022014 and PJ009321012014), Rural Development Administration, Republic of Korea. A-Na Ha and Kyeong-Lim Lee were supported by a scholarship from the BK21Plus program, the Ministry of Education Korea.
Conflict of interest None of the authors have any conflict of interest to declare.
Author contributions I-K Kong conceived and designed the experiments. A-N Ha, M. Fakruzzaman and K-L Lee performed the experiments. J-I Bang and G-K Deb analysed the data. Z Wang and I-K Kong wrote the manuscript. A-N Ha, M. Fakruzzaman, J-I Bang, K-L Lee, G-K Deb, Z Wang and I-K Kong provided final approval.
embryo development. Theriogenology 77, 1064–1077. Dragovic RA, Ritter LJ, Schulz SJ, Amato F, Armstrong DT, Gilchrist RB, 2005: Role of oocyte-secreted growth differentiation factor 9 in the regulation of mouse cumulus expansion. Endocrinology 146, 2798–2806. Elvin JA, Clark AT, Wang P, Wolfman NM, Matzuk MM, 1999: Paracrine actions of growth differentiation factor-9 in the mammalian ovary. Mol Endocrinol 13, 1035–1048. Eppig JJ, Wigglesworth K, Pendola F, Hirao Y, 1997: Murine oocytes suppress expression of luteinizing hormone receptor messenger ribonucleic acid by granulosa cells. Biol Reprod 56, 976–984. Eppig JJ, Pendola FL, Wigglesworth K, Pendola JK, 2005: Mouse oocytes regulate metabolic cooperativity between granulosa cells and oocytes: amino acid transport. Biol Reprod 73, 351–357. Farin CE, Farin PW, Piedrahita JA, 2004: Development of fetuses from in vitro-produced and cloned bovine embryos. J Anim Sci 82 (E-Suppl), E53–E62. Gilchrist RB, Lane M, Thompson JG, 2008: Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Hum Reprod Update 14, 159–177. Hill JR, Burghardt RC, Jones K, Long CR, Looney CR, Shin T, Spencer TE, Thompson JA, Winger QA, Westhusin ME, 2000: Evidence for placental abnormality as the major cause of mortality in first-trimester somatic cell cloned bovine fetuses. Biol Reprod 63, 1787–1794. Hussein TS, Thompson JG, Gilchrist RB, 2006: Oocyte-secreted factors enhance oocyte developmental competence. Dev Biol 296, 514–521. Jang G, Jeon HY, Ko KH, Park HJ, Kang SK, Lee BC, Hwang WS, 2005: Developmental competence and gene expression in
preimplantation bovine embryos derived from somatic cell nuclear transfer using different donor cells. Zygote 13, 187–195. Ju S, Rui R, 2012: Effects of cumulus cells on in vitro maturation of oocytes and development of cloned embryos in the pig. Reprod Domest Anim 47, 521–529. Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, Han YM, 2001: Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 28, 173–177. Kang YK, Park JS, Koo DB, Choi YH, Kim SU, Lee KK, Han YM, 2002: Limited demethylation leaves mosaic-type methylation states in cloned bovine pre-implantation embryos. EMBO J 21, 1092–1100. Koo D, Kang Y, Choi Y, Park JS, Kim H, Oh KB, Son D, Park H, Lee K, Han Y, 2002: Aberrant allocations of inner cell mass and trophectoderm cells in bovine nuclear transfer blastocysts. Biol Reprod 67, 487–492. Lan J, Hua S, He X, Zhang Y, 2010: DNA methyltransferases and methyl-binding proteins of mammals. Acta Biochim Biophys Sin (Shanghai) 42, 243–252. Lee HS, Yu XF, Bang JI, Cho SJ, Deb GK, Kim BW, Kong IK, 2010: Enhanced histone acetylation in somatic cells induced by a histone deacetylase inhibitor improved inter-generic cloned leopard cat blastocysts. Theriogenology 74, 1439– 1449. Li E, 2002: Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 3, 662–673. Ng RK, Gurdon JB, 2005: Epigenetic memory of active gene transcription is inherited through somatic cell nuclear transfer. Proc Natl Acad Sci USA 102, 1957–1962. Prather RS, 2007: Nuclear remodeling and nuclear reprogramming for making transgenic pigs by nuclear transfer. Adv Exp Med Biol 591, 1–13.
© 2015 Blackwell Verlag GmbH
COC/DO Co-culture for Cloning of Bovine Embryos Sanfins A, Plancha CE, Overstrom EW, Albertini DF, 2004: Meiotic spindle morphogenesis in in vivo and in vitro matured mouse oocytes: insights into the relationship between nuclear and cytoplasmic quality. Hum Reprod 19, 2889–2899. Shi W, Zakhartchenko V, Wolf E, 2003: Epigenetic reprogramming in mammalian nuclear transfer. Differentiation 71, 91–113. Song YH, Pinkernell K, Alt E, 2011: Stem cell induced cardiac regeneration: fusion/ mitochondrial exchange and/or transdifferentiation? Cell Cycle 10, 2281– 2286. Sugiura K, Eppig JJ, 2005: Society for Reproductive Biology Founders’ Lecture 2005. Control of metabolic cooperativity between oocytes and their companion granulosa cells by mouse oocytes. Reprod Fertil Dev 17, 667–674. Sutton ML, Gilchrist RB, Thompson JG, 2003: Effects of in-vivo and in-vitro environments on the metabolism of the cumulus-oocyte complex and its influence on oocyte developmental capacity. Hum Reprod Update 9, 35–48. Tanghe S, Van Soom A, Mehrzad J, Maes D, Duchateau L, de Kruif A, 2003: Cumulus contributions during bovine fertilization in vitro. Theriogenology 60, 135–149.
