Biochemical and Biophysical Research Communications xxx (2017) 1e8
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells SunilGowda Sunnaghatta Nagaraja, Vishnuvarthan Krishnamoorthy, Raghavi Raviraj, Alagudinesh Paramasivam, Devipriya Nagarajan* Radiation Biology Lab, Anusandhan Kendra-II, School of Chemical and Biotechnology, SASTRA University, Thanjavur, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 September 2017 Accepted 5 October 2017 Available online xxx
Radiotherapy is used to treat tumors of different origins and nature, but often lead to development of radioresistance and metastasis of cells. Interestingly, radiation induces epithelial-mesenchymal transition (EMT), a process by which epithelial cells undergo mesenchymal phenotype and stimulates tumor progression capability. Our study investigated the effect of Trichostatin A (TSA), a natural derivate isolated from Streptomyces, upon radiation-induced lung EMT and we tried to understand the role of signaling molecules in irradiated lung cancer cells (A549). The cells were categorized into four groups: untreated control, radiation alone (R; 8Gy, X-ray), radiation combined with TSA (R þ T) and TSA (100nM). Radiation-induced lung EMT were evidenced by decreased expression of epithelial marker like E-cadherin, Zona occluden1 (ZO-1) and increased expression of N-cadherin and Vimentin. The Snail protein, a master regulator of EMT, was observed to be elevated after radiation treatment. In addition, TGF-b1 signaling (smad2, 3, and 4) proteins were activated upon irradiation. Western blot data were supported by the altered m-RNA expression of E-cadherin, TGF-b and Snail genes and this effect were reversed by TSA treatment. In addition to this, as supportive evidence, we performed docking studies between snail protein and TSA using Auto docking software and results suggested that less binding energy was needed for the putative binding of TSA on C-terminal domain of Snail protein. Based on our report, we suggest that TSA can effectively inhibit radiation-induced EMT (i) by altering epithelial and mesenchymal markers (ii) by modulating signaling molecules of TGFb1 pathway (iii) by inhibiting cancer cell migratory potential in A549 cells (iv)by effectively binding to Snail which is an enhancer of EMT. © 2017 Elsevier Inc. All rights reserved.
Keywords: Radiation EMT Trichostatin A TGFb1 Docking studies
1. Introduction Radiotherapy (RT) has been widely used in treatment of lung cancer as adjuvant with or without surgery and chemotherapy. Some of the limitations with radiotherapy is development of radioresistance [1] and metastasis of cells [2]. Epithelial-mesenchymal transition (EMT) is normal physiological process where the epithelial cells undergo differentiation into morphologically, nonpolar and motile mesenchymal cells [3] and have profound effect on metastasis and radioresistance [4]. There are reports for radiation-induced EMT in colorectal cancer [5] and prostate cancer [6]. EMT in cancer cells leads to change in expression pattern of
* Corresponding author. Radiation Biology Lab, Anusandhan Kendra-II, School of Chemical & Biotechnology, SASTRA University, Thanjavur, Tamil Nadu, 613401, India. E-mail address: [email protected] (D. Nagarajan).
epithelial phenotypic genes like E-cadherin which is decreased, whereas in case of mesenchymal phenotype there is an elevation in the expression of N-cadherin and Vimentin genes [7,8]. EMT is mediated by many transcriptional factors such as Snail, Twist and ZEB [9e11]. Radiation induces ROS generation via ERK, inactivates GSK3b signal which stimulates Snail mediated downstream effect on EMT in A549 cells by decreasing epithelial markers like E-cadherin and increasing mesenchymal markers like N-cadherin and Vimentin [12]. Thus, radiation causing metastatic effect on cancer cells turns to be a major problem and identification of novel inhibitors to block molecular pathways is receiving researcher's attention. Recent studies indicate that phytochemicals and some commercial derivatives are effective in blocking TGF-b induced EMT [5] [13,14]. In our current study, we tried to demonstrate the effect of Trichostatin A (TSA), a derivative isolated from Streptomyces sp. on radiation-induced EMT in lung cancer cells. TSA known for its anti-cancer activity by inhibiting histone
https://doi.org/10.1016/j.bbrc.2017.10.031 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
2
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
deactylases (HDACs) [15] and reports shows that TSA is effective in inhibiting EMT in HepG2 cells [16] and MDCK cells [17]. Still, research is not focused much to understand the effect of TSA on radiation-induced EMT in A549 cells. So, the main purpose of the study was to investigate the effect of TSA on EMT by evaluating EMT markers, signaling molecules and transcriptional factors in A549 cells. In order to know the interaction between the Snail protein and TSA, we used Auto dock software and the binding interactions between them was analyzed using appropriate tools. 2. Material and methods 2.1. Reagents and antibodies TSA was obtained from Merck Life sciences (India, cat. no.647925) and dissolved at concentration of 1mM in dimethyl sufloxide (DMSO; 0.1%) as a main stock and it was then diluted to working concentration with cell culture media. Rabbit monoclonal antibody against TGFb1 was purchased from Abclonal (USA, cat no e A2124). Vimentin, N-Cadherin, ZO-1, Snail, Slug, ZEB1, E-cadherin. Anti-rabbit IgG-HRP-linked antibody (#7074), phosphosmad2 (Ser465/467), Smad2, phospho-smad3 (Ser423/425), Smad3, Smad4 (#12747) were purchased from Cell Signaling (USA). GAPDH antibody (#SC-25778) was obtained from Santa Cruz biotechnology (USA).
mentioned above groups. A scratch was created after 2 h of treatment to wound the monolayer cultured cells in a 6-well plate using sterile 200ul pipette tip. Images of the wound were taken at 0 h, 12 h and 24 h after scratching using a digital camera mounted on an inverted microscope (Zeiss, Germany). 2.6. Protein extraction and western blot analysis Protein was extraction from cells was done by using RIPA lysis buffer containing 25mM Tris- HCL, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS, and pH 7.6 (G-biosciences, USA, cat no - #786-489) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF), 2mM sodium vandate, 5mM sodium fluoride and 20ul of protease arrest (G-Biosciences 100 cat no-786-108, USA). Lysate were centrifuged at 4 C at 12000 r/min for 20 min and protein concentration was quantified using Bradford kit (Himedia, India). 30 mg of protein was separated on 10-12% polyacrylamide gel and transferred to nitro-cellulose membranes. The membranes were blocked in 5% nonfat milk in TBST buffer (Tris Buffer Saline containing 0.1% Tween-20) for 1 h at room temperature, and incubated overnight with primary antibodies at 4 C. After washing with TBST buffer, the blots were incubated with HRP-conjugated secondary antibody for 1 h at room temperature and target proteins were detected by clarity western ECL kit (Biorad, USA). 2.7. RNA extraction and RT-q-PCR assay
2.2. Cell culture and irradiation A549 cells were obtained from NCCS (Pune, India) androutinely maintained in DMEM high glucose containing 10% bovine calf serum (FBS), 100 IU/mL penicillin and 100 mg/mL streptomycin (Gibco, Waltham, MA, USA) at 37 C with 5% CO2 in air. Once cells reached 60-80% confluence, the culture medium was replaced with serum-free medium for 24 h prior to irradiation and categorized into four groups: control (C), Radiation (RT), Radiation with TSA (RT þ TSA) and TSA (100nM). The cells were then irradiated with a single dose of 8 Gy X-rays using the LINAC at Vishnu cancer center (Thanjavur, Tamil nadu, India).
Total RNA was extracted using Trizol reagent (SRL. India) as per standard protocol. RNA concentration and quality was analyzed using a Nano drop e 2000 spectrophotometer (Thermo Fischer Scientific, USA). RNA (1 mg) was used as template for reverse transcription reaction (Takara Bio INC, Japan), followed by quantitative real-time RT-PCR analysis using specific primers (Primers designed using primer3 software and synthesized from integrated DNA technologies, USA) for the specific genes as follows in Table 1. Quantitative real time PCR (QRT-PCR) was carried out using SYBR green kit (Biorad, USA cat-1708882AP) according to the manufacturer's instructions. Q-PCR data was analyzed by DDCt method in terms of fold change by using b-actin as internal control.
