Effect of Propionibacterium spp. on ruminal fermentation, nutrient digestibility, and methane emissions in beef heifers fed a high-forage diet D. Vyas, E. J. McGeough, S. M. McGinn, T. A. McAllister and K. A. Beauchemin J ANIM SCI 2014, 92:2192-2201. doi: 10.2527/jas.2013-7492 originally published online March 18, 2014

The online version of this article, along with updated information and services, is located on the World Wide Web at: http://www.journalofanimalscience.org/content/92/5/2192

www.asas.org

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

Effect of Propionibacterium spp. on ruminal fermentation, nutrient digestibility, and methane emissions in beef heifers fed a high-forage diet1 D. Vyas,* E. J. McGeough,† S. M. McGinn,* T. A. McAllister,* and K. A. Beauchemin*2 *Lethbridge Research Center, Agriculture and Agri-Food Canada, Lethbridge, AB T1J 4B1, Canada; and †Department of Animal Science, University of Manitoba, Winnipeg, MB R3T 2N2, Canada

ABSTRACT: The objective of this study was to test the efficacy of different Propionibacterium strains in mitigating methane (CH4) emissions in beef heifers fed a high-forage diet. Twenty ruminally cannulated beef heifers were used in a randomized block design with 28-d periods. Treatments included 1) Control, 2) Propionibacterium acidipropionici strain P169, 3) Propionibacterium acidipropionici strain P5, and 4) Propionibacterium jensenii strain P54. Strains (5 × 109 CFU) were administered daily directly into the rumen in 10 g of a maltodextrin carrier in a gel capsule. Control heifers received the carrier only. All heifers were fed a basal diet (70:30 forage to concentrate, DM basis) based on barley silage and corn grain. No treatment effects were observed for overall DMI (P = 0.78) or DMI in chambers (P = 0.29). Dry matter intake was 12 to 29% less in the chambers, with intake depression numerically lower in heifers receiving Propionibacterium than Control. Mean ruminal pH averaged 6.47 and was not affected by treatments (P = 0.34). Likewise, no treatment differences were observed for ruminal concentrations of total VFA (P = 0.24) and ammonia-N (P = 0.49) or for molar

proportion of individual VFA. Total daily enteric CH4 production was not affected by Propionibacterium strains as compared to Control and averaged 178 g/d (P = 0.69). However, enteric CH4 emission intensity (g CH4/kg of DMI) was reduced by 12, 8, and 13% with P169, P5, and P54 as compared to Control, respectively (P = 0.03). No treatment effects were observed for total tract digestibility of nutrients. Likewise, total universal bacterial (P = 0.22) and methanogen (P = 0.64) counts were similar among treatments. However, the relative abundance of total Propionibacteria tended to increase with inoculation as compared to Control (P = 0.06). The relative abundance of Propionibacterium P169 tended to be greater at 3 h postdosing, but returned to pretreatment (0 h) levels within 9 h, suggesting it failed to persist at detectable levels in the rumen. In conclusion, Propionibacterium spp. did not reduce total enteric CH4 production, possibly due to their inability to persist and integrate into the ruminal microbial community. However, CH4 emission intensity was reduced with Propionibacterium strains, a response attributed to the numerically greater DMI of heifers receiving Propionibacterium.

Key words: beef, digestibility, direct fed microbial, methane, Propionibacterium © 2014 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2014.92:2192–2201 doi:10.2527/jas2013-7492 INTRODUCTION Enteric methane (CH4) from ruminants accounts for 17 to 37% of global anthropogenic CH4 emissions (Lassey, 2008). Additionally, CH4 production in cattle 1Funding for the study was from Dupont Nutrition and Health. We thank B. Farr, A. Furtado, and R. Roth for sampling and laboratory assistance, D. Vedres for GC analyses, and the staff at the Metabolism Unit of the Lethbridge Research Center (Agriculture and Agri-Food Canada, Lethbridge, Alberta, Canada) for animal care. 2Corresponding author: [email protected] Received December 10, 2013. Accepted February 20, 2014.

can represent a loss of 2 to 12% of GE intake, reducing the efficiency of ruminant production systems (Johnson et al., 2000). Hence, various strategies have been investigated to reduce enteric CH4 emissions, which include increasing alternate hydrogen (H+) acceptors in the rumen by inducing greater ruminal propionate synthesis (McAllister and Newbold, 2008). Propionibacteria are natural propionate producers that inhabit the rumen and comprise 1.4 to 4.3% of the total microbial population (Mead and Jones, 1981; Aleman et al., 2007). The development of Propionibacterium strains as direct fed microbials (DFM) may offer an effective means of increasing ruminal propionate production and reducing

2192 Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

2193

Propionibacterium spp. and methane emissions

CH4 emissions from cattle fed forage-based diets. This approach would not only be beneficial to the environment, but would also increase feed efficiency as propionate is the major precursor for gluconeogenesis in ruminants (Bergman, 1990). Previous studies have shown increased ruminal propionate with Propionibacterium P169 in lactating dairy cows (Stein et al., 2006) and steers (Lehloenya et al., 2008). However, the effects of feeding P169 and other Propionibacterium strains (P5 and P54) on CH4 emissions and total tract digestibility has not been studied in beef cattle fed high-forage diets. The primary objective of this study was to identify Propionibacterium strains that mitigate CH4 emissions in beef cattle offered a backgrounding diet typically fed during the growing phase of commercial beef production. MATERIALS AND METHODS Experimental Design, Dietary Treatments, and Animal Care The experiment was conducted in accordance with the Canadian Council of Animal Care Guidelines (CCAC, 1993) under the approved Lethbridge Research Center Animal Care and Use Committee protocol # 1129. Twenty ruminally cannulated beef heifers were used in a randomized block design with 28-d periods. The heifers were blocked in 5 groups (i.e., blocks) on the basis of preexperimental BW (mean ± SD: group 1 = 406 ± 17 kg, group 2 = 408 ± 31 kg, group 3 = 396 ± 15 kg, group 4 = 441 ± 17 kg, and group 5 = 427 ± 38 kg). Dietary treatments included 1) Control, 2) Propionibacterium acidipropionici strain P169, 3) P. acidipropionici strain P5, and 4) P. jensenii strain P54. Strains (5 × 109 CFU) were administered directly into the rumen at the time of feeding each day in 10 g of a maltodextrin carrier using a porcine gel capsule (Torpac #10; Torpac Inc., Fairfield, NJ); Control heifers received the carrier only. Treatments were randomly allotted within each group. All heifers were fed the basal diet (70:30 forage to concentrate; Table 1) formulated to provide adequate ME and MP for 400 kg growing beef cattle with an ADG of 1 kg/d (NRC, 2000). Heifers were fed for ad libitum intake once daily at 1300 h, housed in a ventilated tie-stall barn, and exercised daily in an open dry lot. Measurements During the experiment, d 1 to 14 were used to adapt heifers to their treatments. Ruminal contents were collected on d 15 and d 18, ruminal pH was measured continuously from d 15 to 21, enteric CH4 was measured from d 19 to 21, and diet digestibility was measured from d 25 to 28. Daily intakes and orts of the diets for individual heifers were recorded. Diets and orts were sampled