© 2015 Blackwell Verlag GmbH
Uhm SJ, Gupta MK, Chung H, Kim JH, Park C, Lee HT, 2009: Relationship between developmental ability and cell number of day 2 porcine embryos produced by parthenogenesis or somatic cell nuclear transfer. Asian-Aust J Anim Sci 22, 483–491. Vajta G, Gjerris M, 2006: Science and technology of farm animal cloning: state of the art. Anim Reprod Sci 92, 211–230. Varani S, Elvin JA, Yan C, DeMayo J, DeMayo FJ, Horton HF, Byrne MC, Matzuk MM, 2002: Knockout of pentraxin 3, a downstream target of growth differentiation factor-9, causes female subfertility. Mol Endocrinol 16, 1154–1167. Wang Y, Su J, Wang L, Xu W, Quan F, Liu J, Zhang Y, 2011: The effects of 5-aza-2’-deoxycytidine and trichostatin A on gene expression and DNA methylation status in cloned bovine blastocysts. Cell Reprogram (Formerly” Cloning and Stem Cells”) 13, 297–306. Wilmut I, Schnieke AE, McWhir J, Kind AJ, Campbell KH, 1997: Viable offspring derived from fetal and adult mammalian cells. Nature 385, 810–813. Xiong Y, Dowdy SC, Podratz KC, Jin F, Attewell JR, Eberhardt NL, Jiang SW, 2005: Histone deacetylase inhibitors decrease DNA methyltransferase-3B
7 messenger RNA stability and down-regulate de novo DNA methyltransferase activity in human endometrial cells. Cancer Res 65, 2684–2689. Young LE, 2003: Scientific hazards of human reproductive ‘cloning’. Hum Fertil (Camb) 6, 59–63. Younis AI, Brackett BG, 1991: Importance of cumulus cells and insemination intervals for development of bovine oocytes into morulae and blastocysts in vitro. Theriogenology 36, 11–21. Zhou W, Sadeghieh S, Abruzzese R, Uppada S, Meredith J, Ohlrichs C, Broek D, Polejaeva I, 2009: Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency. Cloning Stem Cells 11, 397–405.
Submitted: 22 May 2014; Accepted: 26 Dec 2014 Author’s address (for correspondence): Dr Il-Keun Kong, Department of Animal Science, Division of Applied Life Science, Gyeongsang National University, Jinju 660701, Gyeongsangnam-do, Korea. E-mail: [email protected]
Effects of Co-culture of Cumulus Oocyte Complexes with Denuded Oocytes During In Vitro Maturation on the Developmental Competence of Cloned Bovine Embryos A-N Ha1, M Fakruzzaman1, K-L Lee1, J-I Bang1, G-K Deb2, Z Wang3 and I-K Kong1,4 1 Department of Animal Science, Division of Applied Life Science (BK21 Plus), Gyeongsang National University, Jinju, Korea; 2Biotechnology Division, Bangladesh Livestock Research Institute, Savar, Dhaka, Bangladesh; 3Department of Animal, Dairy, and Veterinary Sciences, Utah State University, Logan, UT, USA; 4Institute of Agriculture and Life Science, Gyeongsang National University, Jinju, Korea
Contents This study evaluated the effects of co-culture of immature cumulus oocyte complexes (COCs) with denuded immature oocytes (DO) during in vitro maturation on the developmental competence and quality of cloned bovine embryos. We demonstrated that developmental competence, judged by the blastocyst formation rate, was significantly higher in the co-cultured somatic cell nuclear transfer (SCNT+DO, 37.1 1.1%) group than that in the non-co-cultured somatic cell nuclear transfer (SCNT-DO, 25.1 0.9%) group and was very similar to that in the control IVF (IVF, 38.8 2.8%) group. Moreover, the total cell number per blastocyst in the SCNT+DO group (101.7 6.2) was higher than that in the SCNT-DO group (81.7 4.3), while still less than that in the IVF group (133.3 6.0). Furthermore, our data showed that mRNA levels of the methylation-related genes DNMT1 and DNMT3a in the SCNT+DO group were similar to that in the IVF group, while they were significantly higher in the SCNT-DO group. Similarly, while the mRNA levels of the deacetylation-related genes HDAC2 and HDAC3 were significantly higher in the SCNTDO group, they were comparable between the IVF and SCNT+DO groups. However, the mRNA levels of HDAC1 and DNMT3B were significantly higher in the SCNT+DO group than in the other groups. In conclusion, the present study demonstrated that co-culture of COCs with DO improves the in vitro developmental competence and quality of cloned embryos, as evidenced by increased total cell number.