2.3. Cell viability assay and TSA treatment 2.8. Virtual screening (docking methodology) The effect of TSA on cell viability was determined using MTT assay, around 104 cells per well were seeded in 96 well culture plates. After 24 h of incubation, the cells were treated with various concentration of TSA (0, 25, 50, 100, 200 nM) for 2 h and irradiation was performed. After 24 h of irradiation, cells were incubated with MTT (5mg/ml) for 2-4 hr at 37 C and 150ml of DMSO was added to dissolve the formazan crystals. Absorbance was read at 595nM. The cell viability percentage was determined by multiskan micro plate reader. Based on the above the effective concentration of TSA was fixed and further study on radiation-induced EMT was carried out. 2.4. Cell morphology analysis Cell morphology was images were taken in Inverted phase contrast microscope (IPC) (Zeiss, Germany) in Control, RT (radiation control), R þ T (radiation þ TSA) and TSA (100nM) group at 0 h and 24 h. To observe the morphology scanning electron microscope (SEM) (Jeol, USA) images were taken at SASTRA University, Thanjavur, Tamil nadu, India by processing through standard protocol as mentioned previously [18]. 2.5. Wound healing assay The cells were grown until 70- 80% confluent and treated as
Auto dock 4.1 was used for the docking studies in this experiments [17]. As the complete crystal structure of Snail is not available in the protein Data Bank and the complete structure was generated using the ROBETTA server (template- UniProtKB095863) [19]. The modeled structure was checked for geometry by PROCHECK analysis [20]. TSA structure was generated from the pubchem. H Yamasaki et al. [21], explains the role of carboxylterminal zinc finger domain of Snail and thus was enclosed carboxyl-terminal in a grid box of -13.156 25.085 X -26.483 grid points. The algorithm used for docking studies was Lamarckian genetic algorithm with default parameters. The cluster with highest number of conformation and least binding energy was chosen as the best binding site on Snail protein for TSA. Interactions were analyzed using Pymol software. 2.9. Statistical analysis All the experiments were repeated three times independently and expressed as mean ± SD. Statistical analysis was performed using Prism software (7.0 Graph pad, USA) and one-sample Student's t tests to compare the differences between the control and RT group (*), RT þ TSA group and RT group (#). A p value of 0.05 was considered as significant.
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
3
Table 1 List of forward and reverse primers for EMT related genes. Sl no
Gene (Homo sapiens)
Forward primer 50 - 30
Reverse primer 30 -50
1 2 3 4 5 6 7
E- cadherin N- cadherin Vimentin TGF- beta Snail ZEB1 b-actin
CAATGCCGCCATCGCTTAC GGCGTTATGTGTGTATCTTCACTG GGACCAGCTAACCAACGACA GGGACTATCCACCTGCAAGA GAGGACAGTGGGAAAGGCTC ACTGGGTGAGGTTGTCTCGGTA CTCTTCCAGCCTTCCTTCCT
ATGACTCCTGTGTTCCTGTTAATG TGGAAAGCTTCTCACGGCAT AAGGTCAAGACGTGCCAGAG CCTCCTTGGCGTAGTAGTCG TGGCTTCGGATGTGCATCTT AAAGGAAGACTGATGGCTGAAAT AGCACTGTGTTGGCGTACAG
3. Results 3.1. TSA inhibits the migratory abilities of A549 cells and reverses the radiation induced morphological change Wound healing assay showed an increased migratory potential of cancer cells in post radiation period, whereas TSA pretreatment for 2 h reverses the migration properties of the cancer cells when compared to the RT group. TSA (100nM) treated group showed similar changes as control group (Fig. 1, #*p < 0.05). Cell morphology observation on control group cells showed cuboidal
morphology while in RT group cells lose cell-cell contact, acquire mesenchymal phenotype. Upon TSA treatment prior to irradiation, the cells with mesenchymal phenotype were observed to be less when compared to that of radiation group. TSA 100nM treated group did not show any morphological changes when compared to control group (Fig. 2B&, #*p < 0.05). 3.2. TSA may reverse the radiation induced EMT in A549 cells MTT assay was performed after 24 h of TSA treatment followed by irradiation procedure. Different concentrations of TSA (5, 25, 50,
Fig. 1. Inhibition of migratory potential of irradiated A549 cells. (A)Confluent monolayer of A549 cells were grouped into control, RT group (8Gy), RT þ TSA group, TSA alone (100nM) group and scratched by using pipette tip. At 0, 12 and 24 h after irradiation cells were photographed using inverted phase contrast with camera (10). (B) The level of migration of cells were quantified as the wound area covered, average of three independent values with mean ± SD (#*P < 0.05).
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
4
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
Fig. 2. TSA modulates EMT like phenotype in A549 cells. (A) Cytotoxic effect of TSA on A549 cells by treating 0, 5, 25, 50, 100 nM of TSA for 24 h. (B) Cell morphology images (10) of control, RT, RT þ TSA and TSA (100nM) groups were taken after 24 h of irradiation and (C) quantified by counting the number of mesenchymal cells present per field (n ¼ 3, *p < 0.05).
RT þ TSA group reduced the snail and ZEB expression when compared to RT group (Fig. 4D and E, #*p < 0.05). The mRNA expression showed that Snail expression was increased in RT group compare to control group, while RT þ TSA comparatively regulated the expression of Snail (Fig. 4F). In q-PCR, there was increased expressions of Snail & ZEB expression in RT group upto 2 and 1.5 fold respectively in comparison to control group (Fig. 4C, #*p < 0.05).
100 and 200nM) were used and the cell viability and the IC50 value was calculated as the mean ± SD IC50 was 100.4 ± 104.4 nM (Fig. 2A, *p < 0.05). Western blot analysis revealed that the expression of epithelial marker like E-cadherin was decreased at 72hwhile Ncadherin was increased (cadherin switch) in RT group compared to control group. The expression of E-cadherin and N-cadherin was reversed in RT þ TSA group in comparison to RT group. Other epithelial markers like ZO-1 and b-catenin were observed to be reduced in RT group in comparison to control group, but the expression of ZO-1 and b-catenin in RT þ TSA group was increased in compared to RT group. Vimentin was elevated in RT group compared to control group which was decreased in RT þ TSA group (Fig. 3A and B, #*p < 0.05). Reverse transcriptase PCR and Real-time PCR for mRNA expression of E-cadherin was decreased at 72 h in RT group which was reversed in RT þ TSA group (Fig. 4A-C, #*p < 0.05). Similarly, the mRNA expression of N-cadherin was increased at 72 h in RT group when compared to control group while RT þ TSA group comparatively reduced the N-cadherin expression (Fig. 4A-C, #*p < 0.05). The q-PCR studies of Vimentin mRNA expression at 72 h in RT group increased by 3-fold when compared to control group and RT þ TSA comparatively reduced the effect of the RT (Fig. 4C, #*p < 0.05).
TGF-b expression was elevated in RT group while TSA treatment successfully decreased TGF-b expression. Smad proteins are downstream transcriptional factors of TGF-b in inducing EMT, reports suggested that radiation activated EMT via smad regulated TGF- b pathway in cancer cells [22e24]. Our results showed that psmad2 and p-smad3 of RT group were increased whereas TSA treatment decreased p-smad2 and p-smad3 expression. Smad4 another important transcriptional factor increased its expression in RT group, when compared to normal control group and TSA treated group (Fig. 5A&B, #*p < 0.05). In mRNA expression of TGF-b in qPCR was increased around 3- fold in RT group and decreased in RT þ TSA group (Fig. 4C, #*p < 0.05).
3.3. TSA may reverse the radiation induced transcriptional proteins which induces EMT in A549 cells
3.5. TSA likely to interact with snail protein and it has putative binding site on snail
Western blot results showed that expressions of Snail and ZEB were increased in 6 h of RT group compared to control group.
To know the complete molecular interactions between TSA and Snail protein molecular docking was carried in autodock (4.1) and
3.4. Radiation induced TGF-b/smad signaling in A549 cells was reversed by TSA
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
5
Fig. 3. Effect of TSA on radiation induced EMT markers. (A) Protein levels of E-cadherin, N-cadherin, Vimentin, ZO-1 and b-catenin was measured by western blotting. (B) Quantification of protein expression for various proteins (*#p < 0.05).
