Acta Biomaterialia 10 (2014) 2674–2683

Contents lists available at ScienceDirect

Acta Biomaterialia journal homepage: www.elsevier.com/locate/actabiomat

Effective delivery of p65 shRNA by optimized Tween 85-polyethyleneimine conjugate for inhibition of tumor growth and lymphatic metastasis Jisheng Xiao a,1, Xiaopin Duan a,b,1, Qingshuo Meng a, Qi Yin a, Zhiwen Zhang a, Haijun Yu a, Lingli Chen a, Wangwen Gu a, Yaping Li a,⇑ a b

Center of Pharmaceutics, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203, People’s Republic of China School of Pharmacy, Shenyang Pharmaceutical University, Shenyang 110016, People’s Republic of China

a r t i c l e

i n f o

Article history: Received 10 October 2013 Received in revised form 31 January 2014 Accepted 3 February 2014 Available online 10 February 2014 Keywords: Tween 85-PEI conjugates p65 shRNA Lymphatic metastasis Breast cancer Nanoparticles

a b s t r a c t To maximize the interference efficacy of pGPU6/Neo-p65 shRNA-expressing pDNA (p65 shRNA) and subsequently more effectively inhibit tumor growth and lymphatic metastasis through blocking the nuclear factor-kappa B (NF-jB) signaling pathway, seven Tween 85-polyethyleneimine (PEI) conjugates (TnPs, n = 2, 3, 4, 5, 6, 7 and 8), which differed in the length of the polymethylene [–(CH2)n–] spacer between Tween 85 and PEI, were synthesized and investigated. The results showed that the transfection efficiency and cytotoxicity both increased with the spacer chain length. Then, TnPs with a [–(CH2)6–] spacer (T6P) were chosen to deliver p65 shRNA to a tumor and subsequently inhibit tumor growth and lymphatic metastasis. The T6P/p65 shRNA complex nanoparticles (T6Ns) could significantly down-regulate p65 expression in breast cancer cells, and consequently inhibit cell invasion and disrupt the tube formation. Most importantly, T6Ns accumulated greatly in tumor tissue, and as a result, significantly inhibited the growth and lymphatic metastasis of breast cancer xenograft. All these results indicated that the transfection efficacies of cationic amphiphiles could be significantly modulated by minor structural variations, and that T6P was promising for the effective delivery of p65 shRNA to knock down the expression of the key metastasis-driving genes and inhibit tumor growth and metastasis. Ó 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction Metastasis, the spread of tumor cells from a primary tumor to establish a secondary tumor in a distant site, is the leading cause of mortality in patients diagnosed with breast cancer and other solid tumors [1]. Generally, tumor cells disseminate to distant organs mainly through lymphatic vessels and blood vessels. Compared with blood vessels, lymphatic vessels offer more advantages for invasion and transport of pre-metastatic cells, such as: (1) discontinuous basement membrane and loose cell-cell junctions; (2) a much lower flow rate that increases survival by minimizing shear stress; and (3) a 1000-fold higher lymph concentration of hyaluronic acid, a molecule with potent cell-protecting and pro-survival properties [2]. Cancer cells can and do take advantage of the cell-transport capabilities of the lymphatic system and disseminate through the lymphatic vessels to distal organs, while still remaining viable and active. The status of metastasis to the ⇑ Corresponding author. Tel./fax: +86 21 2023 1979. 1

E-mail address: [email protected] (Y. Li). These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.actbio.2014.02.009 1742-7061/Ó 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

regional lymph nodes is a prognostic factor in patients with malignancies and a determinant of the treatment course of patients [3,4]. Nuclear factor-kappa B (NF-jB), a heterodimeric DNA-binding protein that consists of two major subunits, p50 and p65, has been found to play a crucial role in the progress and distant metastasis of human cancer [5–7]. Activated NF-jB can bind to DNA and lead to the expression of diverse genes that promote cell proliferation, regulate apoptosis, facilitate angiogenesis and lymphangiogenesis and stimulate invasion and metastasis [8–12]. Specifically, the inhibition of NF-jB can markedly down-regulate the expression of vascular endothelial growth factor (VEGF), such as VEGF-A, VEGF-C and VEGF-D, thereby suppressing angiogenesis and lymphangiogenesis [13]. Thus, targeting this signaling pathway using RNA interference (RNAi) could prevent tumor metastasis and consequently reduce mortality. However, the successful use of RNAi greatly depends on having an effective and safe delivery system. It was reported that the cationic amphiphiles, which combined the merits of both cationic lipids and cationic polymers, showed excellent potential for gene delivery [14]. The molecular architectures of cationic amphiphiles