Introduction Somatic cell nuclear transfer (SCNT) in mammalian species has rapidly advanced since the successful birth of a cloned lamb in 1997 (Wilmut et al. 1997). However, the overall efficiency of mammalian cloning by SCNT is low with 2–10% of reconstructed embryos typically develop to term (Young 2003). Embryos produced by SCNT tend to have a lower blastocyst formation rate, a lower number of blastomeres and higher incidence of apoptosis than those produced by fertilization either in vitro or in vivo (Vajta and Gjerris 2006; Prather 2007). Moreover, SCNT-derived embryos tend to lead to greater rates of foetal mortality and stillbirth (Hill et al. 2000; Farin et al. 2004; Beyhan et al. 2007b). These developmental problems associated with SCNT may be partly caused by incomplete epigenetic reprogramming of the somatic nuclei (Ng and Gurdon 2005; Vajta and Gjerris 2006). Aberrant expression of several imprinted and nonimprinted genes is associated with compromised
© 2015 Blackwell Verlag GmbH
development of cloned embryos (Kang et al. 2002; Beyhan et al. 2007b). Most notably, cloned embryos show aberrant expression of genes related to DNA methylation (Sanfins et al. 2004) and histone modification (Beyhan et al. 2007a), with the level of misregulation of these genes inversely correlated the developmental competence of the cloned embryos. In addition to the epigenetic state of donor cells, the quality of recipient oocytes may influence reprogramming efficiency in cloned embryos (Zhou et al. 2009; Ju and Rui 2012). Bi-directional communication between the oocyte and its surrounding cumulus cells (CCs) through gap junctions supports and nurtures the oocytes in ovarian follicles. Oocyte growth, meiotic resumption, and promotion of cytoplasmic and nuclear maturation via paracrine factors, and various other functions are regulated by CCs (Albertini et al. 2001). Consequently, healthy CCs are important for appropriate embryonic development in vitro (Li 2002). Equally important, the health of CCs is maintained by oocyte-secreted factors (OSFs) (Gilchrist et al. 2008). Supplementation of OSFs (denuded oocytes (DO) or growth differentiation factor 9 (GDF9) and/or bone morphogenetic protein (BMP15) during in vitro maturation (IVM) improves the developmental competence and quality of in vitro-produced embryos by increasing the cytoplasmic and nuclear maturation of oocytes (Gilchrist et al. 2008). OSFs also regulate oxidative stress, maintain zona characteristics and increase sperm penetration (Younis and Brackett 1991; Dey et al. 2011). However, the effect of OSFs on the developmental potential and quality of cloned embryos has not been evaluated. DNA methylation and histone modification are two vital factors for successful cloning outcomes (Shi et al. 2003). The mRNA levels of genes related to reprogramming during cloning might positively affect cloning success. Members of the DNA methyl-transferase (DNMT) family are essential for maintaining DNA methylation (DNMT1) during chromosome replication and for de novo methylation (DNMT3a and DNMT3b) during cell lineage specifications. Histone deacetylases (HDACs) are responsible for histone deacetylation, which in turn modifies chromatin structure and defines the epigenetic state of a cell, such as establishing the totipotency of early embryos (Zhou et al. 2009).
2
A-N Ha, M Fakruzzaman, K-L Lee, J-I Bang, G-K Deb, Z Wang and I-K Kong
The present study evaluated the effects of co-culture of cumulus oocyte complexes (COCs) with DO during IVM on the developmental competence and quality of cloned bovine embryos. The quality of cloned embryos was evaluated by the numbers of total and apoptotic cells per blastocyst, as well as by the mRNA levels of the genes that are involved in epigenetic reprogramming.
Materials and Methods Chemicals and ethics All chemicals and media were purchased from Sigma Chemical Co. (St. Louis, MO, USA), unless otherwise stated. The experiments were approved by the Gyeongsang National University Association for the Accreditation of Laboratory Animal Care (approval no. GNU-140922-T0049). Experimental groups and IVM The overall experimental flowchart was shown in Fig. 1. Experimental groups were IVF (in vitro fertilization), SCNT-DO (SCNT of cultured COCs only without DO) and SCNT+DO (SCNT of co-cultured COCs with DO). Immature oocytes that had an uniform cytoplasmic configuration and over three layers cumulus cells were selected as first grade COCs, of which were denuded by vortexing for 4 min and then passed repeatedly through a fine-bore, fire-polished, glass pipette in TL-HEPES to remove any remaining CCs (Hussein et al. 2006). DO were washed in IVM medium and transferred to IVM medium droplets possessing intact immature COCs at a ratio of 1 : 5 (COCs+DO, Fig. 1). The IVM protocol of oocytes obtained from abattoir ovaries of Korean Native Cattle (Hanwoo) of unknown reproductive