Fig. 4. Effect of TSA on radiation induced mRNA expression of EMT markers & relative protein expression of transcriptional factors. (A)mRNAexpression of E-cadherin and Ncadherin quantified by RT-PCR method (B) Semi-quantification of relative expression of mRNA level of E-cadherin and N-cadherin. (C) Relative expression of mRNA level of Ecadherin, N-cadherin, Vimentin, Snail, ZEB and TGF-b by q-PCR (fold range) by using b-actin as internal control (D)Protein levels of transcriptional factors: Snail & ZEB. (E)Relative protein expression of Snail & ZEB. (F) Semi-quantitative mRNA expression of Snail by RT-PCR and its relative qunatification (*#p < 0.05).
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
6
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
Fig. 5. Effect of TSA on radiation induced TGF-b1 pathway. (A) Protein level of TGF-b1, Smad2, p-Smad2, Smad3, p-Smad3 and Smad4 analyzed by western blotting. (B)Relative expression of protein TGF-b1, Smad2, p-Smad2, Smad3, p-Smad3 and Smad4. (C) Structure of TSA(D)TSA binding site displayed on C-terminal domain of Snail protein and residues constituting the Snail-TSA binding sites are shown. The residues such as 207-P (proline) 209-S (serine) and 220-R (arginine) are in hydrogen formation with TSA are shown.
complex were viewed by using Pymol. TSA structure was taken from pubchem (Fig. 5C). Docking analysis indicates that the residues of C-terminal domain of Snail protein constitutes the TSASnail binding site e C185, K187, H198, T201, H202, P-207, F208, S209, P2011, R220, L223, M248, H252, Q255 and E256. The three residues such as P207, S209 and R220 of Snail protein are in hydrogen bonding with the TSA as shown in (Fig. 5D). The results of binding energy of TSA with number of conformations, number of hydrogen bonds are shown in Table 2 as follows (*P. < 0.05). 4. Discussion During EMT, epithelial cells lose their markers such as E-cadherin and convert into spindle shaped mesenchymal cells by acquiring markers like N-cadherin [25], which allows the cancer cell to become more aggressive, metastatic and form a secondary metastasis [26]. In our previous study, we observed that radiation can induce morphological changes by modulating cuboidal lung epithelial cells to spindle shaped mesenchymal cell [12,27]. Ecadherin is required for the formation of stable adherens junction, and reduced expression levels of E-cadherin have been reported in various cancer cells, being associated with tumor progression and metastasis [28,29]. Araki et al. [30], have reported that E/N-cadherin switch mediates cancer progression via TGF-b induced epithelial-to-mesenchymal transition in extrahepatic cholangiocarcinoma. Transcription factors like Snail, Slug, ZEB1,
Twist, have been implicated in the control of EMT [9]. In our study, we observed that radiation increased N-cadherin, Snail, ZEB and decreased E-cadherin expression. Prevention of EMT is now considered an effective measure for the inhibition of cancer recurrence and migration. In our study, TSA pretreatment decreased transition of epithelial to mesenchymal morphology and also inhibited E/N-cadherin switch. In support of our data, X. Wang et al. [31] showed that TSA reverses EMT in colorectal cancer cells and prostate cancer cells by suppressing the invasion and migration of cancer cells. In another study with renal cells and hepatocytes, TSA exerted anti-EMT effects by decreasing TGF-b mediated EMT [32,33]. Snail, Slug and zinc-finger E-box-binding transcription factors (ZEB1 and ZEB2) are important regulators of E-cadherinand it was shown that all these factors confers tumor cells with cancer stem cell-like traits and promotes drug resistance, tumor recurrence and metastasis [34e36]. ZEB expression follows activation of Snail expression, represses E-cadherin genes and activates mesenchymal genes that define the EMT phenotype [36]. In our study we observed increased expression of Snail and ZEB proteins in irradiated A549 cells which was effectively decreased by TSA pretreatment. In support of our data, studies have shown that TSA inhibits epithelial mesenchymal transition induced by TGF-b1 in airway epithelium by decreasing the trascription factors like snail and slug [37]. Interestingly, our docking studies showed that TSA effectively binds with C-terminal domain of Snail by forming three hydrogen
Table 2 TSA and Snail interaction. S. no.
Binding energy (kcal/mol)
Number of hydrogen bonds
Residues forming hydrogen bond with TSA
1
3.32*
Three
207P (proline), 209S (serine) & 220R (arginine)
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
bonds with 207-proline, 209-serine, 220- arginine residues with minimum binding energy of -3.32(Kcal/mol). Based on the western blot, RT-PCR and docking studies, we suggest that TSA might directly bind with Snail protein and decrease binding efficiency of Snail on the promoter region of E-cadherin which might ultimately enhance the expression of E-cadherin and prevent expression of mesenchymal proteins. Stimulation of TGF-b1- leads to Smad2 phosphorylation and pSmad2 in complex with Smad4 will move to the nucleus in order to regulate the target genes [38]. We observed that radiation induced TGF-b1 which simulates stimulates its downstream molecules. TSA pretreatment inhibits the downstream proteins molecules like psmad2, p-smad3 and smad4 and acts as effective target in blocking EMT and helps to prevent the invasion of cancer cells [39]. On the whole, TSA pretreatment reversed radiation-induced morphological changes and altered the expression of epithelial and mesenchymal markers. TSA inhibited TGFb and its signaling molecules in irradiated A549 cells. Docking studies suggest that TSA by effectively binding with snail might enhance E-cadherin expression and there by maintaining epithelial architecture. Still, mechanistic investigations on other signaling molecules and understanding epigentic modification are still needed. Conflict of interest None. Acknowledgement This study was supported by Science and Engineering Research Board, Department of Science and Technology, Government of India (YSS/2014/000518) and Prof. T. R. Rajagopalan Fund, SASTRA University, Tamil Nadu, India (TRR/19/05/2015). We acknowledge Vishnu cancer center, Thanjavur, Tamil Nadu, India for providing Xray facility. Appendix A. Supplementary data Supplementary data related to this article can be found at https://doi.org/10.1016/j.bbrc.2017.10.031. References [1] T.B. Brunner, L.A. Kunz-Schughart, P. Grosse-Gehling, M. Baumann, Cancer stem cells as a predictive factor in radiotherapy, Semin. Radiat.Oncol 22 (2012) 151e174. [2] K. Polyak, R.A. Weinberg, Transitions between epithelial and mesenchymal states: acquisition of malignant and stem cell traits, Nat. Rev. Cancer 9 (2009) 265e273. [3] D. Kong, Y. Li, Z. Wang, F.H. Sarkar, Cancer stem cells and epithelial-tomesenchymal transition (EMT)-Phenotypic cells: are they cousins or twins? Cancers (Basel) 3 (2011) 716e729. [4] D.T. Marie-Egyptienne, I. Lohse, R.P. Hill, Cancer stem cells, the epithelial to mesenchymal transition (EMT) and radioresistance: potential role of hypoxia, Cancer Lett. 341 (2013) 63e72. [5] A. Kawamoto, T. Yokoe, K. Tanaka, S. Saigusa, Y. Toiyama, H. Yasuda, Y. Inoue, C. Miki, M. Kusunoki, Radiation induces epithelial-mesenchymal transition in colorectal cancer cells, Oncol. Rep. 27 (2012) 51e57. [6] S. Josson, C.S. Anderson, S.Y. Sung, P.A. Johnstone, H. Kubo, C.L. Hsieh, R. Arnold, M. Gururajan, C. Yates, L.W. Chung, Inhibition of ADAM9 expression induces epithelial phenotypic alterations and sensitizes human prostate cancer cells to radiation and chemotherapy, Prostate 71 (2011) 232e240. [7] R. Kalluri, R.A. Weinberg, The basics of epithelial-mesenchymal transition, J. Clin. Invest. 119 (2009) 1420e1428. [8] L. Chang, P.H. Graham, J. Hao, J. Ni, J. Bucci, P.J. Cozzi, J.H. Kearsley, Y. Li, Acquisition of epithelial-mesenchymal transition and cancer stem cell phenotypes is associated with activation of the PI3K/Akt/mTOR pathway in prostate cancer radioresistance, Cell Death Dis. 4 (2013) e875. [9] H. Peinado, D. Olmeda, A. Cano, Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat. Rev. Cancer 7 (2007) 415e428.