Table 1. Ingredient and chemical composition of the basal diet Item Ingredient Barley silage1 Corn, dry rolled2 Supplement3 Canola meal Barley, ground Canola oil Limestone Salt Urea Molasses Vitamin E (500,000 IU/kg) Feedlot premix4 MGA-100 premix5 Chemical composition DM, % OM, % of DM CP, % of DM NDF, % of DM ADF, % of DM

% of DM 70.0 20.0 10.0 4.100 3.517 0.057 0.300 0.050 0.400 1.500 0.006 0.050 0.020 41.4 ± 1.49 92.9 ± 0.26 13.1 ± 0.78 38.2 ± 1.48 24.8 ± 0.73

1Composition

(mean ± SD; % DM basis)): 33.2 ± 3.06 DM, 11.1 ± 1.78 CP, 52.1 ± 2.43 NDF, 33.9 ± 1.33 ADF. 2Composition (mean ± SD; % DM basis): 90.5 ± 0.40 DM, 9.03 ± 0.49 CP, 10.8 ± 1.98 NDF, 3.14 ± 0.29 ADF. 3Composition (mean ± SD; % DM basis): 94.2 ± 0.21 DM, 28.5 ± 3.32 CP, 23.0 ± 0.73 NDF, 14.7 ± 0.45 ADF. 4Feedlot premix provided an additional 14 g/kg Ca, 103 mg/kg Zn, 26 mg/kg Cu, 47 mg/kg Mn, 1 mg/kg I, 0.50 mg/kg Se, 0.33 mg/kg Co, 17,187 IU/kg vitamin A, 859 IU/kg vitamin D3, and 24 IU/kg vitamin E of the diet DM. 5Melengestrol acetate (220 mg/kg; Pfizer Animal Health, Pfizer Canada).

daily during measurement of CH4 and digestibility. Samples were pooled by week for each animal at the end of each period. Dietary ingredients were sampled once weekly and analyzed for DM by drying at 55°C for 72 h. Inclusion of forage (as-fed basis) in the diet was adjusted if the DM concentration of barley silage deviated by more than 3% units from the average. Samples were stored at -20°C until they were analyzed. Methane Measurements. Methane emissions were measured from individual heifers for 3 d using environmental chambers according to Beauchemin and McGinn (2006). All heifers were trained for entry into the environmental chambers before starting the trial to minimize the stress during the time they were in chambers. Each of the 4 chambers measured 4.4 m wide × 3.7 m deep × 3.9 m tall (63.5 m3 volume; model C1330; Conviron Inc., Winnipeg, Manitoba, Canada) and housed 1 heifer. Processes involved in air circulation in the chambers and gas sampling are described by Avila-Stagno et al. (2013). Each chamber was calibrated by sequentially releasing 0, 0.2, and 0.4 L/min of CH4 separately into each empty chamber using a mass-flow meter (Omega Engineering,

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

2194

Vyas et al.

Stamford, CT). A 3-point regression was developed by plotting actual against calculated CH4 emission. The slopes of these best fit linear relationships were used to correct for among-chamber variability. Concentrations of CH4 in the intake and exhaust air ducts were monitored using a CH4 analyzer (model Ultramat 5E; Siemens Inc., Karlsruhe, Germany). The analyzer was calibrated daily using CH4 as the primary standard for the span and N2 for the zero offset. The difference between the incoming and outgoing mass of CH4 was used to calculate the amount generated in each chamber by each heifer. Emission of CH4 per kg of DMI was calculated by dividing total emissions by the total DMI for each heifer in each chamber. Ruminal Fermentation. To determine the effect of Propionibacteria on ruminal pH, daily pH profiles were measured starting at feeding on d 15 using an indwelling pH data acquisition system (LRC pH dataloggers; Dascor, Escondido, CA) that was retained in the rumen for 7 d (includes the period of CH4 measurement). The system was standardized using pH 4 and 7 buffers before insertion on the first day and then on removal on the last day. The shift in pH/millivolt between the start and end standardization was assumed to be linear and was used to convert millivolt readings to pH units (Penner et al., 2006). The pH was recorded every minute and classified according to 3 pH thresholds: 6.0 (Plaizier, 2004); 5.8 (Beauchemin et al., 2003; Dohme et al., 2008), and 5.6 (Nagaraja and Lechtenberg, 2007). On d 15 and 18, at 0, 3, 6, and 9 h postfeeding, ruminal contents were sampled from 4 different sites (cranial, caudal, ventral, and dorsal) composited and strained through a double layer of polyester monofilament fabric (Pecap 7–1180/59, mesh opening 1, 180 µm; Tetko Inc., Scarborough, Ontario, Canada). Two samples of filtered ruminal fluid (5 mL) were preserved by adding 1 mL of 25% (wt/vol) HPO3 for VFA determination and 1 mL of 1% (wt/vol) H2SO4 for NH3 determination. The samples were stored at -20°C until analyzed. Diet Digestibility. Following CH4 measurement, heifers were given a rest period of 3 d before determining the effect of the treatments on diet digestibility. Feed intake was restricted to 0.95 of ad libitum (determined from the d 10 to 17 intake, before the heifers going into chambers) starting at feeding on d 25. Total fecal collection was used for determining total tract digestibility, with the total weight of feed, orts, and feces recorded daily. At the end of each period, 10% of the daily subsamples of feed, orts, and feces were pooled for each individual heifer. These samples were stored for subsequent DM determination and chemical analysis. DNA Extraction and Quantitative PCR Ruminal samples collected at 0, 3, and 9 h were processed separately for each heifer. Microbial pel-