health status has been described previously (Dey et al. 2011). In brief, COCs with more than three layers of compact CCs and an uniform cytoplasm were selected in TL-HEPES medium (114 mM sodium chloride, 3.2 mM potassium chloride, 2 mM sodium bicarbonate, 10 mM HEPES, 1 ll/ml phenol red, 100 IU/ml penicillin, and 0.1 mg/ml streptomycin) under a stereomicroscope. Then, oocytes were cultured in IVM medium (TCM199) supplemented with 10% (v/v) foetal bovine serum (FBS), 1 lg/ml estradiol-17b, 10 lg/ml folliclestimulating hormone (FSH), 0.6 mM cysteine and 0.2 mM Na-pyruvate. Thereafter, oocytes were transferred to a well of a 4-well dish containing 700 ll of IVM medium in 5% CO2 at 38.5°C with maximum humidity for 23–24 h. After maturation, COCs were fertilized as described previously (Dey et al. 2011) for production of embryos in vitro or were subjected to SCNT for production of cloned embryos. Nuclear transfer procedure Holstein primary foetal cells of 3–5 passages were used as donor cell for SCNT. Donor cells were cultured in DMEM supplemented with 10% FBS to approximately 80% confluence and then dissociated with 0.25% trypsin–EDTA for using SCNT. Matured COCs with a first polar body were selected for subsequent SCNT, which was conducted as described previously (Lee et al. 2010). We selected MII oocytes that had extruded the first polar body by visually determined using an inverted microscopy (Olympus, Tokyo, Japan). The reconstructed oocytes were fused by the Sendai virus (SV)-mediated method. The donor nuclei were immersed in SV solution as described previously (Song et al. 2011) for 1 min and then transferred to the perivitelline space of enucleated oocytes. After fusion, the reconstructed oocytes were activated by incubation in 5 mM ionomycin for 5 min followed by incubation in 2 mM 6-Dimethylaminopyridine (DMAP) in 5% CO2 at 38.5°C with maximum humidity for 4 h. Culture of cloned embryos After activation, the cloned embryos were placed in modified CR1aa medium supplemented with 44 lg/ml Na-pyruvate, 14.6 lg/ml glutamine, 100 IU/ml penicillin, 100 lg/ml streptomycin sulphate, 3 mg/ml bovine serum albumin (BSA) and 310 lg/ml glutathione for 3 days (IVC-I) (Deb et al. 2011). Thereafter, the cloned embryos were cultured until Day 8 in the same medium, except that BSA was replaced with 10% (v/v) FBS (IVC-II). The embryos were cultured in 5% CO2 at 38.5°C with maximum humidity.
Fig. 1. Flowchart of experiments
Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) staining On Day 8, blastocysts were washed once in TL-HEPES and transferred to a well of a 4-well dish containing © 2015 Blackwell Verlag GmbH
COC/DO Co-culture for Cloning of Bovine Embryos
3
700 ll of Dulbecco’s phosphate-buffered saline (D-PBS) containing 4% (v/v) paraformaldehyde at room temperature for 1 h before being stored at 4°C. Thereafter, the total number of cells and the number of apoptotic cells per blastocyst were calculated. TUNEL was performed as described previously (Deb et al. 2011). Embryos were randomly selected from a pooled population of each group. The TUNEL assay was performed according to the manufacturer’s protocol using the In Situ Cell Death Detection Kit (Fluorescein; Roche Diagnostics Corp., Indianapolis, IN, USA). TUNELstained embryos were washed in PBS-PVP (PBS with polyvinylpyrrolidone; PVP) and counterstained with 10 lg/ml of Hoechst 33342 prepared in PBS-PVP for 10 min at room temperature in the dark to label all nuclei. The total number of cells per blastocyst was counted using an epifluorescence microscope (Olympus IX71) equipped with a mercury lamp. The number of apoptotic cells was determined by red fluorescence, and the total number of cells was determined by green/blue fluorescence.
72°C for 30 s, and a final extension at 72°C for 5 min. Fluorescence was measured after the annealing/extension step of each cycle. Amplification was followed by a melting curve analysis step, in which the temperature was raised from 65 to 95°C at a rate of 0.5°C per second and fluorescence was measured continuously. A negative control was performed for each mRNA during each qPCR experiment. In negative reactions, ultrapure water (ML019-02; WelGene, Daegu, Korea) was added instead of cDNA. The target genes were quantified by the DDCT method using CFX MANAGER v1.1 software (Bio-Rad Laboratories). Gene expression data were normalized against that of the reference gene GAPDH, which was evaluated alongside the target mRNA. The efficiency of qPCR was calculated for each gene using relative calibration curves prepared from bovine uterine cDNA using a 10-fold dilution series in five points. The standard curves yielded correlation coefficients >0.98 and reaction efficiencies of 90–110%. The mean of at least three biological replicates was used for statistical analysis.
Gene expression analysis For analysis of mRNA levels, blastocysts at Day 8 (five per tube per group) were transferred to a 1.5-ml Eppendorf tube, after which they were snap-frozen in liquid nitrogen and stored at 80°C. Quantitative reverse transcription PCR (qPCR) was conducted as described previously (Deb et al. 2011). The gene-specific primer sequences, which were designed using PRIMER3 software (http://frodo.wi.mit.edu/), are presented in Table 1. The specificity of each primer was tested by BLAST analysis of the genomic NCBI database. Primer sequences for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were previously published (Deb et al. 2011). qPCR was performed in duplicate in a CFX98 instrument (Bio-Rad Laboratories, Hercules, CA, USA) in a 10-ll reaction volume, which contained 0.2 mM of each bovine-specific primer, 19 iQ SYBR Green Supermix (iQ SYBR Green Supermix Kit; Bio-Rad Laboratories), and 1.5 ll diluted cDNA. The PCR protocol involved a denaturation step at 95°C for 3 min, followed by 44 cycles at 95°C for 15 s, 57°C for 20 s and
Statistical analysis Results were expressed as means SE, and p < 0.05 was considered to be statistically significant unless otherwise stated. Data were analysed using one-way ANOVA (SPSS Inc., Chicago, IL, USA). Significant differences between groups were detected using t-test or Duncan’s multiple range test.