7
[10] E. Rosivatz, I. Becker, K. Specht, E. Fricke, B. Luber, R. Busch, H. Hofler, K.F. Becker, Differential expression of the epithelial-mesenchymal transition regulators snail, SIP1, and twist in gastric cancer, Am. J. Pathol. 161 (2002) 1881e1891. [11] M. Korpal, E.S. Lee, G. Hu, Y. Kang, The miR-200 family inhibits epithelialmesenchymal transition and cancer cell migration by direct targeting of Ecadherin transcriptional repressors ZEB1 and ZEB2, J. Biol. Chem. 283 (2008) 14910e14914. [12] D. Nagarajan, T. Melo, Z. Deng, C. Almeida, W. Zhao, ERK/GSK3beta/Snail signaling mediates radiation-induced alveolar epithelial-to-mesenchymal transition, Free Radic. Biol. Med. 52 (2012) 983e992. [13] Y. Chen, W. Liu, P. Wang, H. Hou, N. Liu, L. Gong, Y. Wang, K. Ji, L. Zhao, P. Wang, Halofuginone inhibits radiotherapy-induced epithelial-mesenchymal transition in lung cancer, Oncotarget 7 (2016) 71341e71352. [14] A.K. Reka, R. Kuick, H. Kurapati, T.J. Standiford, G.S. Omenn, V.G. Keshamouni, Identifying inhibitors of epithelial-mesenchymal transition by connectivity map-based systems approach, J. Thorac. Oncol. 6 (2011) 1784e1792. [15] H.J. Kim, S.C. Bae, Histone deacetylase inhibitors: molecular mechanisms of action and clinical trials as anti-cancer drugs, Am. J. Transl. Res. 3 (2011) 166e179. [16] Q.Q. Shi, G.W. Zuo, Z.Q. Feng, L.C. Zhao, L. Luo, Z.M. You, D.Y. Li, J. Xia, J. Li, D.L. Chen, Effect of trichostatin A on anti HepG2 liver carcinoma cells: inhibition of HDAC activity and activation of Wnt/beta-Catenin signaling, Asian pac. J. Cancer Prev. 15 (2014) 7849e7855. [17] G.M. Morris, D.S. Goodsell, R.S. Halliday, R. Huey, W.E. Hart, R.K. Belew, Automated docking using a lamarckian genetic algorithm and empirical binding free energy functions, J. Comput. Chem. 19 (1998) 1639e1662. [18] C. Heckman, S. Kanagasundaram, M. Cayer, J. Paige, Preparation of Cultured Cells for Scanning Electron Microscope, 2007. [19] H. Peinado, E. Ballestar, M. Esteller, A. Cano, Snail mediates E-cadherin repression by the recruitment of the Sin3A/histone deacetylase 1 (HDAC1)/ HDAC2 complex, Mol. Cell Biol. 24 (2004) 306e319. [20] R.A. Laskowski, M.W. MacArthur, D.S. Moss, J.M. Thornton, PROCHECK : a progtamme to check the sterochemical quality of protein structure, J. Appl. Crystallogr. 26 (1993) 283e291. [21] H. Yamasaki, T. Sekimoto, T. Ohkubo, T. Douchi, Y. Nagata, M. Ozawa, Y. Yoneda, Zinc finger domain of Snail functions as a nuclear localization signal for importin beta-mediated nuclear import pathway, Genes cells. 10 (2005) 455e464. [22] Y.Y. Sheen, M.J. Kim, S.A. Park, S.Y. Park, J.S. Nam, Targeting the transforming growth factor-beta signaling in, Cancer Ther. Biomol. Ther. Seoul. 21 (2013) 323e331. [23] A. Nakao, T. Imamura, S. Souchelnytskyi, M. Kawabata, A. Ishisaki, E. Oeda, K. Tamaki, J. Hanai, C.H. Heldin, K. Miyazono, P. ten Dijke, TGF-beta receptormediated signalling through Smad2, Smad3 and Smad4, EMBO J. 16 (1997) 5353e5362. [24] H.L. Grimes, T.O. Chan, P.A. Zweidler-McKay, B. Tong, P.N. Tsichlis, The Gfi-1 proto-oncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits G1 arrest induced by interleukin-2 withdrawal, Mol. Cell Biol. 16 (1996) 6263e6272. [25] J.P. Thiery, Epithelial-mesenchymal transitions in development and pathologies, Curr. Opin. Cell Biol. 15 (2003) 740e746. [26] T. Brabletz, F. Hlubek, S. Spaderna, O. Schmalhofer, E. Hiendlmeyer, A. Jung, T. Kirchner, Invasion and metastasis in colorectal cancer: epithelialmesenchymal transition, mesenchymal-epithelial transition, stem cells and beta-catenin, Cells Tissues Organs 179 (2005) 56e65. [27] C. Almeida, D. Nagarajan, J. Tian, S.W. Leal, K. Wheeler, M. Munley, W. Blackstock, W. Zhao, The role of alveolar epithelium in radiation-induced lung injury, PLoS One 8 (2013) e53628. [28] J.P. Thiery, H. Acloque, R.Y. Huang, M.A. Nieto, Epithelial-mesenchymal transitions in development and disease, Cell 139 (2009) 871e890. [29] M.A. Huber, N. Kraut, H. Beug, Molecular requirements for epithelialmesenchymal transition during tumor progression, Curr. Opin. Cell Biol. 17 (2005) 548e558. [30] K. Araki, T. Shimura, H. Suzuki, S. Tsutsumi, W. Wada, T. Yajima, T. Kobayahi, N. Kubo, H. Kuwano, E/N-cadherin switch mediates cancer progression via TGF-beta-induced epithelial-to-mesenchymal transition in extrahepatic cholangiocarcinoma, Br. J. Cancer 105 (2011) 1885e1893. [31] X. Wang, J. Xu, H. Wang, L. Wu, W. Yuan, J. Du, S. Cai, Trichostatin A, a histone deacetylase inhibitor, reverses epithelial-mesenchymal transition in colorectal cancer SW480 and prostate cancer PC3 cells, Biochem. Biophys. Res. Commun. 456 (2015) 320e326. [32] A. Kaimori, J.J. Potter, M. Choti, Z. Ding, E. Mezey, A.A. Koteish, Histone deacetylase inhibition suppresses the transforming growth factor beta1induced epithelial-to-mesenchymal transition in hepatocytes, Hepatology 52 (2010) 1033e1045. [33] M. Yoshikawa, K. Hishikawa, T. Marumo, T. Fujita, Inhibition of histone deacetylase activity suppresses epithelial-to-mesenchymal transition induced by TGF-beta1 in human renal epithelial cells, J. Am. Soc. Nephrol. 18 (2007) 58e65. [34] A. Cano, M.A. Perez-Moreno, I. Rodrigo, A. Locascio, M.J. Blanco, M.G. del Barrio, F. Portillo, M.A. Nieto, The transcription factor snail controls epithelialmesenchymal transitions by repressing E-cadherin expression, Nat. Cell Biol. 2 (2000) 76e83. [35] V. Bolos, H. Peinado, M.A. Perez-Moreno, M.F. Fraga, M. Esteller, A. Cano, The
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
8
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors, J. Cell Sci. 116 (2003) 499e511. [36] J. Comijn, G. Berx, P. Vermassen, K. Verschueren, L. van Grunsven, E. Bruyneel, M. Mareel, D. Huylebroeck, F. van Roy, The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion, Mol. Cell. 7 (2001) 1267e1278. [37] I.H. Park, J.H. Kang, J.M. Shin, H.M. Lee, Trichostatin a inhibits epithelial
mesenchymal transition induced by TGF-beta1 in airway epithelium, PLoS One 11 (2016) e0162058. [38] K. Tsuchida, M. Nakatani, K. Hitachi, A. Uezumi, Y. Sunada, H. Ageta, K. Inokuchi, Activin signaling as an emerging target for therapeutic interventions, Cell Commun. Signal 7 (2009) 15. [39] S. Lamouille, R. Derynck, Cell size and invasion in TGF-beta-induced epithelial to mesenchymal transition is regulated by activation of the mTOR pathway, J. Cell. Biol. 178 (2007) 437e451.