let was extracted based on a method described earlier (Stevenson and Weimer, 2007), with some modifications. Briefly, ruminal samples were thawed at 4°C overnight. Twenty-five grams of sample were homogenized in a blender with chilled extraction buffer (100 mM Tris-HCl, 10 mM EDTA, 0.15 M NaCl pH 8.0) to release solid associated bacteria and the blend was filtered using a double layer of cheese cloth. Filtered ruminal sample was centrifuged at 10,000 × g for 20 min at 4°C. Microbial pellet was resuspended in stool lysis buffer (ASL buffer; QIAamp DNA Stool Kit; Qiagen, Mississauga, Ontario, Canada), and microbial cells were lysed in a bead beater (B. Braun, Melsungen, Hesse, Germany). The DNA was extracted using the QIAamp DNA Stool Kit and resuspended in elution buffer (AE buffer; QIAamp DNA Stool Kit; Qiagen, Mississauga, Ontario, Canada). The concentration and quality of DNA were measured at A260 and A280 using a ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). The DNA obtained was stored at -20°C in aliquots of 10 ng/μL (stock) of AE buffer. Quantitative real-time PCR assays were performed with 7900 HT Fast Real-time PCR system (Applied Biosystem, Foster City, CA) using POWER SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK), forward and reverse primers (25 pmol of each primer/reaction), and approximately 20 ng of template DNA in a final volume of 25 μL per reaction. Features of the primers used for qPCR are shown in Table 2. Amplifications were performed under the following conditions: one cycle at 95°C for 5 min followed by 40 cycles of amplification at 95°C for 10-s and a 30-s annealing ⁄ elongation (at the temperatures shown in Table 2 based on each primer pair). The PCR product specificity was verified by melt denaturation with an increment of 0.1°C/s from 60 to 95°C, with fluorescence collection at 0.1°C intervals. Amplification products were verified by agarose gel electrophoresis using 1% agarose in Tris-acetate-EDTA (40 mM Tris acetate, 1 mM EDTA [pH 8.5]), followed by ethidium bromide staining and visualization under UV light. A 1-kb ladder (Quick-Load; New England Biolabs Ltd., Pickering, Ontario, Canada) was included on each gel to confirm amplicon sizes (Petri et al., 2012). A standard curve for total archaea and universal bacteria was constructed using plasmid DNA containing 16S rRNA inserts of DNA purified from a pure culture of Methanobrevibacter sp. strain AbM4 (Zhou et al., 2009) and Ruminococcus albus (Petri et al., 2012), respectively. Standard for total Propionibacteria was prepared from genomic DNA extracted from purified culture of P. acidipropionici P169 grown at 32°C for 48 h in sodium lactate broth (NLB). Standards were quantified using ND-1000 spectrophotometer and were subjected to 7 sequential 10-fold dilu-

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

2195

Propionibacterium spp. and methane emissions

Table 2. Features of primers used for qPCR analysis Gene Total bacteria Total methanogens Total Propionibacteria Propionibacterium P169

Primers (5’-3’)1 BAC338F– ACTCCTACGGGAGGCAG BAC805R– GACTACCAGGGTATCTAATCC UnimetF- CCGGAGATGGAACCTGAGAC UnimetR- CGGTCTTGCCCAGCTCTTATTC PG1F- RGTGGCGAAGGCGGTTCTCTGGA PG1R- TGRGGTCGAGTTGCAGACCCCAAT P169F-GTCCTTTCTTAACCGCTCGGG P169R- GACTCCGTCGTCCGTCATAAG

Tm2 61

Size3 468

Reference Yu et al. (2005)

60

160

Zhou et al. (2009)

70

610

Rossi et al. (1999)

62

151

Peng et al. (2011)

1Primer

direction (F, forward; R, reverse). temperature (°C). 3Amplicon size in base pairs. 2Annealing

tions, each analyzed in triplicate. A linear relationship was observed between the threshold cycle (Ct) and the log of DNA concentration when each primer pair was tested against purified DNA from its target bacteria (R2, 0.98 to 0.99). The relative population size of total Propionibacteria was determined as the ratio of the amplification of total Propionibacteria 16S rRNA to the amplification of the reference primers with a primer set (BAC338F and BAC805R) that amplified all eubacterial species used as the reference primer set. Details of these calculations, with corrections for PCR efficiency, are described by Stevenson and Weimer (2007). Polymerase chain reaction efficiency was calculated using the formula E = [10(-1/slope) -1]. The slopes ranged from -3.41 to -3.39 for total bacterial primer, -3.44 to -3.39 for total methanogens, -3.59 to -3.56 for total Propionibacteria, and -3.46 to -3.43 for Propionibacterium P169 primers. Likewise, the efficiencies ranged from 0.96 to 0.97 for total bacteria, 0.95 to 0.97 for total archaea, 0.89 to 0.91 for total Propionibacteria, and 0.95 to 0.96 for Propionibacterium P169. Laboratory Analyses Dry matter for all samples was determined by oven drying at 55°C for 72 h. Dried samples were ground in a Wiley mill (A. H. Thomas, Philadelphia, PA) through a 1-mm screen. Analytical DM content of the ground sample was determined by drying at 135°C for 2 h (method 930.15; AOAC, 2005), followed by hot weighing. The OM content was calculated as the difference between 100 and the percentage ash (method 942.05; AOAC, 2005). The NDF and ADF contents were determined according to Van Soest et al. (1991) with heat stable amylase and sodium sulfite used in the NDF procedure. Gross energy content was determined using a bomb calorimeter (model E2k; CAL2k, Johannesburg, South Africa). For the measurement of CP (N × 6.25), samples were ground using a ball mill (Mixer Mill MM2000; Tetsch, Haan, Germany). Total N was quantified by flash

combustion and thermal conductivity detection (Carlo Erba Instuments, Milan, Italy). Ruminal VFA was quantified using GLC (model 5890; Hewlett-Packard, Wilmington, DE) with a capillary column (30 m × 0.32 mm × 1µm; ZB-FFAP; Phenomenex Inc., Torrance, CA) and flame ionization detection. Crotonic acid was used as internal standard for determination of VFA. For VFA, the oven temperature was maintained at 170°C for 4 min, increased by 3.5°C/min to 190°C, and held at this temperature for 2.5 min. The injector temperature was 225°C, the detector temperature was 250°C, and the carrier gas was helium. Ruminal NH3–N concentration was determined by the salicylate-nitroprusside-hypochlorite method using a flow injection analyzer (Sims et al., 1995). Statistical Analysis Normality of distribution and homogeneity of variance was determined using the Univariate procedure of SAS (SAS Inst. Inc., Cary, NC). The data were subsequently analyzed using the Mixed procedure of SAS with heifer as the experimental unit. For data that were collected serially (DMI, BW, CH4, and ruminal fermentation), the model included the fixed effect of treatment, sampling time, and their interaction, with sampling time considered as a repeated effect in the model. Denominator degrees of freedom were estimated using the Kenward-Roger operation in the MODEL statement. Group was used in the RANDOM statement. The PDIFF option was included in the LSMEANS statement to provide pairwise comparisons among means. Time-series covariance structure was modeled using the options of autoregressive order one, compound symmetry, and unstructured order one. The best time-series covariance structure was selected based on the lowest Akaike and Bayesian information criteria. Data for ruminal pH were summarized by day according to Dohme et al. (2008). The mixed model for pH data included the fixed effect of treatment with day used in the REPEATED statement. Data are presented as least squares means ±

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

2196

Vyas et al.