Results The developmental competence of cloned embryos was then evaluated both by the cleavage rates and blastocyst formation rates. While there was no significant difference in cleavage rate among the groups, significant differences were found for blastocyst formation rate among them. Specifically, the blastocyst formation rate in the SCNT-DO group (25.1 0.9%) was found to be significantly lower than that in the SCNT+DO and IVF groups, but was found very similar between the SCNT+DO and IVF groups (37.1 1.1% vs 38.8 2.8%) (Table 2). Furthermore, total number of
Table 1. qPCR primer sequences used in this study
Genes DNMT1 DNMT3a DNMT3b HDAC1 HDAC2 HDAC3 GAPDH
Accession number
Forward primer (50 - 30 )
Reverse primer (50 - 30 )
Product size
Annealing temperature (°C)
AY244709 AY271298 AY244710 NM001037444 NM001075146 NM0012062431 NM_173979
agggagacgtggagatgctg agacatgtgggttgaacccg caggatgggaaggagtttgga acctttatcccacaacccttca ttattacggacagggtcatc aagtttgaggcttctggttt attttgaatggacagccatc
catggagcgcttgaaggag ggctcccacaagagatgcag caccaaaccactggacccac tcccttttacccagtacccatt ccgacattaaatctctgcat gactcggtcagtgaggtaga tgtacaggaaagccctgact
194 188 151 201 225 150 120
57 58 56 60 60 60 57
DNMT1, DNA methyl-transferase 1; DNMT3a, DNA methyl-transferase 3a; DNMT3b, DNA methyl-transferase 3b; HDAC1, Histone deacetylation 1; HDAC2, Histone deacetylation 2; HDAC3, Histone deacetylation 3; °C, Temperature in degree Celsius unit; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.
© 2015 Blackwell Verlag GmbH
4
A-N Ha, M Fakruzzaman, K-L Lee, J-I Bang, G-K Deb, Z Wang and I-K Kong
Table 2. Effect of coculture of COCs with DO on the developmental competence of cloned embryos (mean SE)
Groups
No. of presumed zygotes in IVC-1 (replicated)
No. of oocytes enucleated (replicated)
No. and (%) of fused embryos
No. and (%) of cleaved embryos
No. and (%) of blastocysts
237 (4)
– 247 (4) 198 (4)
– 203 (82.1 2.5) 140 (70.7 1.6)
179 (75.5 1.7) 178 (87.7 3.1) 108 (77.1 1.3)
92 (38.8 2.8)A 51 (25.1 0.9)B 52 (37.1 1.1)A
IVF SCNT-DOa SCNT+DOa
a The fusion rates are calculated from the number of oocytes enucleated. Cleavage and blastocyst development rates were calculated from the number of fused embryos. SCNT-DO, SCNT of cultured COCs only without DO; SCNT+DO, SCNT of co-cultured COCs with DO. A,B Values with different superscripts in the same column were significantly different (p < 0.05).
cells per blastocyst was higher in the SCNT+DO group (101.7 6.2) than in the SCNT-DO group (81.7 4.3) even though being still lower (p < 0.05) than in the IVF group (133.3 6.0) (Table 3; Fig. 2). Apoptotic number of cells per blastocyst was not significantly different among three groups (5.9 0.7, 7.1 1.1 and 4.7 0.8). The mRNA levels of six reprogramming-related genes were also investigated in this study (Fig. 3). Gene expression values were normalized against that of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The mRNA levels of the methylation-related genes DNMT1 and DNMT3a were found to be not significantly differ between the SCNT+DO and IVF groups (DNMT1: 1.0 vs 1.4; DNMT3a: 1.0 vs 1.1), while the SCNT-DO group showed significantly higher levels than the IVF group (DNMT1: 2.2 vs 1.4; DNMT3a: 1.3 vs 1.1) did. However, the mRNA level of DNMT3b was significantly higher in the SCNT+DO group than in the SCNT-DO and IVF groups (2.3 vs 1.6 and 1.0). The mRNA levels of the deacetylation-related genes HDAC2 and HDAC3 did not significantly differ between the SCNT+DO and IVF groups (HDAC2: 1.3 and 1.0; HDAC3: 1.8 and 1.0), while their expression levels were significantly higher in the SCNT-DO group than in the IVF group (HDAC2: 1.0 vs 2.6; HDAC3: 1.0 vs 2.5). However, the mRNA level of HDAC1 was significantly higher in the SCNT+DO group than in the SCNT-DO and IVF groups (2.1 vs 1.8 and 1.0).