J. Xiao et al. / Acta Biomaterialia 10 (2014) 2674–2683

consist of a positively charged hydrophilic polar region and a hydrophobic nonpolar region often tethered together via a linker functionality such as ether, ester, amide, amidine groups, etc. However, gene transfection efficacies of cationic amphiphiles could be significantly modulated by minor structural variations in both the hydrophilic polar region and the hydrophobic nonpolar region [15–18]; in particular, the nature of the linkage between the hydrophilic region and the hydrophobic region also plays an important role in modulating the gene delivery [19,20], and systematic structure-activity investigations toward understanding how variations in the structural components influence the gene transfection efficacies of cationic amphiphiles is still an intensely pursued area in non-viral gene delivery [21–23]. In a previous study, we synthesized Tween 85-polyethyleneimine (PEI) conjugate by [–(CH2)2–] (T2P), which showed obvious cellular uptake and transfection efficiency; however, the increased degree of transfection efficiency was much lower than that of cellular uptake, which could be due to the low lysosome escape ability [24]. In order to improve transfection efficiency and the lysosome escape ability further, six new Tween 85-PEI conjugates (TnPs, n = 3, 4, 5, 6, 7 and 8) with a flexible hydrophobic polymethylene spacer between Tween 85 and PEI were designed and compared with T2P. The polymethylene spacer was different in the chain length, varying from propanediyl to octanediyl, and its effect on cellular uptake, lysosome escape ability and finally transfection property was investigated. Then, the most effective TnPs were used as vectors to down-regulate p65 expression and block NF-jB signaling pathway, and the potency of inhibiting tumor growth and lymphatic metastasis was evaluated in MDA-MB-435 tumor-bearing mice. 2. Materials and methods 2.1. Materials Branched PEIs with average molecular weights of 2 and 25 kDa (PEI 2K and PEI 25K, respectively), 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) and ethidium bromide were obtained from Sigma (St Louis, MO). Tween 85, N-(3-dimethylaminopropyl)-N0 -ethylcarbodiimide hydrochloride (EDCI), 4-dimethylamiopryidine (DMAP) and N-hydroxybenzotriazole (HOBt) were purchased from Sinopharm Group Chemical Reagent Co., Ltd (Shanghai, China). Succinic anhydride, glutaric acid, adipic acid, pimelic acid, suberic acid, azelaic acid and sebacic acid were obtained from TCI (Shanghai, China). TOTO-3, Hoechst 33342 and LysoTracker Green were purchased from Molecular Probes (Eugene, OR). All the other reagents were of analytical grade. The pGPU6/Neo-GFP-expressing pDNA (pEGFP-N1) was purchased from Clontech (Palo Alto, CA, USA), pGPU6/Neo-p65 shRNA-expressing pDNA (p65 shRNA) that targets the sequence GCCCTATCCCTTTACGTCA and pGPU6/neo-nonsense shRNAexpressing pDNA (NS shRNA) that targets the sequence GTTCTCCGAACGTGTCACGT were obtained from GenePharm Co. Ltd (Shanghai, China). All pDNAs were amplified in the DH5a strain of Escherichia coli and purified with the Plasmid Mega Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. The purity was confirmed by Ultraviolet (UV) spectrophotometry (A260/A280) and the concentration was determined from the absorbance at 260 nm using a UV spectrophotometer (Shimadzu, Tokyo, Japan). 2.2. Cell culture Human breast cancer cell line MDA-MB-435, human microvascular endothelial cells (HMEC-1) and mouse embryonic fibroblasts NIH3T3 were obtained from the American Tissue Culture

2675

Collection (ATCC, Manassas, VA). MDA-MB-435 cells and HMEC-1 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) and MCDB131 medium, respectively, supplemented with 100 lg ml1 streptomycin, 100 U ml1 penicillin and 10% fetal bovine serum. NIH3T3 cells were grown in DMEM supplemented with 100 lg ml1 streptomycin, 100 U ml1 penicillin and 10% newborn calf serum. All cells were cultured in a humidified atmosphere containing 5% CO2 at 37 °C. 2.3. Animals 6-Week-old female nude mice (18–22 g) were purchased from Shanghai Experimental Animal Center (Shanghai, China) and kept under a 12 h light/dark cycle at the Animal Care Facility. Mice were given daily fresh diet with free access to water and acclimatized for at least 5 days prior to the experiments. The in vivo experiments were carried out under the guideline approved by the Institutional Animal Care and Use Committee (IACUC) of the Shanghai Institute of Materia Medica, Chinese Academy of Sciences. 2.4. Synthesis and characterization of TnPs All TnPs were synthesized essentially applying the same synthetic steps as depicted in Fig. 1A. As a representative experimental detail, synthesis of T6P was described below; the other TnPs were synthesized following the same two-step protocols as described for the synthesis of T6P using the appropriate diacid.  Step 1: Tween 85 (200 mg, 0.1 mmol), suberic acid (21.1 mg, 0.11 mmol), EDCI (54.8 mg, 0.28 mmol) and DMAP (34.9 mg, 0.28 mmol) were dissolved in anhydrous acetonitrile-tetrahydrofuran (1:1, v/v) and reacted under stirring for 2 days at 37 °C. The reaction mixture was then concentrated by rotary evaporation, and dialyzed against 95% ethanol for 2 days. After that, ethanol was evaporated, and the product Tween 85-COOH was dried under vacuum.  Step 2: Tween 85-COOH (199.2 mg, 0.10 mmol), PEI 2K (100 mg, 0.05 mmol), EDCI (24.9 mg, 0.13 mmol) and HOBt (17.6 mg, 0.13 mmol) were dissolved in anhydrous acetonitrile-ethanol (1:1, v/v) and reacted at room temperature for 12 h. The reaction solution was then concentrated and dialyzed against 95% ethanol for 2 days. T6P was obtained after removing the solvent under reduced pressure and drying under vacuum. The structures of TnPs were confirmed by proton nuclear magnetic resonance (1H NMR) recorded on a Varian Mercury Plus-400 NMR spectrometer (Varian, USA) operated at 400 MHz, and the graft ratio, the number of Tween 85 chains conjugated to per PEI molecule, was calculated according to the 1H NMR. The cytotoxicity of TnPs against MDA-MB-435 cells was determined by MTT assay. Briefly, MDA-MB-435 cells seeded in a 96-well plate (5  103 cells per well) were treated with various concentrations of TnPs for 48 h. Then, 20 ll of MTT solution (5 mg ml1) was added to each well and incubated for an additional 4 h. After that, the medium was removed, and 150 ll dimethyl sulfoxide was added to cells to dissolve the MTT formazan crystals. Absorbance at 570 nm was recorded using a microplate reader (Tecan, Durham, NC), and cell viability was expressed as the percentage of absorbance relative to that of control experiments without treatment. 2.5. Preparation and characterization of TnPs/pEGFP-N1 complex nanoparticles TnPs/pEGFP-N1 complex nanoparticles (TnPNs) with the required N/P ratio were prepared by adding 100 ll of pEGFP-N1

2676

J. Xiao et al. / Acta Biomaterialia 10 (2014) 2674–2683

Fig. 1. (A) Schematic of the synthetic steps for TnPs. (B) 1H NMR spectra of TnPs. (C) Viability of MDA-MB-435 cells after treatment with TnPs at different concentrations for 48 h.