Table 3. Dry matter intake and BW for beef heifers fed a high-forage diet supplemented with Control or Propionibacterium strains P169, P5, or P541 Treatment Variable No. of observations DMI, kg/d BW, kg Initial BW, kg Final BW, kg ADG, kg/d

Control 5 9.2 482 461 497 1.3

P169 5 9.7 462 442 478 1.3

P5 5 9.7 481 456 498 1.5

P54 5 9.4 482 460 498 1.3

SEM

Treatment

0.44 20.4 18.4 22.5 0.27

0.78 0.42 0.50 0.38 0.94

P-value Week Treatment × Week < 0.01 < 0.01 ̶ ̶ ̶

0.08 0.99 ̶ ̶ ̶

1Propionibacterium strains P169, P5, and P54 (5 × 109 CFU) were administered daily with 10 g maltodextrin carrier in a gel capsule; Control heifers received carrier only.

SEM. Statistical significance was declared at P ≤ 0.05 and a tendency to significance was declared at 0.05 < P ≤ 0.10. RESULTS DMI, BW, and Ruminal Fermentation Dry matter intake averaged 9.4 kg/d during the ad libitum feeding period and was not affected by treatments (P = 0.78; Table 3). However, DMI fluctuated every week as the experiment progressed (week effect: P < 0.01). Overall, BW increased during the experiment (P  < 0.01), but average BW was similar among treatments (P = 0.42). No treatment differences were observed for initial BW, final BW, or ADG. Mean ruminal pH averaged 6.47 and was not affected by treatments (Table 4). Ruminal pH variables,

including minimum, maximum, and pH range were similar among all treatments. No treatment differences were observed for duration (h/d), area, bouts (per d), or bout duration under pH 6, 5.8, or 5.6. Total VFA and NH3–N concentrations and molar proportions of individual VFA including acetate, propionate, butyrate, valerate, and caproate were similar among treatments (Table 5). The molar proportion of isobutyrate was reduced by P5 and P54 (P = 0.01) compared with Control. Total VFA concentrations peaked 9 h postfeeding whereas the proportion of acetate decreased and propionate increased postfeeding resulting in a reduction (P < 0.01) in acetate:propionate ratio at 3, 6, and 9 h compared with prefeeding levels. Peak ruminal NH3–N was observed at 3 h postfeeding. No treatment × sampling time interactions were observed for any ruminal fermentation variable.

Table 4. Ruminal pH variables for beef heifers fed a high-forage diet supplemented with Control or Propionibacterium strains P169, P5, or P541 Variable No. of observations Minimum ruminal pH Mean ruminal pH Maximum ruminal pH Range1 Ruminal pH < 6.0 Duration, h/d Area, pH units × min/d Bouts, no./d Bout duration, min/bout Ruminal pH < 5.8 Duration, h/d Area, pH units × min/d Bouts, no./d Bout duration, min/bout Ruminal pH < 5.6 Duration, h/d Area, pH units × min/d Bouts, no./d Bout duration, min/bout

SEM

Treatment P-value

0.11 0.08 0.04 0.08

0.68 0.34 0.17 0.88

1.6 22 3.1 18

1.36 37.9 1.33 5.5

0.36 0.35 0.25 0.73

3.0 56 5.1 17

0.7 9 1.7 16

1.05 22.9 1.03 7.1

0.33 0.35 0.15 0.99

1.8 26 2.5 20

0.4 2 1.2 11

0.78 12.0 0.55 7.8

0.41 0.32 0.25 0.43

Control 5 5.87 6.53 6.95 1.07

P169 5 5.86 6.47 6.89 1.03

P5 5 5.74 6.35 6.81 1.07

2.0 35 4.4 15

1.6 18 4.7 18

4.6 102 6.9 23

1.2 17 2.7 16

0.5 4 2.3 14

0.6 7 1.4 13

0.2 2 1.3 3

P54 5 5.92 6.51 6.91 1.00

1Propionibacterium strains P169, P5, and P54 (5 × 109 CFU) were administered daily with 10 g maltodextrin carrier in a gel capsule; Control heifers received carrier only.

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

2197

Propionibacterium spp. and methane emissions

Table 5. Ruminal fermentation characteristics for beef heifers fed a high-forage diet supplemented with Control or Propionibacterium strains P169, P5, or P541 Variable No. of observations Total VFA, mM Individual VFA, mol/100 mol Acetate (A) Propionate (P) Isobutyrate Butyrate (B) Valerate Isovalerate Caproate A:P ratio (A+B):P ratio NH3–N, mM

Control 5 121

Treatment P169 5 116

62.8 20.3 1.09a 11.1 1.68 2.07 0.93 3.12 3.67 4.88

62.1 21.3 1.07ab 11.1 1.70 1.93 0.86 2.94 3.46 5.09

P5 5 129 62.4 21.0 1.00b 11.2 1.64 2.02 0.82 3.04 3.58 5.06

P54 5 124 62.9 20.4 1.02b 10.9 1.68 2.08 0.90 3.11 3.66 5.57

P-value Hour Treatment × Hour

SEM

Treatment

4.9

0.24

< 0.01

0.85

0.69 0.73 0.02 0.44 0.05 0.15 0.04 0.14 0.16 0.38

0.76 0.72 0.01 0.99 0.80 0.44 0.37 0.78 0.81 0.49

< 0.01 < 0.01 < 0.01 < 0.01 < 0.01 0.01 < 0.01 < 0.01 < 0.01 < 0.01

0.34 0.37 0.84 0.14 0.48 0.95 0.88 0.53 0.52 0.28

a,bValues

in a row not bearing a common letter differ (P ≤ 0.05). strains P169, P5, and P54 (5 × 109 CFU) were administered daily with 10 g maltodextrin carrier in a gel capsule; Control heifers received carrier only. 1Propionibacterium