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells SunilGowda Sunnaghatta Nagaraja, Vishnuvarthan Krishnamoorthy, Raghavi Raviraj, Alagudinesh Paramasivam, Devipriya Nagarajan* Radiation Biology Lab, Anusandhan Kendra-II, School of Chemical and Biotechnology, SASTRA University, Thanjavur, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 September 2017 Accepted 5 October 2017 Available online xxx
Radiotherapy is used to treat tumors of different origins and nature, but often lead to development of radioresistance and metastasis of cells. Interestingly, radiation induces epithelial-mesenchymal transition (EMT), a process by which epithelial cells undergo mesenchymal phenotype and stimulates tumor progression capability. Our study investigated the effect of Trichostatin A (TSA), a natural derivate isolated from Streptomyces, upon radiation-induced lung EMT and we tried to understand the role of signaling molecules in irradiated lung cancer cells (A549). The cells were categorized into four groups: untreated control, radiation alone (R; 8Gy, X-ray), radiation combined with TSA (R þ T) and TSA (100nM). Radiation-induced lung EMT were evidenced by decreased expression of epithelial marker like E-cadherin, Zona occluden1 (ZO-1) and increased expression of N-cadherin and Vimentin. The Snail protein, a master regulator of EMT, was observed to be elevated after radiation treatment. In addition, TGF-b1 signaling (smad2, 3, and 4) proteins were activated upon irradiation. Western blot data were supported by the altered m-RNA expression of E-cadherin, TGF-b and Snail genes and this effect were reversed by TSA treatment. In addition to this, as supportive evidence, we performed docking studies between snail protein and TSA using Auto docking software and results suggested that less binding energy was needed for the putative binding of TSA on C-terminal domain of Snail protein. Based on our report, we suggest that TSA can effectively inhibit radiation-induced EMT (i) by altering epithelial and mesenchymal markers (ii) by modulating signaling molecules of TGFb1 pathway (iii) by inhibiting cancer cell migratory potential in A549 cells (iv)by effectively binding to Snail which is an enhancer of EMT. © 2017 Elsevier Inc. All rights reserved.
Keywords: Radiation EMT Trichostatin A TGFb1 Docking studies
1. Introduction Radiotherapy (RT) has been widely used in treatment of lung cancer as adjuvant with or without surgery and chemotherapy. Some of the limitations with radiotherapy is development of radioresistance [1] and metastasis of cells [2]. Epithelial-mesenchymal transition (EMT) is normal physiological process where the epithelial cells undergo differentiation into morphologically, nonpolar and motile mesenchymal cells [3] and have profound effect on metastasis and radioresistance [4]. There are reports for radiation-induced EMT in colorectal cancer [5] and prostate cancer [6]. EMT in cancer cells leads to change in expression pattern of
* Corresponding author. Radiation Biology Lab, Anusandhan Kendra-II, School of Chemical & Biotechnology, SASTRA University, Thanjavur, Tamil Nadu, 613401, India. E-mail address: [email protected] (D. Nagarajan).
epithelial phenotypic genes like E-cadherin which is decreased, whereas in case of mesenchymal phenotype there is an elevation in the expression of N-cadherin and Vimentin genes [7,8]. EMT is mediated by many transcriptional factors such as Snail, Twist and ZEB [9e11]. Radiation induces ROS generation via ERK, inactivates GSK3b signal which stimulates Snail mediated downstream effect on EMT in A549 cells by decreasing epithelial markers like E-cadherin and increasing mesenchymal markers like N-cadherin and Vimentin [12]. Thus, radiation causing metastatic effect on cancer cells turns to be a major problem and identification of novel inhibitors to block molecular pathways is receiving researcher's attention. Recent studies indicate that phytochemicals and some commercial derivatives are effective in blocking TGF-b induced EMT [5] [13,14]. In our current study, we tried to demonstrate the effect of Trichostatin A (TSA), a derivative isolated from Streptomyces sp. on radiation-induced EMT in lung cancer cells. TSA known for its anti-cancer activity by inhibiting histone
https://doi.org/10.1016/j.bbrc.2017.10.031 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
2
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
deactylases (HDACs) [15] and reports shows that TSA is effective in inhibiting EMT in HepG2 cells [16] and MDCK cells [17]. Still, research is not focused much to understand the effect of TSA on radiation-induced EMT in A549 cells. So, the main purpose of the study was to investigate the effect of TSA on EMT by evaluating EMT markers, signaling molecules and transcriptional factors in A549 cells. In order to know the interaction between the Snail protein and TSA, we used Auto dock software and the binding interactions between them was analyzed using appropriate tools. 2. Material and methods 2.1. Reagents and antibodies TSA was obtained from Merck Life sciences (India, cat. no.647925) and dissolved at concentration of 1mM in dimethyl sufloxide (DMSO; 0.1%) as a main stock and it was then diluted to working concentration with cell culture media. Rabbit monoclonal antibody against TGFb1 was purchased from Abclonal (USA, cat no e A2124). Vimentin, N-Cadherin, ZO-1, Snail, Slug, ZEB1, E-cadherin. Anti-rabbit IgG-HRP-linked antibody (#7074), phosphosmad2 (Ser465/467), Smad2, phospho-smad3 (Ser423/425), Smad3, Smad4 (#12747) were purchased from Cell Signaling (USA). GAPDH antibody (#SC-25778) was obtained from Santa Cruz biotechnology (USA).
mentioned above groups. A scratch was created after 2 h of treatment to wound the monolayer cultured cells in a 6-well plate using sterile 200ul pipette tip. Images of the wound were taken at 0 h, 12 h and 24 h after scratching using a digital camera mounted on an inverted microscope (Zeiss, Germany). 2.6. Protein extraction and western blot analysis Protein was extraction from cells was done by using RIPA lysis buffer containing 25mM Tris- HCL, 150mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS, and pH 7.6 (G-biosciences, USA, cat no - #786-489) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF), 2mM sodium vandate, 5mM sodium fluoride and 20ul of protease arrest (G-Biosciences 100 cat no-786-108, USA). Lysate were centrifuged at 4 C at 12000 r/min for 20 min and protein concentration was quantified using Bradford kit (Himedia, India). 30 mg of protein was separated on 10-12% polyacrylamide gel and transferred to nitro-cellulose membranes. The membranes were blocked in 5% nonfat milk in TBST buffer (Tris Buffer Saline containing 0.1% Tween-20) for 1 h at room temperature, and incubated overnight with primary antibodies at 4 C. After washing with TBST buffer, the blots were incubated with HRP-conjugated secondary antibody for 1 h at room temperature and target proteins were detected by clarity western ECL kit (Biorad, USA). 2.7. RNA extraction and RT-q-PCR assay
2.2. Cell culture and irradiation A549 cells were obtained from NCCS (Pune, India) androutinely maintained in DMEM high glucose containing 10% bovine calf serum (FBS), 100 IU/mL penicillin and 100 mg/mL streptomycin (Gibco, Waltham, MA, USA) at 37 C with 5% CO2 in air. Once cells reached 60-80% confluence, the culture medium was replaced with serum-free medium for 24 h prior to irradiation and categorized into four groups: control (C), Radiation (RT), Radiation with TSA (RT þ TSA) and TSA (100nM). The cells were then irradiated with a single dose of 8 Gy X-rays using the LINAC at Vishnu cancer center (Thanjavur, Tamil nadu, India).
Total RNA was extracted using Trizol reagent (SRL. India) as per standard protocol. RNA concentration and quality was analyzed using a Nano drop e 2000 spectrophotometer (Thermo Fischer Scientific, USA). RNA (1 mg) was used as template for reverse transcription reaction (Takara Bio INC, Japan), followed by quantitative real-time RT-PCR analysis using specific primers (Primers designed using primer3 software and synthesized from integrated DNA technologies, USA) for the specific genes as follows in Table 1. Quantitative real time PCR (QRT-PCR) was carried out using SYBR green kit (Biorad, USA cat-1708882AP) according to the manufacturer's instructions. Q-PCR data was analyzed by DDCt method in terms of fold change by using b-actin as internal control.