(0.2 mg ml1) in pure water dropwise to different amounts of TnPs under vortexing, followed by standing for 30 min at room temperature. As a control, PEI 25K/pEGFP-N1 complex nanoparticles (PPNs) were also prepared by the same process as described for TnPNs above. Agarose gel retardation assay was performed to confirm the formation of the complex nanoparticles. Briefly, TnPNs at different N/ P ratios, premixed with 6 gel-loading buffer, were loaded onto a 0.8% (w/v) agarose gel containing ethidium bromide (0.5 mg ml1 of gel) in tris-acetate-ethylenediaminetetraacetic acid buffer and subjected to electrophoresis for 25 min at 90 V. The pDNA migration pattern was revealed under a UV illuminator and photographed using a bioimage system (UVP, Upland, CA). The particle size and zeta potential of TnPNs at an N/P ratio of 10 were assessed by laser light scattering (DLS) using a Zetasizer (ZS90, Malvern, Worcestershire, UK) equipped with a 633 nm He–Ne laser. After equilateral dilution with pure water and 300 mM NaCl, the freshly prepared nanoparticles were measured at 25 °C with a scatter angle of 90°. The data were obtained with the average of three measurements. The toxic effect of the complex nanoparticles was also determined. After incubation with a series of concentrations of TnPNs for 48 h, the viability of MDA-MB-435 cell was then measured using the MTT method.

transfected with PPNs (optimum N/P ratio of 10) with the same procedure as TnPNs and used as a positive control. 2.7. Cellular uptake pEGFP-N1 was first fluorescently labeled with TOTO-3 at the ratio of 1 nM dye molecule lg1 pEGFP-N1, and then complexed with TnPs. MDA-MB-435 cells seeded in a 24-well plate were incubated with TOTO-3 labeled TnPNs (N/P ratio of 10) at 2 lg pEGFP-N1 per well for 2 h. Cells were then collected and washed twice with phosphate buffered saline (PBS). The cellular uptake of complex nanoparticles was investigated by the FACSCalibur system. TOTO-3 labeled PPNs at an N/P ratio of 10 was used as control. 2.8. Intracellular localization MDA-MB-435 cells seeded on 10 mm2 glass coverslips placed in a 24-well plate were incubated with TOTO-3 labeled TnPNs or PPNs (N/P ratios of 10) at 2 lg pEGFP-N1/well for 1.5 h, followed by staining with Hoechst 33342 and LysoTracker Green for an additional 0.5 h at 37 °C in darkness. After the medium was removed, cells were washed twice with PBS and fixed with 4% paraformaldehyde for 30 min. Then, cells were mounted on glass slides with 3 ll of MobiGlow (MoBiTec, Goettingen, Germany), and visualized using confocal microscope (FluoView™ FV1000, Olympus).

2.6. In vitro transfection 2.9. Western blot analysis MDA-MB-435 cells seeded in a 24-well plate (1  104 cells per well) were incubated with TnPNs (N/P ratio of 10) at 2 lg pEGFP-N1 per well for 4 h. The medium was then replaced with fresh medium, and cells were further incubated for 48 h. The EGFP expressing cells were visualized using a fluorescence inversion microscope system (Olympus, Japan) and quantified by FACSCalibur system (BD Biosciences, Oxford, UK). Cells were also

MDA-MB-435 cells transfected with T6P/p65 shRNA complex nanoparticles (T6Ns) or T6P/NS shRNA complex nanoparticles (T6nNs) for 24 h were harvested, washed and lysed. Equal amounts of proteins were separated on a 10% SDS-polyacrylamide gel and transferred onto nitrocellulose membranes (Millipore, Billerica, MA, USA). The proteins were identified by incubation with primary

J. Xiao et al. / Acta Biomaterialia 10 (2014) 2674–2683

antibodies against p65, matrix metalloprotease 2 (MMP2), matrix metalloprotease 9 (MMP9) and b-actin (Abcam, Cambridge, UK), followed by incubation with horseradish-peroxidase-conjugated secondary antibody (Beyotime Biotechnology, Jiangsu, China). The detection was performed using the enhanced chemiluminescence system (Pierce, Rockford, IL, USA) according to the manufacturer’s protocol.

2677

equation: V = (major axis)  (minor axis)2/2. Body weight was simultaneously measured. After 5 weeks, mice were sacrificed and the tumors and lymph nodes were excised, photographed and weighted. For the evaluation of liver function, the livers were also collected, fixed in 10% formalin and embedded in paraffin. The paraffin-embedded tissues were then sectioned at 5 lm thickness and stained with hematoxylin and eosin (H&E) for histopathological examination.