Nutrient Digestibility Propionibacterium strains had no effect on total tract digestibility of DM, OM, CP, NDF, ADF, and GE, (Table 6) with average digestibilities of 67.6, 69.6, 70.6, 50.7, 46.4, and 64.7%, respectively. Methane Emissions Moving the cattle into the chambers caused a general reduction in DMI (Table 7), as compared to intake in the metabolism unit. Once in the chambers, the DMI of cattle fed Control, P169, P5, and P54 was 71, 88, 82, and 83% of ad libitum intake, respectively. The drop in DMI was more pronounced in Control heifers as compared to those receiving Propionibacterium, but it did not differ statistically (P = 0.29). Total enteric CH4 production was not affected by treatments and averaged 178 g/d (P = 0.69; Table 7). Compared to the Control, intensity of enteric CH4 emisTable 6. Total tract nutrient digestibility for beef heifers fed a high-forage diet supplemented with Control or Propionibacterium strains P169, P54, or P51 Variable Control No. of observations 5 DM, % 66.6 OM, % 68.6 CP, % 71.2 NDF, % 49.7 ADF, % 45.3 GE, % 63.6

P169 5 67.7 69.6 71.4 50.8 47.4 64.1

P5 5 66.4 68.6 69.0 48.3 43.8 63.9

P54 5 69.5 71.7 70.9 53.8 48.9 67.0

SEM Treatment P-value 1.20 1.14 2.24 2.08 2.04 1.41

0.40 0.32 0.61 0.39 0.44 0.38

1 Propionibacterium strains P169, P5 and P54 (5 × 109 CFU) were administered with 10 g maltodextrin carrier in a gel capsule; Control heifers received carrier only.

sions (g of CH4/kg of DMI) was decreased (P = 0.03) by 12, 8, and 13% with P169, P5, and P54, respectively. Similarly, CH4 emissions corrected for differences in GE intake compared to the Control were decreased (P < 0.01) by 12, 9, and 13% for P169, P5, and P54, respectively. Days in chambers affected CH4 emissions as emissions tended to be greater on the second day of measurement, irrespective of treatment (P < 0.01). Similarly, intensity of CH4 emission (g of CH4/kg of DMI) was greater (P < 0.01) on the second day of CH4 measurement, with no interactions observed between treatment and days. Microbial Profile Propionibacterium strains did not affect absolute copy numbers of total universal bacteria (P = 0.22) or total methanogens (P = 0.64; Table 8). However, absolute copy number (P = 0.07; Table 8) and relative population size of total Propionibacteria (P = 0.06; Table 9) tended to increase as a result of inoculation with treatments as compared to Control. Ruminal microbial profiles were affected by sampling time. The relative abundance of total Propionibacteria increased at 3 h but returned to pretreatment levels by 9 h (P < 0.01). However, the relative abundance of Propionibacterium P169 tended to increase (P = 0.07) at 3 and 9 h as compared to predosing levels. DISCUSSION It is well established that intensity of CH4 emissions from feedlot cattle are greater during the growing than the finishing phase of beef production, mainly due to the greater proportion of forage that leads to more acetate and less propionate production (Beauchemin and McGinn,

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

2198

Vyas et al.

Table 7. Enteric methane (CH4) emissions from beef heifers fed a high-forage diet supplemented with Control or Propionibacterium strains P169, P54, and P51 Treatment Variable Control No. of observations 5 DMI, kg/d 6.5 CH4, g/d 167 Methane emission intensity g CH4/kg DMI2 25.7a % of GE intake2 7.8a a,bValues

P169 5 8.4 190

P5 5 7.8 181

22.7b 6.9b

23.5b 7.1b

P54 5 7.7 172 22.4b 6.8b

SEM

Treatment

P-value Day

Treatment × Day

0.69 15.5

0.29 0.69

0.59 < 0.01

0.48 0.21

0.84 0.26

0.03 < 0.01

< 0.01 < 0.01

0.31 0.32

within a row with different letters differ (P ≤ 0.05).

1Propionibacterium strains P169, P5, and P54 (5 × 109 CFU) were administered with 10 g maltodextrin carrier in a gel capsule; Control heifers received carrier only. 2Based

on DMI or GE intake on the days of CH4 measurement.

2005). Thus, strategies that reduce CH4 emissions in cattle fed high-forage diets could be more significant than those from the feedlot sector (Beauchemin and McGinn, 2006). Propionibacteria are suggested to reduce CH4 emissions by promoting ruminal propionate synthesis (Alazzeh et al., 2013). Propionate synthesis by reduction of pyruvate is the characteristic metabolic feature of Propionibacteria (Piveteau, 1999). Furthermore, propionate is typically the principal alternative H+ sink after CH4 in the rumen, and an increase in ruminal propionate synthesis is anticipated to reduce CH4 emissions (Moss et al., 2000). Previous studies have used Propionibacterium P169 to promote propionate synthesis during milk production in lactating dairy cows (Stein et al., 2006) and growing beef steers (Lehloenya et al., 2008). However, no in vivo study has explored the potential for Propionibacterium spp. to mitigate CH4 emissions in ruminants. In addition, little is known about the effects on rumen VFA profiles of individual strains of Propionibacterium, which could differ substantially in metabolic activity (Deborde et al., 1999; Piveteau, 1999; Luo, 2012). Although metabolic differences of the Propionibacterium strains in our study have not been investigated, previous studies have shown more propionate production with P. acidipropionici than with other Propionibacterium spp., including P. freudenreichii and P. shermanii (Rehberger and Glatz, 1998; Piveteau, 1999; Himmi et al., 2000). The differences observed between different strains and species is attributed to the relative ability of various Propionibacterium species to metabolize pyruvate through the Kreb’s cycle (Piveteau, 1999). Methane emissions from beef heifers fed the Control diet were 7.8% of GE intake and comparable to the study of Beauchemin and McGinn (2005) that reported 7.3% of GE was lost as CH4 in heifers fed a diet with 75% of DM as barley silage. Emissions of a similar magnitude have also been reported for other diets (McGinn et al., 2004; Beauchemin and McGinn, 2006; Hünerberg et al., 2013). Methane emissions observed in our study and others (Beauchemin and McGinn, 2005; Beauchemin and McGinn, 2006; Brown et