Discussion OSFs improve the in vitro developmental competence and quality of bovine oocytes when DO are added to the maturation medium (Hussein et al. 2006). This is likely Table 3. Effect of coculture of COCs with DO on the quality of cloned blastocysts (mean SE) Groups IVF SCNT-DO SCNT+DO
No. of blastocysts
No. of total cells
Apoptotic cells rate
15 15 15
133.3 6.0a 81.7 4.3c 101.7 6.2b
5.9 0.7 7.1 1.1 4.7 0.8
SCNT-DO, SCNT of cultured COCs only without DO; SCNT+DO, SCNT of cocultured COCs with DO. a–c Values with different superscripts in the same column were significantly different (p < 0.05).
to be the cumulative effects from improved nuclear and cytoplasmic maturation, zona hardening regulation and management of oxidative stress in oocytes (Dey et al. 2011). The present study demonstrated that OSFs also increase the developmental competence and quality of cloned bovine embryos. The beneficial effect of OSFs on oocyte developmental competence is mainly mediated through the regulation of CCs function. OSFs regulate gene expression patterns (Elvin et al. 1999; Varani et al. 2002; Dey et al. 2011), mucification and expansion (Dragovic et al. 2005), apoptosis (Hussein et al. 2006), glycolysis and amino acid uptake in CCs (Eppig et al. 1997, 2005; Sugiura and Eppig 2005), and the transfer of cAMP and energy substrates to oocytes (Sutton et al. 2003). The expression pattern of OSF-related genes in CCs correlates with the developmental competence of oocytes. Mucification and expansion of CCs is necessary for ovulation, sperm capacitation and fertilization (Tanghe et al. 2003). Considering these findings, the present study examined the hypothesis that OSFs may increase the developmental competence and quality of cloned bovine embryos. Co-culture of COCs with DO increased blastocyst formation rate and trophectoderm cell numbers, compared to culture COCs alone (Hussein et al. 2006), and also related to the expression of GPX1 (Dey et al. 2011). The total cell number and apoptotic index are important indicators for the assessment embryo quality. Embryos with a higher total number of cells and fewer apoptotic cells are more likely to implant and develop into live offspring (Albertini et al. 2001). One study showed that the total number of bovine SCNT embryos was lower than in the IVF embryos although there was no significant difference between the two groups (Koo et al. 2002). But another study reported that the total cell number of porcine SCNT blastocysts was significantly lower than in the parthenogenetic blastocysts (Uhm et al. 2009). These results demonstrated that SCNT+DO embryos increased the blastocysts development, although no significant difference was found compared to control. In this study, we also investigated the expression profiles of genes related to chromatin remodelling. DNA methylation modifies and regulates the chromatin structure and plays a crucial role in sustaining genomic stability, activating or suppressing gene expression, maintaining genomic imprinting, regulating X-chromosome inactivation and © 2015 Blackwell Verlag GmbH
COC/DO Co-culture for Cloning of Bovine Embryos
5
(a)
(a′)
(a′′)
(b)
(b′)
(b′′)
(c)
(c′)
(c′′)
Fig. 2. Representative image of blastocysts at Day 8 stained for detection of total and apoptotic cells. Hoechst 33342 staining to label all cells (blue) (a, b and c), TUNEL staining to label apoptotic cells (red) (a0 , b0 and c0 ) and merged images (a00 , b00 and c00 ). Blastocysts of the IVF (a,a0 and a00 ), SCNT-DO (b, b0 and b00 ) and SCNT+DO (c, c0 and c00 ) groups
Fig. 3. Expression of DNA transferase- and histone deacetylation-related mRNAs in SCNT blastocysts. Data show the mean values of three biological replicates. Within each column, values with different letters (a–c) are different (p < 0.05). The data are expressed as means SE
silencing repetitive elements (Xiong et al. 2005; Lan et al. 2010). Cloned bovine embryos tend to have aberrant methylation patterns when compared to in vitro-fertilized embryos, indicating inefficient reprogramming (Bourc’his et al. 2001; Dean et al. 2001; Kang et al. 2001). Consistent with such findings, pre-implantation cloned embryos display marked differences in gene expression, which affects the developmental competence of cloned embryos after implantation (Jang et al. 2005). Expression of chromatin remodelling proteins (DNMT1, DNMT3a, DNMT3b, HDAC1, HDAC2 and HDAC3) correlates with the © 2015 Blackwell Verlag GmbH
reprogramming efficiency of cloned embryos (Zhou et al. 2009; Wang et al. 2011). Based on these facts, we investigated the effect of co-culture of COCs with DO on the expression of these chromatin remodelling genes. We found that the expression of DNMT1, DNMT3a, HDAC2 and HDAC3 was comparable between the SCNT+DO and IVF groups but was significantly different from the SCNT-DO group. Such results indicate that coculture of COCs with DO may help to improve epigenetic reprogramming in bovine cloning. But the expression of HDAC1 and DNMT3B in SCNT+DO group was higher than in
6
A-N Ha, M Fakruzzaman, K-L Lee, J-I Bang, G-K Deb, Z Wang and I-K Kong
SCNT-DO and IVF groups. Controlled gene expression and cell proliferation are essential for the integrity and survival of all organisms. During the development of a fertilized embryo into a multicellular organism, cell fate decisions are made and cell lineage- or tissue-specific gene expression patterns have to be established and maintained (Zhou et al. 2009). DNMTs and HDACs play important roles in the regulation of gene transcription through chromatin remodelling. The present study demonstrated that coculture of COCs with DO has marked impacts on the expression of these epigenetic modifier genes. In conclusion, we identified several beneficial effects by co-culturing COCs with DO. First, we demonstrated that co-culture COCs with DO during IVM dramatically increased the blastocyst formation rates of cloned bovine embryos. Second, such co-culture treatment also increased the total number of cells in the clone bovine embryos. Third, coculture COCs with DO during IVM ‘normalized’ the mRNA levels of DNMT1, DMNT3A,