2.3. Cell viability assay and TSA treatment 2.8. Virtual screening (docking methodology) The effect of TSA on cell viability was determined using MTT assay, around 104 cells per well were seeded in 96 well culture plates. After 24 h of incubation, the cells were treated with various concentration of TSA (0, 25, 50, 100, 200 nM) for 2 h and irradiation was performed. After 24 h of irradiation, cells were incubated with MTT (5mg/ml) for 2-4 hr at 37 C and 150ml of DMSO was added to dissolve the formazan crystals. Absorbance was read at 595nM. The cell viability percentage was determined by multiskan micro plate reader. Based on the above the effective concentration of TSA was fixed and further study on radiation-induced EMT was carried out. 2.4. Cell morphology analysis Cell morphology was images were taken in Inverted phase contrast microscope (IPC) (Zeiss, Germany) in Control, RT (radiation control), R þ T (radiation þ TSA) and TSA (100nM) group at 0 h and 24 h. To observe the morphology scanning electron microscope (SEM) (Jeol, USA) images were taken at SASTRA University, Thanjavur, Tamil nadu, India by processing through standard protocol as mentioned previously [18]. 2.5. Wound healing assay The cells were grown until 70- 80% confluent and treated as
Auto dock 4.1 was used for the docking studies in this experiments [17]. As the complete crystal structure of Snail is not available in the protein Data Bank and the complete structure was generated using the ROBETTA server (template- UniProtKB095863) [19]. The modeled structure was checked for geometry by PROCHECK analysis [20]. TSA structure was generated from the pubchem. H Yamasaki et al. [21], explains the role of carboxylterminal zinc finger domain of Snail and thus was enclosed carboxyl-terminal in a grid box of -13.156 25.085 X -26.483 grid points. The algorithm used for docking studies was Lamarckian genetic algorithm with default parameters. The cluster with highest number of conformation and least binding energy was chosen as the best binding site on Snail protein for TSA. Interactions were analyzed using Pymol software. 2.9. Statistical analysis All the experiments were repeated three times independently and expressed as mean ± SD. Statistical analysis was performed using Prism software (7.0 Graph pad, USA) and one-sample Student's t tests to compare the differences between the control and RT group (*), RT þ TSA group and RT group (#). A p value of 0.05 was considered as significant.
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
3
Table 1 List of forward and reverse primers for EMT related genes. Sl no
Gene (Homo sapiens)
Forward primer 50 - 30
Reverse primer 30 -50
1 2 3 4 5 6 7
E- cadherin N- cadherin Vimentin TGF- beta Snail ZEB1 b-actin
CAATGCCGCCATCGCTTAC GGCGTTATGTGTGTATCTTCACTG GGACCAGCTAACCAACGACA GGGACTATCCACCTGCAAGA GAGGACAGTGGGAAAGGCTC ACTGGGTGAGGTTGTCTCGGTA CTCTTCCAGCCTTCCTTCCT
ATGACTCCTGTGTTCCTGTTAATG TGGAAAGCTTCTCACGGCAT AAGGTCAAGACGTGCCAGAG CCTCCTTGGCGTAGTAGTCG TGGCTTCGGATGTGCATCTT AAAGGAAGACTGATGGCTGAAAT AGCACTGTGTTGGCGTACAG
3. Results 3.1. TSA inhibits the migratory abilities of A549 cells and reverses the radiation induced morphological change Wound healing assay showed an increased migratory potential of cancer cells in post radiation period, whereas TSA pretreatment for 2 h reverses the migration properties of the cancer cells when compared to the RT group. TSA (100nM) treated group showed similar changes as control group (Fig. 1, #*p < 0.05). Cell morphology observation on control group cells showed cuboidal
morphology while in RT group cells lose cell-cell contact, acquire mesenchymal phenotype. Upon TSA treatment prior to irradiation, the cells with mesenchymal phenotype were observed to be less when compared to that of radiation group. TSA 100nM treated group did not show any morphological changes when compared to control group (Fig. 2B&, #*p < 0.05). 3.2. TSA may reverse the radiation induced EMT in A549 cells MTT assay was performed after 24 h of TSA treatment followed by irradiation procedure. Different concentrations of TSA (5, 25, 50,
Fig. 1. Inhibition of migratory potential of irradiated A549 cells. (A)Confluent monolayer of A549 cells were grouped into control, RT group (8Gy), RT þ TSA group, TSA alone (100nM) group and scratched by using pipette tip. At 0, 12 and 24 h after irradiation cells were photographed using inverted phase contrast with camera (10). (B) The level of migration of cells were quantified as the wound area covered, average of three independent values with mean ± SD (#*P < 0.05).
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
4
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
Fig. 2. TSA modulates EMT like phenotype in A549 cells. (A) Cytotoxic effect of TSA on A549 cells by treating 0, 5, 25, 50, 100 nM of TSA for 24 h. (B) Cell morphology images (10) of control, RT, RT þ TSA and TSA (100nM) groups were taken after 24 h of irradiation and (C) quantified by counting the number of mesenchymal cells present per field (n ¼ 3, *p < 0.05).
RT þ TSA group reduced the snail and ZEB expression when compared to RT group (Fig. 4D and E, #*p < 0.05). The mRNA expression showed that Snail expression was increased in RT group compare to control group, while RT þ TSA comparatively regulated the expression of Snail (Fig. 4F). In q-PCR, there was increased expressions of Snail & ZEB expression in RT group upto 2 and 1.5 fold respectively in comparison to control group (Fig. 4C, #*p < 0.05).
100 and 200nM) were used and the cell viability and the IC50 value was calculated as the mean ± SD IC50 was 100.4 ± 104.4 nM (Fig. 2A, *p < 0.05). Western blot analysis revealed that the expression of epithelial marker like E-cadherin was decreased at 72hwhile Ncadherin was increased (cadherin switch) in RT group compared to control group. The expression of E-cadherin and N-cadherin was reversed in RT þ TSA group in comparison to RT group. Other epithelial markers like ZO-1 and b-catenin were observed to be reduced in RT group in comparison to control group, but the expression of ZO-1 and b-catenin in RT þ TSA group was increased in compared to RT group. Vimentin was elevated in RT group compared to control group which was decreased in RT þ TSA group (Fig. 3A and B, #*p < 0.05). Reverse transcriptase PCR and Real-time PCR for mRNA expression of E-cadherin was decreased at 72 h in RT group which was reversed in RT þ TSA group (Fig. 4A-C, #*p < 0.05). Similarly, the mRNA expression of N-cadherin was increased at 72 h in RT group when compared to control group while RT þ TSA group comparatively reduced the N-cadherin expression (Fig. 4A-C, #*p < 0.05). The q-PCR studies of Vimentin mRNA expression at 72 h in RT group increased by 3-fold when compared to control group and RT þ TSA comparatively reduced the effect of the RT (Fig. 4C, #*p < 0.05).
TGF-b expression was elevated in RT group while TSA treatment successfully decreased TGF-b expression. Smad proteins are downstream transcriptional factors of TGF-b in inducing EMT, reports suggested that radiation activated EMT via smad regulated TGF- b pathway in cancer cells [22e24]. Our results showed that psmad2 and p-smad3 of RT group were increased whereas TSA treatment decreased p-smad2 and p-smad3 expression. Smad4 another important transcriptional factor increased its expression in RT group, when compared to normal control group and TSA treated group (Fig. 5A&B, #*p < 0.05). In mRNA expression of TGF-b in qPCR was increased around 3- fold in RT group and decreased in RT þ TSA group (Fig. 4C, #*p < 0.05).
3.3. TSA may reverse the radiation induced transcriptional proteins which induces EMT in A549 cells
3.5. TSA likely to interact with snail protein and it has putative binding site on snail
Western blot results showed that expressions of Snail and ZEB were increased in 6 h of RT group compared to control group.
To know the complete molecular interactions between TSA and Snail protein molecular docking was carried in autodock (4.1) and
3.4. Radiation induced TGF-b/smad signaling in A549 cells was reversed by TSA
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
5
Fig. 3. Effect of TSA on radiation induced EMT markers. (A) Protein levels of E-cadherin, N-cadherin, Vimentin, ZO-1 and b-catenin was measured by western blotting. (B) Quantification of protein expression for various proteins (*#p < 0.05).