al., 2011; Hünerberg et al., 2013) are on the upper range of 6.5% ( ± 1.0%) of GE intake estimated by IPCC (2006) for cattle fed high-forage diets. To our knowledge, this study represents the first direct evidence of the efficacy of Propionibacterium species in suppressing the intensity of CH4 emissions in vivo. Various factors, including the site and extent of digestion, the level of feed intake (Blaxter and Clapperton, 1965), and digesta passage rate, can affect the rate or degree of CH4 production (Johnson and Johnson, 1995). In this study, DMI measured in the chambers was reduced by 12 to 29% relative to overall DMI, probably due to reduced energy expenditure and stress associated with isolation in the chambers. A similar decline in intake was observed in previous studies using chambers for CH4 measurements (McGinn et al., 2004; Beauchemin and McGinn, 2005). However, the decline in DMI was numerically lower in heifers receiving Propionibacterium as compared to Control. The reason for the maintenance of the greater feed intake in heifers receiving Propionibacterium is not clear. Because inoculated Propionibacterium strains have shown immunomodulatory properties in mice (PerezChaia et al., 1995; Kirjavainen et al., 1999), we can speculate about the existence of a mechanism in ruminants where immunomodulatory properties of inoculated Table 8. Ruminal microbial population in response to various Propionibacterium strains in beef heifers fed a high-forage diet with Control, P169, P5, or P54 treatments (as log10 conversion of absolute copy number of 16s rRNA gene per gram of rumen contents)1 Treatments Control P169 P5 9.7 9.9 9.8 8.5 8.6 8.6 5.9 6.3 6.3 Total Propionibacteria 5.1 ND Propionibacterium P169 ND2

Variable Total bacteria Total archaea

P54 9.5 8.3 5.8 ND

SEM 0.12 0.18 0.16 0.13

Treatment P-value 0.22 0.64 0.07 –

1Propionibacterium strains P169, P5, and P54 (5 × 109 CFU) were administered with 10 g maltodextrin carrier in a gel capsule; Control heifers received carrier only. 2Not detected.

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

2199

Propionibacterium spp. and methane emissions

Table 9. Relative abundance of total ruminal Propionibacteria and P169 in beef heifers fed a high-forage diet supplemented with Control or Propionibacterium strains P169, P5, or P541 Variable

Control 0.74 Total Propionibacteria2 ND4 Propionibacterium P1693 a,bValues

Treatment (T) P169 P5 1.80 1.50 12.0 ND

P54 0.90 ND

SEM 0.357 2.26

0 0.67b 4.3

Hour (H) 3 1.82a 19.2

9 1.20ab 12.5

SEM 0.332 4.09

T 0.06 –

P-value H < 0.01 0.07

T×H 0.33 –

within a row with different letters differ (P ≤ 0.05). strains P169, P5, and P54 (5 × 109 CFU) were administered with 10 g maltodextrin carrier in a gel capsule; Control heifers received

1Propionibacterium

carrier only. 2Relative abundance was determined as the ratio of copies of total Propionibacteria to copies of total bacteria and expressed as percentage. 3Relative abundance was determined as the ratio of copies of Propionibacterium P169 to copies of total Propionibacteria and expressed as percentage. 4Not detected.

strains might have reduced physiological stress in chambers, resulting in numerically greater intake as compared to Control. Level of intake affects ruminal passage rate of digesta (Sniffen et al., 1992), and although not measured, greater ruminal passage rate as a result of the greater DMI with Propionibacterium strains may have led to shorter retention time of substrates in the rumen, resulting in less fermentation and thereby less intense CH4 emissions. Another possibility for the lower intensity of CH4 emissions could be the antimicrobial activity of some Propionibacterium strains, which produce inhibitory metabolites such as short-chain fatty acids (FA) and antimicrobial peptides known as bacteriocins (Grinstead and Barefoot, 1992). Although the strains used in our study have not been screened for bacteriocins, some strains of Propionibacterium have shown inhibitory activity against ruminal bacteria. As such, certain strains of Propionibacterium reduce CH4 and total gas production in vitro (Holo et al., 2002; Alazzeh et al., 2013). However, if present, the antimicrobial activity of the Propionibacterium strains did not result in changes in the number of total bacteria or methanogens in the rumen. Similarly, considering the low levels of ruminal persistence, the effect of Propionibacterium strains on maintaining DMI in chambers is difficult to explain and needs to be further investigated. The lack of response observed with total CH4 emissions was consistent with no change in the molar proportion of ruminal propionate. Although no studies have reported enteric CH4 emissions, previous studies have reported either an increase (Kim et al., 2000, Stein et al., 2006; Lehloenya et al., 2008) or no change in the ruminal propionate concentration (Ghorbani et al., 2002) when various Propionibacterium strains were administered to ruminants. Likewise, ruminal fermentation characteristics including total VFA, major VFA profile, ruminal pH, and NH3–N concentrations were similar across all Propionibacterium strains, results that are consistent with previous studies in steers supplemented with Propionibacterium P169 (Lehloenya et al., 2008). The reduction in molar proportion of isobutyrate with P5 and P54 was unexpected. Branched-chain FA are the end

products of branched-chain AA fermentation and are used as an energy source by proteolytic bacteria (Macfarlane et al., 1992). Propionibacterium spp. can utilize AA as substrate for energy (Piveteau, 1999). Hence, the effects observed on isobutyrate concentrations probably reflect the differences in the extent of utilization of AA by the Propionibacterium strains used in the present study. The effects of bacterial DFM on ruminal fermentation vary based on the type of diet, the physiological stage of animal (Wallace, 1994), and the level and species of bacterial DFM used (Krehbiel et al., 2003). Some bacterial DFM products may require a greater feeding rate or dosage for several days to coexist with endogenous bacteria in the rumen (Krehbiel et al., 2003). Hence, the inability of Propionibacterium strains to alter ruminal fermentation in our study may be related to dosage level. Previous studies using higher doses (6 × 1011 CFU) of Propionibacterium P169 observed significant increases in ruminal propionate in lactating dairy cows (Stein et al., 2006; Weiss et al., 2008) and steers (Lehloenya et al., 2008). On the contrary, no effects were observed when P. freudenreichii strain PF24 (2 × 109 CFU) was administered in combination with Lactobacillus acidophilus strain LA747 (1 × 109 CFU) in lactating dairy cows (Raeth-Knight et al., 2007). However, the results must be interpreted with caution as none of the previous studies used Propionibacterium strains P169, P5, and P54 in beef heifers fed high-forage diets. It is possible that the levels of Propionibacterium strains were adequate, but the strains were unable to integrate, compete, and persist within the ruminal microbial community (McAllister et al., 2011). Results using strainspecific primers for PCR in the present study suggest that the population of Propionibacterium P169 did not persist in the rumen over a 24-h period as the abundance relative to total Propionibacteria returned to pretreatment levels within 9 h. Others have observed that cultured ruminal bacteria often fail to persist in the rumen (Krause et al., 2000, 2001), possibly due to morphological and metabolic changes that reduce their competitiveness with wild-type counterparts (Stewart et al., 1997; McAllister et al., 2011). Another possibility for the lack of persistence could be the lack of substrate availability for Propionibacterium