2.10. Cell proliferation and apoptosis analysis For cell proliferation assay, MDA-MB-435 cells seeded in a 96-well plate were treated with T6nNs and T6Ns at the concentration of 0.5 lg shRNA per well for 48 h. Then, cell viability was determined by MTT assay. For apoptosis analysis, MDA-MB-435 cells seeded in a 24-well plate were transfected with T6nNs or T6Ns for 48 h and then stained with Hoechst 33342 in the dark at 37 °C for 30 min. The nuclear morphology was observed using a fluorescence inversion microscope system. To quantify the number of apoptotic cells, treated cells were harvested, washed twice with ice-cold PBS, stained with Annexin V-FITC and prodium iodide (PI) following the manufacturer’s instructions and analyzed using FACSCalibur (BD Biosciences, Oxford, UK). 2.11. In vitro invasion MDA-MB-435 cells transfected with T6Ns or T6nNs for 24 h were trypsinized and suspended in serum-free medium. 100 ll of the cell suspension (1  105 cells) was added to the upper chambers of transwell coated with Matrigel (BD Biosciences), and 500 ll NIH3T3 conditioned medium was added to the lower chamber as chemoattractant. After incubation for 24 h, cells in upper wells were removed with a cotton swab, while cells that passed through the filters into the lower wells were fixed with 90% ethanol, stained with crystal violet and photographed using a fluorescence inversion microscope. For quantification, cells were counted under a microscope in five predetermined fields, and data were expressed as the percentage of those passed through the membrane relative to the number of non-transfected cells through the membrane. 2.12. Biodistribution The MDA-MB-435 tumor model was generated by orthotopic injection of 5  106 cells in 50 ll DMEM medium into the mammary fat pad of the mice, and the tumor was allowed to grow to 100 mm3 before experiment. To know the biodistribution, TOTO-3 labeled T6Ns were equilaterally diluted with 300 mM NaCl and injected to the mice bearing MDA-MB-435 tumor via tail vein at a dose of 2 mg shRNA kg1. Mice were sacrificed at 15 min, 1, 2, 4 and 24 h after injection, the heart, liver, spleen, lung, kidney and tumor were excised, washed with cold saline and homogenized in 1 ml saline, followed by centrifugation at 10,000 rpm for 5 min. After that, 100 ll of the supernatant was added to a black 96-well plate and the content of T6Ns in each tissue was obtained by measuring the fluorescence intensity (excitation/emission: 480/520) using a microplate reader. 2.13. In vivo anti-metastasis Mice bearing MDA-MB-435 tumors were randomly divided into three groups (n = 6) and administered intravenously every other day with saline, T6Ns and T6nNs (2 mg shRNA kg1), respectively, for 5 weeks (T6Ns and T6nNs were equilaterally diluted with 300 mM NaCl before injection). At various time intervals, tumor volume was measured and calculated using the following

2.14. Statistical analysis All values were expressed as mean ± SD and each value is the mean of at least three repetitive experiments in each group. The student’s t-test was performed to test the significance of the difference between two groups. 3. Results and discussion 3.1. Synthesis and characterization of TnPs TnPs with different chain length polymethylene spacers were synthesized by the conventional condensation reaction. The hydroxyl group of Tween 85 was first converted to the carboxyl group through reacting with appropriate diacid with a catalytic amount of EDCI and DMAP for 48 h; then, the carboxyl-terminated Tween 85 was conjugated with PEI 2K in the presence of EDCI and HOBt for 12 h. The structure of all the synthetic TnPs was confirmed by 1 H NMR (Fig. 1B). The presence of the characteristic resonances of oleate in Tween 85 (0.9 and 1.2–1.4 ppm) and PEI 2K (2.4– 3.0 ppm) indicated the successful linkage between Tween 85 and PEI 2K. In addition, all TnPs exhibited similar graft ratios, which were 1.76, 1.77, 1.71, 1.78 and 1.73 for T2P, T3P, T4P, T5P and T6P, respectively. Fig. 1C showed the viability of MDA-MB-435 cells after incubating for 48 h with different concentrations of TnPs. All TnPs showed no obvious cytotoxicity at the concentration of 1 lg ml1, as indicated by the high cell viability (100%). When the concentration was increased, cell viability decreased gradually, demonstrating the concentration-dependent cytotoxicity of TnPs. However, the cell viability was still as high as 80% when the concentration of TnPs was 10 lg ml1 (the concentration used in the in vitro transfection experiments). These results indicated that TnPs were virtually nontoxic at the concentration used for the transfection experiments. Furthermore, TnPs with a longer spacer (n > 6) were also synthesized and investigated for their cytotoxicity against MDA-MB-435 cells. Unfortunately, the results showed that TnPs with a longer spacer (n > 6) displayed relatively higher cytotoxicity than those with a shorter spacer (n 6 6), and were not suitable for transfection; therefore, TnPs with a longer spacer (n > 6) were not further examined in the following experiments. 3.2. Physicochemical characteristics of TnPNs To characterize the electrostatic binding interactions between the plasmid DNA and TnPs as a function of different N/P charge ratios, a gel retardation assay was performed (Fig. 2A). All TnPs showed a high ability to condense pEGFP-N1, with completely retardation of pEGFP-N1 at an N/P ratio of 1.5. The high condensing effect of TnPs could be attributed to the oleate chains in Tween 85, which was reported to be able to enhance the condensation capability of PEI [25,26]. In addition, the polymethylene spacers could fold in a way that facilitated the interaction with pDNA, thereby binding pDNA more efficiently. The particle size and zeta potential of TnPNs in water and in 150 mM NaCl are shown in Fig. 2B and C, respectively. The mean

2678

J. Xiao et al. / Acta Biomaterialia 10 (2014) 2674–2683

Fig. 2. (A) Agarose gel electrophoresis of TnPNs at various N/P ratios. (B) Particle size and (C) zeta potential of TnPNs in water and 150 mM NaCl. (D) Viability of MDA-MB-435 cells incubated with TnPNs for 48 h.

particle size of TnPNs in water was 140 nm, and the spacer length did not affect the particle size of complex nanoparticles. After dilution with NaCl, the particle size slightly deceased to 120 nm. The particle size of TnPNs was beneficial for tumor-targeting delivery, which was large enough to avoid renal filtration and small enough to penetrate through the leaky vasculatures in the tumor region,

while reducing reticuloendothelial system (RES)-mediated clearance [27]. All TnPNs showed high zeta potential of nearly 50 mV in water; however, the zeta potential significantly decreased to 15 mV after dilution with NaCl. The slight positive surface charge could also facilitate the accumulation in the tumor due to their high affinity for negatively charged functional groups

Fig. 3. (A) Fluorescent images and (B) quantitative analysis of MDA-MB-435 cells transfected with PPNs and TnPNs (scale bar: 50 lm). (C) Quantitative analysis of cellular uptake of PPNs and TnPNs after 2 h incubation.