Fig. 4. Effect of TSA on radiation induced mRNA expression of EMT markers & relative protein expression of transcriptional factors. (A)mRNAexpression of E-cadherin and Ncadherin quantified by RT-PCR method (B) Semi-quantification of relative expression of mRNA level of E-cadherin and N-cadherin. (C) Relative expression of mRNA level of Ecadherin, N-cadherin, Vimentin, Snail, ZEB and TGF-b by q-PCR (fold range) by using b-actin as internal control (D)Protein levels of transcriptional factors: Snail & ZEB. (E)Relative protein expression of Snail & ZEB. (F) Semi-quantitative mRNA expression of Snail by RT-PCR and its relative qunatification (*#p < 0.05).
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
6
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
Fig. 5. Effect of TSA on radiation induced TGF-b1 pathway. (A) Protein level of TGF-b1, Smad2, p-Smad2, Smad3, p-Smad3 and Smad4 analyzed by western blotting. (B)Relative expression of protein TGF-b1, Smad2, p-Smad2, Smad3, p-Smad3 and Smad4. (C) Structure of TSA(D)TSA binding site displayed on C-terminal domain of Snail protein and residues constituting the Snail-TSA binding sites are shown. The residues such as 207-P (proline) 209-S (serine) and 220-R (arginine) are in hydrogen formation with TSA are shown.
complex were viewed by using Pymol. TSA structure was taken from pubchem (Fig. 5C). Docking analysis indicates that the residues of C-terminal domain of Snail protein constitutes the TSASnail binding site e C185, K187, H198, T201, H202, P-207, F208, S209, P2011, R220, L223, M248, H252, Q255 and E256. The three residues such as P207, S209 and R220 of Snail protein are in hydrogen bonding with the TSA as shown in (Fig. 5D). The results of binding energy of TSA with number of conformations, number of hydrogen bonds are shown in Table 2 as follows (*P. < 0.05). 4. Discussion During EMT, epithelial cells lose their markers such as E-cadherin and convert into spindle shaped mesenchymal cells by acquiring markers like N-cadherin [25], which allows the cancer cell to become more aggressive, metastatic and form a secondary metastasis [26]. In our previous study, we observed that radiation can induce morphological changes by modulating cuboidal lung epithelial cells to spindle shaped mesenchymal cell [12,27]. Ecadherin is required for the formation of stable adherens junction, and reduced expression levels of E-cadherin have been reported in various cancer cells, being associated with tumor progression and metastasis [28,29]. Araki et al. [30], have reported that E/N-cadherin switch mediates cancer progression via TGF-b induced epithelial-to-mesenchymal transition in extrahepatic cholangiocarcinoma. Transcription factors like Snail, Slug, ZEB1,
Twist, have been implicated in the control of EMT [9]. In our study, we observed that radiation increased N-cadherin, Snail, ZEB and decreased E-cadherin expression. Prevention of EMT is now considered an effective measure for the inhibition of cancer recurrence and migration. In our study, TSA pretreatment decreased transition of epithelial to mesenchymal morphology and also inhibited E/N-cadherin switch. In support of our data, X. Wang et al. [31] showed that TSA reverses EMT in colorectal cancer cells and prostate cancer cells by suppressing the invasion and migration of cancer cells. In another study with renal cells and hepatocytes, TSA exerted anti-EMT effects by decreasing TGF-b mediated EMT [32,33]. Snail, Slug and zinc-finger E-box-binding transcription factors (ZEB1 and ZEB2) are important regulators of E-cadherinand it was shown that all these factors confers tumor cells with cancer stem cell-like traits and promotes drug resistance, tumor recurrence and metastasis [34e36]. ZEB expression follows activation of Snail expression, represses E-cadherin genes and activates mesenchymal genes that define the EMT phenotype [36]. In our study we observed increased expression of Snail and ZEB proteins in irradiated A549 cells which was effectively decreased by TSA pretreatment. In support of our data, studies have shown that TSA inhibits epithelial mesenchymal transition induced by TGF-b1 in airway epithelium by decreasing the trascription factors like snail and slug [37]. Interestingly, our docking studies showed that TSA effectively binds with C-terminal domain of Snail by forming three hydrogen
Table 2 TSA and Snail interaction. S. no.
Binding energy (kcal/mol)
Number of hydrogen bonds
Residues forming hydrogen bond with TSA
1
3.32*
Three
207P (proline), 209S (serine) & 220R (arginine)
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
bonds with 207-proline, 209-serine, 220- arginine residues with minimum binding energy of -3.32(Kcal/mol). Based on the western blot, RT-PCR and docking studies, we suggest that TSA might directly bind with Snail protein and decrease binding efficiency of Snail on the promoter region of E-cadherin which might ultimately enhance the expression of E-cadherin and prevent expression of mesenchymal proteins. Stimulation of TGF-b1- leads to Smad2 phosphorylation and pSmad2 in complex with Smad4 will move to the nucleus in order to regulate the target genes [38]. We observed that radiation induced TGF-b1 which simulates stimulates its downstream molecules. TSA pretreatment inhibits the downstream proteins molecules like psmad2, p-smad3 and smad4 and acts as effective target in blocking EMT and helps to prevent the invasion of cancer cells [39]. On the whole, TSA pretreatment reversed radiation-induced morphological changes and altered the expression of epithelial and mesenchymal markers. TSA inhibited TGFb and its signaling molecules in irradiated A549 cells. Docking studies suggest that TSA by effectively binding with snail might enhance E-cadherin expression and there by maintaining epithelial architecture. Still, mechanistic investigations on other signaling molecules and understanding epigentic modification are still needed. Conflict of interest None. Acknowledgement This study was supported by Science and Engineering Research Board, Department of Science and Technology, Government of India (YSS/2014/000518) and Prof. T. R. Rajagopalan Fund, SASTRA University, Tamil Nadu, India (TRR/19/05/2015). We acknowledge Vishnu cancer center, Thanjavur, Tamil Nadu, India for providing Xray facility. Appendix A. Supplementary data Supplementary data related to this article can be found at https://doi.org/10.1016/j.bbrc.2017.10.031. References [1] T.B. Brunner, L.A. Kunz-Schughart, P. Grosse-Gehling, M. Baumann, Cancer stem cells as a predictive factor in radiotherapy, Semin. Radiat.Oncol 22 (2012) 151e174. [2] K. Polyak, R.A. Weinberg, Transitions between epithelial and mesenchymal states: acquisition of malignant and stem cell traits, Nat. Rev. Cancer 9 (2009) 265e273. [3] D. Kong, Y. Li, Z. Wang, F.H. Sarkar, Cancer stem cells and epithelial-tomesenchymal transition (EMT)-Phenotypic cells: are they cousins or twins? Cancers (Basel) 3 (2011) 716e729. [4] D.T. Marie-Egyptienne, I. Lohse, R.P. Hill, Cancer stem cells, the epithelial to mesenchymal transition (EMT) and radioresistance: potential role of hypoxia, Cancer Lett. 341 (2013) 63e72. [5] A. Kawamoto, T. Yokoe, K. Tanaka, S. Saigusa, Y. Toiyama, H. Yasuda, Y. Inoue, C. Miki, M. Kusunoki, Radiation induces epithelial-mesenchymal transition in colorectal cancer cells, Oncol. Rep. 27 (2012) 51e57. [6] S. Josson, C.S. Anderson, S.Y. Sung, P.A. Johnstone, H. Kubo, C.L. Hsieh, R. Arnold, M. Gururajan, C. Yates, L.W. Chung, Inhibition of ADAM9 expression induces epithelial phenotypic alterations and sensitizes human prostate cancer cells to radiation and chemotherapy, Prostate 71 (2011) 232e240. [7] R. Kalluri, R.A. Weinberg, The basics of epithelial-mesenchymal transition, J. Clin. Invest. 119 (2009) 1420e1428. [8] L. Chang, P.H. Graham, J. Hao, J. Ni, J. Bucci, P.J. Cozzi, J.H. Kearsley, Y. Li, Acquisition of epithelial-mesenchymal transition and cancer stem cell phenotypes is associated with activation of the PI3K/Akt/mTOR pathway in prostate cancer radioresistance, Cell Death Dis. 4 (2013) e875. [9] H. Peinado, D. Olmeda, A. Cano, Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nat. Rev. Cancer 7 (2007) 415e428.