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

2200

Vyas et al.

strains. Previous studies have demonstrated the importance of lactate as the preferred carbon source for dairy Propionibacterium strains (Piveteau, 1999). Marcoux et al. (1992) observed that a lactate-supplemented media enhanced the growth rate of P. freudenreichii subsp. shermanii as compared to a lactose-based medium. Similarly, production of propionic acid with P. acidipropionici CDBB-1049 strains was greater when strains were grown with lactate combined with glucose as compared to glucose alone (Martínez-Campos and de la Torre, 2002). The reason for preferential utilization of lactate is unclear considering greater efficiency of glucose fermentation, but it might be attributed to the fewer metabolic steps needed to convert lactate to pyruvate as compared to glucose (Piveteau, 1999). Nevertheless, ruminal lactate levels were not detectable with the high-forage diet used in our study. The lack of preferred substrate availability may reduce the growth rate of inoculated Propionibacterium strains contributing to their lack of persistence in the rumen. Given that Propionibacterium are natural residents of the rumen, we anticipated that the introduced DFM may persist in this environment. This is the reason we elected to avoid carryover effects by selecting a completely randomized block design as opposed to a crossover or Latin square design in the present study. Better adaptability of Propionibacterium strains to the ruminal environment may induce a propionate-mediated reduction in CH4 emissions. The potential mode of action by which DFM favorably alter feed digestibility includes altering ruminal acid production, establishing desirable microflora, and increasing fiber digestion (McAllister et al., 2011). However, no treatment effects were observed on nutrient digestibility in our study, results that are in agreement with previous studies in steers fed silage based diets with Propionibacterium P169 (Lehloenya et al., 2008) and in lactating dairy cows inoculated with a combination of L. acidophilus and P. freudenreichii (Raeth-Knight et al., 2007). Conclusions Propionibacterium strains had no effect on total CH4 emissions, ruminal fermentation, or nutrient digestibility. The lack of effect might be attributed to low capability of the bacteria to integrate, compete, and persist in the ruminal microbial community of heifers adapted to high-forage diets. However, heifers supplemented with Propionibacterium strains did exhibit higher intakes when housed in individual chambers, possibly due to reduced stress, resulting in a reduction in CH4 emissions per unit of DMI. LITERATURE CITED

Alazzeh, A. Y., H. Sultana, K. A. Beauchemin, Y. Wang, H. Holo, O. M. Harstad, and T. A. McAllister. 2013. Using strains of Propionibacteria to mitigate methane emissions in vitro. Acta Agric. Scand. 62:263–272. Aleman, M. M., D. R. Stein, D. T. Allen, E. Perry, K. V. Lehloenya, T. G. Rehberger, K. J. Mertz, D. A. Jones, and L. J. Spicer. 2007. Effects of feeding two levels of propionibacteria to dairy cows on plasma hormones and metabolites. J. Dairy Res. 74:146–153. Avila-Stagno, J., A. V. Chaves, M. M. He, O. M. Harstad, K. A. Beauchemin, S. M. McGinn, and T. A. McAllister. 2013. Effects of increasing concentrations of glycerol in concentrate diets on nutrient digestibility, methane emissions, growth, fatty acid profiles, and carcass traits of lambs. J. Anim. Sci. 91:829–837. Beauchemin, K. A., W. Z. Yang, and L. M. Rode. 2003. Effects of particle size of alfalfa-based dairy cow diets on chewing activity, ruminal fermentation, and milk production. J. Dairy Sci. 86:630–643. Beauchemin, K.A., and S.M. McGinn. 2005. Methane emissions from feedlot cattle fed barley or corn diets. J. Anim. Sci. 83:653–661. Beauchemin, K. A., and S. M. McGinn. 2006. Methane emissions from beef cattle: Effects of fumaric acid, essential oil, and canola oil. J. Anim. Sci. 84:1489–1496. Bergman, E. N. 1990. Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol. Rev. 70:567–590. Blaxter, K. L., and J. L. Clapperton. 1965. Prediction of the amount of methane produced by ruminants. Br. J. Nutr. 19:511–522. Brown, E. G., R. C. Anderson, G. E. Carstens, H. Gutierrez-Banuelos, J. L. McReynolds, L. J. Slay, T. R. Callaway, and D. J. Nisbet. 2011. Effects of oral nitroethane administration on enteric methane emissions and ruminal fermentation in cattle. Anim. Feed Sci. Technol. 166–167:275–281. CCAC. 1993. Guide to the care and use of experimental animals. Vol. 1. 2nd ed. E. D. Olfert, B. M. Cross, and A. A. McWilliam, editors, Can. Counc. Anim. Care, Ottawa, Ontario. Deborde, C., D. B. Rolin, and P. Boyaval. 1999. In vivo 13C NMR study of the bidirectional reactions of the wood-werkman cycle and around the pyruvate node in Propionibacterium freudenreichii subsp. shermanii and Propionibacterium acidipropionici. Metab. Eng. 1:309–319. Dohme, F., T. J. DeVries, and K. A. Beauchemin. 2008. Repeated ruminal acidosis challenges in lactating dairy cows at high and low risk for developing acidosis: Ruminal pH. J. Dairy Sci. 91:3554–3567. Ghorbani, G. R., D. P. Morgavi, K. A. Beauchemin, and J. A. Leedle. 2002. Effects of bacterial direct-fed microbials on ruminal fermentation, blood variables, and the microbial populations of feedlot cattle. J. Anim. Sci. 80:1977–1985. Grinstead, D. A., and S. F. Barefoot. 1992. Jenseniin G, a heat-stable bacteriocin produced by Propionibacterium jensenii P126. Appl. Environ. Microbiol. 58:215–220. Himmi, E. H., A. Bories, A. Boussaid, and L. Hassani. 2000. Propionic acid fermentation of glycerol and glucose by Propionibacterium acidipropionici and Propionibacterium freudenreichii ssp. shermanii. Appl. Microb. Biotechnol. 53:435–440. Holo, H., T. Faye, D. A. Brede, T. Nilsen, I. Ødegard, T. Langsrud, J. Brendehaug, and I. F. Nes. 2002. Bacteriocins of propionic acid bacteria. Lait 82:59–68. Hünerberg, M., S. M. McGinn, K. A. Beauchemin, E. K. Okine, O. M. Harstad, and T. A. McAllister. 2013. Effect of dried distillers grains plus solubles on enteric methane emissions and nitrogen excretion from growing beef cattle. J. Anim. Sci. 91:2846–2857. IPCC. 2006. 2006 IPCC guidelines for national greenhouse gas inventories. IGES, Hayama, Kanagawa, Japan. www.ipcc-nggip.iges. or.jp/. (Accessed 14 August 2013.) Johnson, D. E., K. A. Johnson, G. M. Ward, and M. E. Branine. 2000. Ruminants and other animals, In: M. A. K. Khalil, editor, Atmospheric methane: Its role in the global environment. Springer, Berlin, Germany. p. 112–133. Johnson, K. A., and D. E. Johnson. 1995. Methane emissions from cattle. J. Anim. Sci. 73:2483–2492.