References Albertini DF, Combelles CM, Benecchi E, Carabatsos MJ, 2001: Cellular basis for paracrine regulation of ovarian follicle development. Reproduction 121, 647– 653. Beyhan Z, Forsberg EJ, Eilertsen KJ, Kent-First M, First NL, 2007a: Gene expression in bovine nuclear transfer embryos in relation to donor cell efficiency in producing live offspring. Mol Reprod Dev 74, 18–27. Beyhan Z, Ross PJ, Iager AE, Kocabas AM, Cunniff K, Rosa GJ, Cibelli JB, 2007b: Transcriptional reprogramming of somatic cell nuclei during preimplantation development of cloned bovine embryos. Dev Biol 305, 637–649. Bourc’his D, Le Bourhis D, Patin D, Niveleau A, Comizzoli P, Renard JP, Viegas-Pequignot E, 2001: Delayed and incomplete reprogramming of chromosome methylation patterns in bovine cloned embryos. Curr Biol 11, 1542–1546. Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik W, 2001: Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci USA 98, 13734–13738. Deb GK, Dey SR, Bang JI, Cho SJ, Park HC, Lee JG, Kong IK, 2011: 9-cis retinoic acid improves developmental competence and embryo quality during in vitro maturation of bovine oocytes through the inhibition of oocyte tumor necrosis factor-alpha gene expression. J Anim Sci 89, 2759–2767. Dey SR, Deb GK, Ha AN, Lee JI, Bang JI, Lee KL, Kong IK, 2011: Coculturing denuded oocytes during the in vitro maturation of bovine cumulus oocyte complexes exerts a synergistic effect on
HDAC2 and HDAC3 methylation- and histone acetylation-related genes. Acknowledgements This work was partly supported by the Next-Generation BioGreen 21 Program (Grant No. PJ009587022014 and PJ009321012014), Rural Development Administration, Republic of Korea. A-Na Ha and Kyeong-Lim Lee were supported by a scholarship from the BK21Plus program, the Ministry of Education Korea.
Conflict of interest None of the authors have any conflict of interest to declare.
Author contributions I-K Kong conceived and designed the experiments. A-N Ha, M. Fakruzzaman and K-L Lee performed the experiments. J-I Bang and G-K Deb analysed the data. Z Wang and I-K Kong wrote the manuscript. A-N Ha, M. Fakruzzaman, J-I Bang, K-L Lee, G-K Deb, Z Wang and I-K Kong provided final approval.
embryo development. Theriogenology 77, 1064–1077. Dragovic RA, Ritter LJ, Schulz SJ, Amato F, Armstrong DT, Gilchrist RB, 2005: Role of oocyte-secreted growth differentiation factor 9 in the regulation of mouse cumulus expansion. Endocrinology 146, 2798–2806. Elvin JA, Clark AT, Wang P, Wolfman NM, Matzuk MM, 1999: Paracrine actions of growth differentiation factor-9 in the mammalian ovary. Mol Endocrinol 13, 1035–1048. Eppig JJ, Wigglesworth K, Pendola F, Hirao Y, 1997: Murine oocytes suppress expression of luteinizing hormone receptor messenger ribonucleic acid by granulosa cells. Biol Reprod 56, 976–984. Eppig JJ, Pendola FL, Wigglesworth K, Pendola JK, 2005: Mouse oocytes regulate metabolic cooperativity between granulosa cells and oocytes: amino acid transport. Biol Reprod 73, 351–357. Farin CE, Farin PW, Piedrahita JA, 2004: Development of fetuses from in vitro-produced and cloned bovine embryos. J Anim Sci 82 (E-Suppl), E53–E62. Gilchrist RB, Lane M, Thompson JG, 2008: Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality. Hum Reprod Update 14, 159–177. Hill JR, Burghardt RC, Jones K, Long CR, Looney CR, Shin T, Spencer TE, Thompson JA, Winger QA, Westhusin ME, 2000: Evidence for placental abnormality as the major cause of mortality in first-trimester somatic cell cloned bovine fetuses. Biol Reprod 63, 1787–1794. Hussein TS, Thompson JG, Gilchrist RB, 2006: Oocyte-secreted factors enhance oocyte developmental competence. Dev Biol 296, 514–521. Jang G, Jeon HY, Ko KH, Park HJ, Kang SK, Lee BC, Hwang WS, 2005: Developmental competence and gene expression in
preimplantation bovine embryos derived from somatic cell nuclear transfer using different donor cells. Zygote 13, 187–195. Ju S, Rui R, 2012: Effects of cumulus cells on in vitro maturation of oocytes and development of cloned embryos in the pig. Reprod Domest Anim 47, 521–529. Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, Han YM, 2001: Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 28, 173–177. Kang YK, Park JS, Koo DB, Choi YH, Kim SU, Lee KK, Han YM, 2002: Limited demethylation leaves mosaic-type methylation states in cloned bovine pre-implantation embryos. EMBO J 21, 1092–1100. Koo D, Kang Y, Choi Y, Park JS, Kim H, Oh KB, Son D, Park H, Lee K, Han Y, 2002: Aberrant allocations of inner cell mass and trophectoderm cells in bovine nuclear transfer blastocysts. Biol Reprod 67, 487–492. Lan J, Hua S, He X, Zhang Y, 2010: DNA methyltransferases and methyl-binding proteins of mammals. Acta Biochim Biophys Sin (Shanghai) 42, 243–252. Lee HS, Yu XF, Bang JI, Cho SJ, Deb GK, Kim BW, Kong IK, 2010: Enhanced histone acetylation in somatic cells induced by a histone deacetylase inhibitor improved inter-generic cloned leopard cat blastocysts. Theriogenology 74, 1439– 1449. Li E, 2002: Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet 3, 662–673. Ng RK, Gurdon JB, 2005: Epigenetic memory of active gene transcription is inherited through somatic cell nuclear transfer. Proc Natl Acad Sci USA 102, 1957–1962. Prather RS, 2007: Nuclear remodeling and nuclear reprogramming for making transgenic pigs by nuclear transfer. Adv Exp Med Biol 591, 1–13.