J. Xiao et al. / Acta Biomaterialia 10 (2014) 2674–2683

2679

over-expressed on the angiogenic endothelial cells [28], as well as decreased interaction with negatively charged serum proteins and blood cells. In addition, the positive zeta potential could also benefit the interaction with the negatively charged cell membrane, thereby enhancing cellular uptake [29]. Given that the cytotoxicity of complex nanoparticles is more relevant and important to transfection, the cytotoxicity of TnPNs at different DNA concentration was also evaluated in the MDAMB-435 cells (Fig. 2D). After treatment with TnPNs for 48 h, most of the cells still remained viable, with over 80% cell viability at the concentration used for the following experiments (4 lg DNA ml1). The results demonstrated that the complex nanoparticles were virtually biosafe at the concentration used for the transfection experiments.

by flow cytometric analysis, and both the mean fluorescence intensity and the number of transfected cells were considered (Fig. 3B). The results were consistent with the fluorescent images, and all TnPs were more effective than PEI 25K. The mean fluorescence intensity and the number of transfected cells all increased with increasing spacer chain length. In the case of T3P, T4P and T5P, although the mean fluorescence intensity was comparable to that of T6P, the number of transfecting cells was relatively lower, indicating that they could transfect a considerably smaller amount of pDNA than T6P. In contrast, the number of transfected cells in the case of T6P was as high as 75%, which was significantly higher than that of T3P (52%), T4P (59%) and T5P (62%) (P < 0.001), demonstrating that T6P was the most effective transfection reagent.

3.3. In vitro transfection

3.4. In vitro cellular uptake

In order to find out the most effective formulation, the in vitro gene transfection efficiency was measured in MDA-MB-435 cells. The preliminary experiment showed that all TnPNs displayed the highest transfection efficiency at an N/P ratio of 10 (data not shown). Hence, the transfection efficiencies of TnPNs at an N/P ratio of 10 were intercompared. In the microscopic images (Fig. 3A), the amount of green fluorescence from EGFP in cells transfected with TnPNs was significantly more than that incubated with PPNs and increased with the increase in spacer chain length. Specifically, cells treated with T6PNs showed the most numerous and brightest green fluorescence, indicating that T6P possessed the highest transfection activity. The transfection efficiency was further quantified

The capacity of TnPs to internalize pDNA into cells was performed using TOTO-3 labeled pEGFP-N1 on MDA-MB-435 cells and compared with PEI 25K (Fig. 3C). The cellular uptake of PPNs was relatively low, while TnPs significantly increased the cellular uptake of pDNA, and the cellular uptake was increased with an increase in the spacer length. Specifically, the mean fluorescence intensity in cells treated with T6PNs was as high as 55.6, which was markedly higher than that of other TnPNs. Additionally, T6PNs were internalized by 97% cells. Tween 80 was reported to have a fusogenic property that could enhance the fluidity of the cell membrane [30]. Tween 85 could also have the fusogenic property, thereby increasing the internalization of TnPNs. The differences in

Fig. 4. Confocal microscopic images of MDA-MB-435 cells incubated with PPNs and TnPNs for 2 h (scale bar: 20 lm). White circles represent the complex nanoparticles that were trapped in lysosome.

2680

J. Xiao et al. / Acta Biomaterialia 10 (2014) 2674–2683

the cellular uptake of TnPNs might be due to their different fusogenic ability, resulting from the different spacer length. 3.5. Intracellular localization As indicated in Fig. 4, the confocal microscopic images of MDAMB-435 cells after incubation with PPNs and TnPNs showed that PPNs had the lowest cellular uptake, and most of the red fluorescence derived from TOTO-3 labeled PPNs was colocalized with the green fluorescence derived from LysoTracker Green, indicating that most of internalized PPNs were trapped in the lysosome. On the contrary, the cellular uptake of TnPNs increased with the increase of spacer length, and T6PNs exhibited the highest cellular uptake. In addition, the ability of TnPNs to escape from lysosome

was also related to the spacer length. The internalized T2PNs were almost localized in the lysosome. With the increase in spacer length, the amount of complex nanoparticles localized in lysosome decreased gradually, and the amount escaped from lysosome increased. Specifically, most of internalized T6PNs were localized in cytoplasm, suggesting that T6PNs possessed the highest lysosome escape ability. Although details of transfection pathways are still incompletely understood, the crucial steps include: (1) the formation of electrostatic complex nanoparticles between polyanionic macromolecules (genes) and the positively charged vectors; (2) endocytotic internalization of the resulting complex nanoparticles; (3) escape of the pDNA from the endosome compartment to the cell cytoplasm; and (4) nuclear trafficking of the endosomally released pDNA to access the nuclear transcription apparatus before

Fig. 5. (A) Expression of p65, MMP2 and MMP9 in MDA-MB-435 cells transfected with T6nNs and T6Ns. (B) Viability of MDA-MB-435 cells after transfection with T6nNs and T6Ns. ⁄⁄⁄P < 0.001 (n = 3) compared with control (non-transfected cells). (C) Nuclear morphologic analysis of MDA-MB-435 cells exposed to T6nNs and T6Ns for 48 h (scale bar: 50 lm). (D) Quantitative analysis of apoptotic MDA-MB-435 cells induced by T6nNs and T6Ns. (E) Quantitative analysis and (F) microscopy images of MDA-MB-435 cells that passed through the membrane after transfection with T6nNs or T6Ns (scale bar: 200 lm). ⁄⁄⁄P < 0.001 (n = 5) compared with control (non-transfected cells).