7
[10] E. Rosivatz, I. Becker, K. Specht, E. Fricke, B. Luber, R. Busch, H. Hofler, K.F. Becker, Differential expression of the epithelial-mesenchymal transition regulators snail, SIP1, and twist in gastric cancer, Am. J. Pathol. 161 (2002) 1881e1891. [11] M. Korpal, E.S. Lee, G. Hu, Y. Kang, The miR-200 family inhibits epithelialmesenchymal transition and cancer cell migration by direct targeting of Ecadherin transcriptional repressors ZEB1 and ZEB2, J. Biol. Chem. 283 (2008) 14910e14914. [12] D. Nagarajan, T. Melo, Z. Deng, C. Almeida, W. Zhao, ERK/GSK3beta/Snail signaling mediates radiation-induced alveolar epithelial-to-mesenchymal transition, Free Radic. Biol. Med. 52 (2012) 983e992. [13] Y. Chen, W. Liu, P. Wang, H. Hou, N. Liu, L. Gong, Y. Wang, K. Ji, L. Zhao, P. Wang, Halofuginone inhibits radiotherapy-induced epithelial-mesenchymal transition in lung cancer, Oncotarget 7 (2016) 71341e71352. [14] A.K. Reka, R. Kuick, H. Kurapati, T.J. Standiford, G.S. Omenn, V.G. Keshamouni, Identifying inhibitors of epithelial-mesenchymal transition by connectivity map-based systems approach, J. Thorac. Oncol. 6 (2011) 1784e1792. [15] H.J. Kim, S.C. Bae, Histone deacetylase inhibitors: molecular mechanisms of action and clinical trials as anti-cancer drugs, Am. J. Transl. Res. 3 (2011) 166e179. [16] Q.Q. Shi, G.W. Zuo, Z.Q. Feng, L.C. Zhao, L. Luo, Z.M. You, D.Y. Li, J. Xia, J. Li, D.L. Chen, Effect of trichostatin A on anti HepG2 liver carcinoma cells: inhibition of HDAC activity and activation of Wnt/beta-Catenin signaling, Asian pac. J. Cancer Prev. 15 (2014) 7849e7855. [17] G.M. Morris, D.S. Goodsell, R.S. Halliday, R. Huey, W.E. Hart, R.K. Belew, Automated docking using a lamarckian genetic algorithm and empirical binding free energy functions, J. Comput. Chem. 19 (1998) 1639e1662. [18] C. Heckman, S. Kanagasundaram, M. Cayer, J. Paige, Preparation of Cultured Cells for Scanning Electron Microscope, 2007. [19] H. Peinado, E. Ballestar, M. Esteller, A. Cano, Snail mediates E-cadherin repression by the recruitment of the Sin3A/histone deacetylase 1 (HDAC1)/ HDAC2 complex, Mol. Cell Biol. 24 (2004) 306e319. [20] R.A. Laskowski, M.W. MacArthur, D.S. Moss, J.M. Thornton, PROCHECK : a progtamme to check the sterochemical quality of protein structure, J. Appl. Crystallogr. 26 (1993) 283e291. [21] H. Yamasaki, T. Sekimoto, T. Ohkubo, T. Douchi, Y. Nagata, M. Ozawa, Y. Yoneda, Zinc finger domain of Snail functions as a nuclear localization signal for importin beta-mediated nuclear import pathway, Genes cells. 10 (2005) 455e464. [22] Y.Y. Sheen, M.J. Kim, S.A. Park, S.Y. Park, J.S. Nam, Targeting the transforming growth factor-beta signaling in, Cancer Ther. Biomol. Ther. Seoul. 21 (2013) 323e331. [23] A. Nakao, T. Imamura, S. Souchelnytskyi, M. Kawabata, A. Ishisaki, E. Oeda, K. Tamaki, J. Hanai, C.H. Heldin, K. Miyazono, P. ten Dijke, TGF-beta receptormediated signalling through Smad2, Smad3 and Smad4, EMBO J. 16 (1997) 5353e5362. [24] H.L. Grimes, T.O. Chan, P.A. Zweidler-McKay, B. Tong, P.N. Tsichlis, The Gfi-1 proto-oncoprotein contains a novel transcriptional repressor domain, SNAG, and inhibits G1 arrest induced by interleukin-2 withdrawal, Mol. Cell Biol. 16 (1996) 6263e6272. [25] J.P. Thiery, Epithelial-mesenchymal transitions in development and pathologies, Curr. Opin. Cell Biol. 15 (2003) 740e746. [26] T. Brabletz, F. Hlubek, S. Spaderna, O. Schmalhofer, E. Hiendlmeyer, A. Jung, T. Kirchner, Invasion and metastasis in colorectal cancer: epithelialmesenchymal transition, mesenchymal-epithelial transition, stem cells and beta-catenin, Cells Tissues Organs 179 (2005) 56e65. [27] C. Almeida, D. Nagarajan, J. Tian, S.W. Leal, K. Wheeler, M. Munley, W. Blackstock, W. Zhao, The role of alveolar epithelium in radiation-induced lung injury, PLoS One 8 (2013) e53628. [28] J.P. Thiery, H. Acloque, R.Y. Huang, M.A. Nieto, Epithelial-mesenchymal transitions in development and disease, Cell 139 (2009) 871e890. [29] M.A. Huber, N. Kraut, H. Beug, Molecular requirements for epithelialmesenchymal transition during tumor progression, Curr. Opin. Cell Biol. 17 (2005) 548e558. [30] K. Araki, T. Shimura, H. Suzuki, S. Tsutsumi, W. Wada, T. Yajima, T. Kobayahi, N. Kubo, H. Kuwano, E/N-cadherin switch mediates cancer progression via TGF-beta-induced epithelial-to-mesenchymal transition in extrahepatic cholangiocarcinoma, Br. J. Cancer 105 (2011) 1885e1893. [31] X. Wang, J. Xu, H. Wang, L. Wu, W. Yuan, J. Du, S. Cai, Trichostatin A, a histone deacetylase inhibitor, reverses epithelial-mesenchymal transition in colorectal cancer SW480 and prostate cancer PC3 cells, Biochem. Biophys. Res. Commun. 456 (2015) 320e326. [32] A. Kaimori, J.J. Potter, M. Choti, Z. Ding, E. Mezey, A.A. Koteish, Histone deacetylase inhibition suppresses the transforming growth factor beta1induced epithelial-to-mesenchymal transition in hepatocytes, Hepatology 52 (2010) 1033e1045. [33] M. Yoshikawa, K. Hishikawa, T. Marumo, T. Fujita, Inhibition of histone deacetylase activity suppresses epithelial-to-mesenchymal transition induced by TGF-beta1 in human renal epithelial cells, J. Am. Soc. Nephrol. 18 (2007) 58e65. [34] A. Cano, M.A. Perez-Moreno, I. Rodrigo, A. Locascio, M.J. Blanco, M.G. del Barrio, F. Portillo, M.A. Nieto, The transcription factor snail controls epithelialmesenchymal transitions by repressing E-cadherin expression, Nat. Cell Biol. 2 (2000) 76e83. [35] V. Bolos, H. Peinado, M.A. Perez-Moreno, M.F. Fraga, M. Esteller, A. Cano, The
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
8
S.S. Nagaraja et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e8
transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors, J. Cell Sci. 116 (2003) 499e511. [36] J. Comijn, G. Berx, P. Vermassen, K. Verschueren, L. van Grunsven, E. Bruyneel, M. Mareel, D. Huylebroeck, F. van Roy, The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion, Mol. Cell. 7 (2001) 1267e1278. [37] I.H. Park, J.H. Kang, J.M. Shin, H.M. Lee, Trichostatin a inhibits epithelial
mesenchymal transition induced by TGF-beta1 in airway epithelium, PLoS One 11 (2016) e0162058. [38] K. Tsuchida, M. Nakatani, K. Hitachi, A. Uezumi, Y. Sunada, H. Ageta, K. Inokuchi, Activin signaling as an emerging target for therapeutic interventions, Cell Commun. Signal 7 (2009) 15. [39] S. Lamouille, R. Derynck, Cell size and invasion in TGF-beta-induced epithelial to mesenchymal transition is regulated by activation of the mTOR pathway, J. Cell. Biol. 178 (2007) 437e451.
Please cite this article in press as: S.S. Nagaraja, et al., Effect of Trichostatin A on radiation induced epithelial-mesenchymal transition in A549 cells, Biochemical and Biophysical Research Communications (2017), https://doi.org/10.1016/j.bbrc.2017.10.031