© 2015 Blackwell Verlag GmbH
COC/DO Co-culture for Cloning of Bovine Embryos Sanfins A, Plancha CE, Overstrom EW, Albertini DF, 2004: Meiotic spindle morphogenesis in in vivo and in vitro matured mouse oocytes: insights into the relationship between nuclear and cytoplasmic quality. Hum Reprod 19, 2889–2899. Shi W, Zakhartchenko V, Wolf E, 2003: Epigenetic reprogramming in mammalian nuclear transfer. Differentiation 71, 91–113. Song YH, Pinkernell K, Alt E, 2011: Stem cell induced cardiac regeneration: fusion/ mitochondrial exchange and/or transdifferentiation? Cell Cycle 10, 2281– 2286. Sugiura K, Eppig JJ, 2005: Society for Reproductive Biology Founders’ Lecture 2005. Control of metabolic cooperativity between oocytes and their companion granulosa cells by mouse oocytes. Reprod Fertil Dev 17, 667–674. Sutton ML, Gilchrist RB, Thompson JG, 2003: Effects of in-vivo and in-vitro environments on the metabolism of the cumulus-oocyte complex and its influence on oocyte developmental capacity. Hum Reprod Update 9, 35–48. Tanghe S, Van Soom A, Mehrzad J, Maes D, Duchateau L, de Kruif A, 2003: Cumulus contributions during bovine fertilization in vitro. Theriogenology 60, 135–149.
© 2015 Blackwell Verlag GmbH
Uhm SJ, Gupta MK, Chung H, Kim JH, Park C, Lee HT, 2009: Relationship between developmental ability and cell number of day 2 porcine embryos produced by parthenogenesis or somatic cell nuclear transfer. Asian-Aust J Anim Sci 22, 483–491. Vajta G, Gjerris M, 2006: Science and technology of farm animal cloning: state of the art. Anim Reprod Sci 92, 211–230. Varani S, Elvin JA, Yan C, DeMayo J, DeMayo FJ, Horton HF, Byrne MC, Matzuk MM, 2002: Knockout of pentraxin 3, a downstream target of growth differentiation factor-9, causes female subfertility. Mol Endocrinol 16, 1154–1167. Wang Y, Su J, Wang L, Xu W, Quan F, Liu J, Zhang Y, 2011: The effects of 5-aza-2’-deoxycytidine and trichostatin A on gene expression and DNA methylation status in cloned bovine blastocysts. Cell Reprogram (Formerly” Cloning and Stem Cells”) 13, 297–306. Wilmut I, Schnieke AE, McWhir J, Kind AJ, Campbell KH, 1997: Viable offspring derived from fetal and adult mammalian cells. Nature 385, 810–813. Xiong Y, Dowdy SC, Podratz KC, Jin F, Attewell JR, Eberhardt NL, Jiang SW, 2005: Histone deacetylase inhibitors decrease DNA methyltransferase-3B
7 messenger RNA stability and down-regulate de novo DNA methyltransferase activity in human endometrial cells. Cancer Res 65, 2684–2689. Young LE, 2003: Scientific hazards of human reproductive ‘cloning’. Hum Fertil (Camb) 6, 59–63. Younis AI, Brackett BG, 1991: Importance of cumulus cells and insemination intervals for development of bovine oocytes into morulae and blastocysts in vitro. Theriogenology 36, 11–21. Zhou W, Sadeghieh S, Abruzzese R, Uppada S, Meredith J, Ohlrichs C, Broek D, Polejaeva I, 2009: Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency. Cloning Stem Cells 11, 397–405.
Submitted: 22 May 2014; Accepted: 26 Dec 2014 Author’s address (for correspondence): Dr Il-Keun Kong, Department of Animal Science, Division of Applied Life Science, Gyeongsang National University, Jinju 660701, Gyeongsangnam-do, Korea. E-mail: [email protected]