J. Xiao et al. / Acta Biomaterialia 10 (2014) 2674–2683

the final transgene expression in cytosol [31–33]. T6P could effectively condense pDNA, significantly increase the cellular uptake and enhance the lysosome escape of pDNA, thereby showing the highest transfection activity. 3.6. Cell proliferation and apoptosis analysis Accumulating evidence has implicated NF-jB as a positive mediator of cell growth. NF-jB can promote tumor cell proliferation through regulating numerous cytokines and growth factors. In this study, the effect of T6Ns on cell proliferation was investigated by MTT assay. As shown in Fig. 5A, the expression of p65 in MDA-MB-435 cells was obviously decreased by T6Ns, but not by T6nNs. As a result, the proliferation of MDA-MB-435 cells transfected with T6Ns was significantly inhibited (50% inhibition), while T6nNs did not show any inhibition on the proliferation of MDA-MB-435 cells, indicating that the complex nanoparticles were non-toxic, and the decrease on the cell viability resulted from the down-regulation of p65 (Fig. 5B). Activation of NF-jB has been reported to be associated with resistance to apoptosis. To investigate whether the blockade of the NF-jB signaling pathway by T6Ns could induce cell apoptosis, the nuclear morphology was observed using a fluorescence inversion microscope system. After incubating with T6Ns, most of cells appeared to have apoptotic morphology, as shown by marked changes in nuclear morphology. In contrast, cells exposed to T6nNs showed no visible apoptosis characteristics after 48 h compared with untreated cells, indicating that T6nNs could not induce cell apoptosis (Fig. 5C). These results further proved that the effect of T6Ns on cell functions was due to the specific down-regulation of p65 rather than the toxicity of T6P. The apoptotic cells were further quantified by Annexin V/PI staining and flow cytometric analysis (Fig. 5D). The results showed that T6Ns significantly induced cell apoptosis, resulting in 55.2% apoptosis (both early stage and late stage). 3.7. In vitro invasion Cell invasion, involving the detachment of tumor cells from the primary site, controlled degradation of structural barriers, such as basement membrane and extracellular matrix, and migration of cells through the degraded matrix, is one of the fundamental steps in the metastatic process of a tumor [34,35]. This process is regulated by numerous gene products, including matrix metalloproteinases (MMPs), urinary plasminogen activator (uPA), interleukin-8 (IL-8) and other chemokines, which are all further regulated by NF-jB [36–38], and the inhibition of the NF-jB

Fig. 6. Quantitative analysis for the biodistribution of T6Ns at 15 min, 1, 2, 4 and 24 h after intravenous administration.

2681

signaling pathway could impair cancer cell invasion [39–41]. Thus, T6P was used as a vector of p65 shRNA to block the NF-jB signaling pathway, thereby inhibiting tumor metastasis. Western blot analysis showed that T6Ns significantly down-regulated the expression of MMP2 and MMP9 in MDA-MB-435 cells (Fig. 5A). As a result, the invasion activity of MDA-MB-435 cells was dramatically decreased after transfection with T6Ns, and the number of cells that passed through the membrane was only 10% of that of non-transfected cells. However, T6nNs did not affect the invasion activity of MDA-MB-435 cells due to the lack of effect on the expression of MMP2 and MMP9 (Fig. 5E and F). 3.8. Biodistribution The tissue distribution of T6Ns in tumor-bearing mice was investigated at 15 min, 1, 2, 4 and 24 h after intravenous administration. As shown in Fig. 6, T6Ns could rapidly distribute to tumor tissue, and the content of T6Ns in the tumor region increased with the extension of time. At 2 h post-administration, the content of T6Ns in tumor tissue reached the maximum, and then slightly decreased over time. In addition, high content of T6Ns was also observed in the liver and kidney, because of the high circulating blood passing through these organs, as well as the unavoidable uptake by the RES in these organs. However, the complex nanoparticles showed relatively low distribution in all organs, and the tumor accumulation exhibited a sharp decrease between 2 and 4 h. The relatively low distribution in all organs could be because part of the complex nanoparticles remained in circulation and did not distribute to organs. The elimination of complex nanoparticles from mice would also induce the relatively low distribution in organs and the sharp decrease in tumor accumulation. Furthermore, the degradation of T6P in tumor tissue would lead to the rapid release of TOTO-3, which was then cleared away, thereby resulting in the rapid decrease of the fluorescence signal. The quick release of shRNA from the complex nanoparticles in tumor tissue would be beneficial for transfection and the down-regulation of p65, thereby resulting in the high antitumor effect in vivo. 3.9. In vivo anti-metastasis The capacity of T6Ns to inhibit the growth and metastasis of a tumor in vivo was evaluated in mice bearing MDA-MB-435 tumors. T6nNs showed no obvious effect on the tumor growth; on the contrary, T6Ns resulted in significant inhibition of tumor growth over a 5-week time period. At the end of the experiment, the tumor volume and weight of T6Ns-treated group were only 1.76% and 0.37% of the saline group, respectively (Fig. 7A–C). The excellent inhibitory effect of T6Ns on tumor growth could be attributed to the efficient accumulation in the tumor site and the high interference efficiency on the p65 expression, which led to the significant inhibition of cell proliferation and induction of cell apoptosis, and subsequently suppression of tumor development. Body weight changes in all mouse groups, as an indicator of systemic toxicity, were also measured (Fig. 7D). The body weight of mice in T6Nsand T6nNs-treated groups did not differ obviously from that of the control, indicating that the complex nanoparticles did not exhibit severe systemic toxicity. Since the complex nanoparticles showed a high accumulation in liver, histopathological evaluation was performed at the end of the experiment to investigate the hepatotoxicity. As shown in Fig. 7E, no acute pathological change was observed in microscopic examination of liver slices, suggesting that the complex nanoparticles did not affect liver function. Metastasis is very common at the later stages of breast cancer, and usually occurs via the blood and/or the lymphatic routes. At 35 days after treatment, the lymph nodes of the saline group and T6nNs-treated group were all enlarged; in contrast, the lymph

2682

J. Xiao et al. / Acta Biomaterialia 10 (2014) 2674–2683

Fig. 7. (A) Tumor growth rate of saline-, T6nNs- and T6Ns-treated groups. (B) Tumor pictures and (C) relative tumor weight of saline-, T6nNs- and T6Ns-treated group at the end of experiment. (D) Body weight change of tumor-bearing mice treated with saline, T6nNs and T6Ns. (E) Histopathological examination of liver separated from saline-, T6nNs- and T6Ns-treated mice at the end of experiment (scale bar: 100 lm). (F) Lymph node pictures and (G) relative lymph node weight of saline-, T6nNs- and T6Ns-treated group at the end of experiment. ⁄P < 0.05 and ⁄⁄⁄P < 0.001 (n = 6) compared with control (saline group).

nodes of the T6Ns-treated group showed no obvious enlargement and the mean lymph node weight of the T6Ns-treated group was only 0.66% of the saline group (Fig. 7F and G), indicating that T6Ns could significantly inhibit the lymphatic metastasis of breast cancer induced by MDA-MB-435 cells. T6Ns could significantly decrease the expression of genes that promote tumor growth and metastasis through blocking NF-jB activity, which resulted in the significant inhibition of cell proliferation and invasion, thereby excellent creating an anti-metastatic effect in vivo.

4. Conclusion Seven TnPs with different polymethylene spacer length between Tween 85 and PEI were synthesized, and the effects of spacer length on cellular uptake, lysosome escape ability and transfection efficiency were evaluated. The cellular uptake and lysosome escape ability all increased with the increase of spacer chain length; therefore, the transfection efficiency was also positively related to the spacer chain length. T6P with highest

J. Xiao et al. / Acta Biomaterialia 10 (2014) 2674–2683

transfection activity could effectively deliver p65 shRNA into metastatic tumor cells and significantly down-regulate p65 expression, leading to remarkable inhibition of cell invasion and suppression of tube formation. Furthermore, T6Ns showed the high accumulation in tumor tissue and a high anti-metastasis effect in vivo. Acknowledgments The National Basic Research Program of China (2010CB934000 and 2013CB932503), the National Natural Science Foundation of China (81230029, 81270047) and Shanghai Program (12nm 0501300) are gratefully acknowledged for financial support. Appendix A. Figures with essential color discrimination Certain figures in this article, particularly Figs. 1–7, are difficult to interpret in black and white. The full color images can be found in the on-line version, at http://dx.doi.org/10.1016/j.actbio.2014. 02.009. References [1] Christofori G. New signals from the invasive front. Nature 2006;441:444–50. [2] Ran S, Volk L, Hall K, Flister MJ. Lymphangiogenesis and lymphatic metastasis in breast cancer. Pathophysiology 2010;17:229–51. [3] Hogan BV, Peter MB, Shenoy H, Horgan K, Shaaban A. Intramammary lymph node metastasis predicts poorer survival in breast cancer patients. Surg Oncol 2010;19:11–6. [4] Shen J, Hunt KK, Mirza NQ, Krishnamurthy S, Singletary SE, Kuerer HM, et al. Intramammary lymph node metastases are an independent predictor of poor outcome in patients with breast carcinoma. Cancer 2004;101:1330–7. [5] Tan W, Zhang W, Strasner A, Grivennikov S, Cheng JQ, Hoffman RM, et al. Tumour-infiltrating regulatory T cells stimulate mammary cancer metastasis through RANKL-RANK signalling. Nature 2011;470:548–53. [6] Meylan E, Dooley AL, Feldser DM, Shen L, Turk E, Ouyang C, et al. Requirement for NF-jB signalling in a mouse model of lung adenocarcinoma. Nature 2009;462:104–7. [7] Pikarsky E, Porat RM, Stein I, Abramovitch R, Amit S, Kasem S, et al. NF-kappa B functions as a tumour promoter in inflammation-associated cancer. Nature 2004;431:461–6. [8] Wu Y, Deng J, Rychahou PG, Qiu S, Evers BM, Zhou BP. Stabilization of snail by NF-jB is required for inflammation-induced cell migration and invasion. Cancer Cell 2009;15:416–28. [9] Park BK, Zhang H, Zeng Q, Dai J, Keller ET, Giordano T, et al. NF-kappa B in breast cancer cells promotes osteolytic bone metastasis by inducing osteoclastogenesis via GM-CSF. Nat Med 2007;13:62–9. [10] Huang S, DeGuzman A, Bucana CD, Fidler IJ. Nuclear factor-jB activity correlates with growth, angiogenesis, and metastasis of human melanoma cells in nude mice. Clin Cancer Res 2000;6:2573–81. [11] Lerebours F, Vacher S, Andrieu C, Espie M, Marty M, Lidereau R, et al. NF-kappa B genes have a major role in inflammatory breast cancer. BMC Cancer 2008;8:41–51. [12] Ahmed A. Prognostic and therapeutic role of nuclear factor-kappa B (NFkappaB) in breast cancer. J Ayub Med Coll 2010;22:218–21. [13] Watari K, Nakao S, Fotovati A, Basaki Y, Hosoi F, Bereczky B, et al. Role of macrophages in inflammatory lymphangiogenesis: enhanced production of vascular endothelial growth factor C and D through NF-jB activation. Biochem Biophys Res Commun 2008;377:826–31. [14] Srinivas R, Samanta S, Chaudhuri A. Cationic amphiphiles: promising carriers of genetic materials in gene therapy. Chem Soc Rev 2009;38:3326–38. [15] Srujan M, Chandrashekhar V, Reddy RC, Prabhakar R, Sreedhar B, Chaudhuri A. The influence of the structural orientation of amide linkers on the serum compatibility and lung transfection properties of cationic amphiphiles. Biomaterials 2011;32:5231–40. [16] Sen J, Chaudhuri A. Gene transfer efficacies of novel cationic amphiphiles with alanine, b-alanine, and serine headgroups: a structureactivity investigation. Bioconjugate Chem 2005;16:903–12.

2683

[17] Singh RS, Chaudhuri A. Single additional methylene group in the head-group region imparts high gene transfer efficacy to a transfection-incompetent cationic lipid. FEBS Lett 2004;556:86–90. [18] Heyes JA, Niculescu-Duvaz D, Cooper RG, Springer CJ. Synthesis of novel cationic lipids: effect of structural modification on the efficiency of gene transfer. J Med Chem 2001;45:99–114. [19] Ghosh YK, Visweswariah SS, Bhattacharya S. Nature of linkage between the cationic headgroup and cholesteryl skeleton controls gene transfection efficiency. FEBS Lett 2000;473:341–4. [20] Fichert T, Regelin A, Massing U. Synthesis and transfection properties of novel non-toxic monocationic lipids. Variation of lipid anchor, spacer and head group structure. Bioorg Med Chem Lett 2000;10:787–91. [21] Niculescu-Duvaz D, Heyes J, Springer CJ. Structure-activity relationship in cationic lipid mediated gene transfection. Curr Med Chem 2003;10:1233–61. [22] Koynova R, Tenchov B. Cationic lipids: molecular structure/transfection activity relationships and interactions with biomembranes. In: Bielke W, Erbacher C, editors. Nucleic acid transfection. Berlin: Springer Verlag; 2010. p. 51–93. [23] Ma K, Hu M, Qi Y, Qiu L, Jin Y, Yu J, et al. Structure-transfection activity relationships with glucocorticoid-polyethyl-enimine conjugate nuclear gene delivery systems. Biomaterials 2009;30:3780–9. [24] Xiao J, Duan X, Yin Q, Chen L, Zhang Z, Li Y. Low molecular weight polyethylenimine-graft-Tween 85 for effective gene delivery: synthesis and in vitro characteristics. Bioconjugate Chem 2011;23:222–31. [25] Neamnark A, Suwantong O, Bahuadur RKC, Hsu CYM, Supaphol P, Uludag˘ H. Aliphatic lipid substitution on 2 kDa polyethylenimine improves plasmid delivery and transgene expression. Mol Pharm 2009;6:1798–815. [26] Alshamsan A, Haddadi A, Incani V, Samuel J, Lavasanifar A, Uludag˘ H. Formulation and delivery of siRNA by oleic acid and stearic acid modified polyethylenimine. Mol Pharm 2008;6:121–33. [27] Duan X, Li Y. Physicochemical characteristics of nanoparticles affect circulation, biodistribution, cellular internalization, and trafficking. Small 2013;9:1521–32. [28] Dicheva BM, ten Hagen TLM, Li L, Schipper D, Seynhaeve ALB, van Rhoon GC, et al. Cationic thermosensitive liposomes: a novel dual targeted heat-triggered drug delivery approach for endothelial and tumor cells. Nano Lett 2012;13:2324–31. [29] He C, Hu Y, Yin L, Tang C, Yin C. Effects of particle size and surface charge on cellular uptake and biodistribution of polymeric nanoparticles. Biomaterials 2010;31:3657–66. [30] Liu F, Yang J, Huang L, Liu D. New cationic lipid formulations for gene transfer. Pharm Res 1996;13:1856–60. [31] Tros de Ilarduya C, Sun Y, Düzgünesß N. Gene delivery by lipoplexes and polyplexes. Eur J Pharm Sci 2010;40:159–70. [32] Karmali PP, Majeti BK, Sreedhar B, Chaudhuri A. In vitro gene transfer efficacies and serum compatibility profiles of novel mono-, di-, and tri-histidinylated cationic transfection lipids: a structureactivity investigation. Bioconjugate Chem 2006;17:159–71. [33] Karmali PP, Kumar VV, Chaudhuri A. Design, syntheses and in vitro gene delivery efficacies of novel mono-, di- and trilysinated cationic lipids: a structureactivity investigation. J Med Chem 2004;47:2123–32. [34] Wittekind C, Neid M. Cancer invasion and metastasis. Oncology 2005;69:14–6. [35] Duffy MJ, McGowan PM, Gallagher WM. Cancer invasion and metastasis: changing views. J Pathol 2008;214:283–93. [36] Anand P, Kunnumakkara AB, Harikumar KB, Ahn KS, Badmaev V, Aggarwal BB. Modification of cysteine residue in p65 subunit of nuclear factor-jB (NF-jB) by picroliv suppresses NF-jB-regulated gene products and potentiates apoptosis. Cancer Res 2008;68:8861–70. [37] Zong H, Wang F, Fan Q-X, Wang L-X. Curcumin inhibits metastatic progression of breast cancer cell through suppression of urokinase-type plasminogen activator by NF-kappa B signaling pathways. Mol Biol Rep 2012;39:4803–8. [38] Huang S, Robinson JB, Deguzman A, Bucana CD, Fidler IJ. Blockade of nuclear factor-kappaB signaling inhibits angiogenesis and tumorigenicity of human ovarian cancer cells by suppressing expression of vascular endothelial growth factor and interleukin 8. Cancer Res 2000;60:5334–9. [39] Huang S, DeGuzman A, Bucana CD, Fidler IJ. Nuclear factor-kappaB activity correlates with growth, angiogenesis, and metastasis of human melanoma cells in nude mice. Clin Cancer Res 2000;6:2573–81. [40] Jang KW, Lee KH, Kim SH, Jin T, Choi EY, Jeon HJ, et al. Ubiquitin ligase CHIP induces TRAF2 proteasomal degradation and NF-kappaB inactivation to regulate breast cancer cell invasion. J Cell Biochem 2011;112:3612–20. [41] Huang S, Pettaway CA, Uehara H, Bucana CD, Fidler IJ. Blockade of NF-kappaB activity in human prostate cancer cells is associated with suppression of angiogenesis, invasion, and metastasis. Oncogene 2001;20:4188–97.