AOAC. 2005. Official methods of analysis. 18th ed. Assoc. Off. Anal. Chem. Int., Gaithersburg, MD. Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

Propionibacterium spp. and methane emissions Kim, S. W., D. G. Standford, H. Roman-Rosario, M. T. Yokoyama, and S. R. Rust. 2000. Potential use of Propionibacterium acidipropionici, strain DH42, as a direct-fed microbial for cattle. J. Anim. Sci. 78(Suppl. 1):1225. (Abstr.) Kirjavainen, P. V., H. S. El Nezami, S. J. Salminen, J. T. Ahokas, and P. F. Wright. 1999. Effects of orally administered viable Lactobacillus rhamnosus GG and Propionibacterium freudenreichii subsp. shermanii JS on mouse lymphocyte proliferation. Clin. Diagn. Lab. Immunol. 6:799–802. Krause, D. O., W. J. M. Smith, F. M. E. Ryan, R. I. Mackie, and C. S. McSweeny. 2000. Use of 16S-rRNA based techniques to investigate the ecological succession of microbial populations in the immature lamb rumen:tracking of a specific strain of inoculated Ruminococcus and interactions with other microbial populations in vivo. Microb. Ecol. 38:365–376. Krause, D. O., R. J. Bunch, L. L. Conlan, P. M. Kennedy, W. J. Smith, R. I. Mackie, and C. S. McSweeney. 2001. Repeated ruminal dosing of Ruminococcus spp. does not result in persistence, but changes in other microbial populations occur that can be measured with quantitative 16S-rRNA based probes. Microbiology 147:1719–1729. Krehbiel, C. R., S. R. Rust, G. Zhang, and S. E. Gilliland. 2003. Bacterial direct-fed microbials in ruminant diets: Performance response and mode of action. J. Anim. Sci. 81(E-Suppl. 2):E120–E132. Lassey, K. R. 2008. Livestock methane emission and its perspective in the global methane cycle. Aust. J. Exp. Agric. 48:114–118. Lehloenya, K. V., C. R. Krehbiel, K. J. Mertz, T. G. Rehberger, and L. J. Spicer. 2008. Effects of propionibacteria and yeast culture fed to steers on nutrient intake and site and extent of digestion. J. Dairy Sci. 91:653–662. Luo, J. 2012. Investigation of the potential application of dairy propionibacteria for the treatment and prevention of ruminal acidosis. PhD Diss. Univ. of New Castle, Callaghan, New South Wales, Australia. Macfarlane, G. T., G. R. Gibson, E. Beatty, and J. H. Cummings. 1992. Estimation of short-chain fatty acid production from protein by human intestinal bacteria based on branched-chain fatty acid measurements. FEMS Microbiol. Ecol. 101:81–88. Marcoux, V., Y. Beaulieu, C. P. Champagne, and J. Goulet. 1992. Production of Propionibacterium freudenreichii subsp. shermanii in whey-based media. J. Ferment. Bioeng. 74:95–99. Martínez-Campos, R., and M. de la Torre. 2002. Production of propionate by fed-batch fermentation of Propionibacterium acidipropionici using mixed feed of lactate and glucose. Biotechnol. Lett. 24:427–431. McAllister, T. A., and C. J. Newbold. 2008. Redirecting rumen fermentation to reduce methanogenesis. Aust. J. Exp. Agric. 48:7–13. McAllister, T. A., K. A. Beauchemin, A. Y. Alazzeh, J. Baah, R. M. Teather, and K. Stanford. 2011. Review: The use of direct fed microbials to mitigate pathogens and enhance production in cattle. Can. J. Anim. Sci. 91:193–211. McGinn, S. M., K. A. Beauchemin, T. Coates, and D. Colombatto. 2004. Methane emissions from beef cattle: Effects of monensin, sunflower oil, enzymes, yeast, and fumaric acid. J. Anim. Sci. 82:3346–3356. Mead, L. J., and G. A. Jones. 1981. Isolation and presumptive identification of adherent epithelial bacteria (“epimural” bacteria) from the ovine rumen wall. Appl. Environ. Microbiol. 41:1020–1028. Moss, A. R., J. P. Jouany, and J. Newbold. 2000. Methane production by ruminants: Its contribution to global warming. Ann. Zootech. 49:231–253. Nagaraja, T. G., and K. F. Lechtenberg. 2007. Acidosis in feedlot cattle. Vet. Clin. North Am. Food Anim. Pract. 23:333–350. NRC. 2000. Nutrient requirements of beef cattle. 7th rev. ed. Natl. Acad. Press, Washington, DC.

2201

Peng, M., A. H. Smith, and T. G. Rehberger. 2011. Quantification of Propionibacterium acidipropionici P169 bacteria in environmental samples by use of strain-specific primers derived by suppressive subtractive hybridization. Appl. Environ. Microbiol. 77:3898–3902. Penner, G. B., K. A. Beauchemin, and T. Mutsvangwa. 2006. An evaluation of the accuracy and precision of a stand-alone submersible continuous ruminal pH measurement system. J. Dairy Sci. 89:2132–2140. Perez-Chaia, A., M. E. Nader de Macias, and G. Oliver. 1995. Propionibacteria in the gut: Effect on some metabolic activities of the host. Lait 75:435–445. Petri, R. M., R. J. Forster, W. Yang, J. J. McKinnon, and T. A. McAllister. 2012. Characterization of rumen bacterial diversity and fermentation parameters in concentrate fed cattle with and without forage. J. Appl. Microbiol. 112:1152–1162. Piveteau, P. 1999. Metabolism of lactate and sugars by dairy propionibacteria: A review. Lait 79:23–41. Plaizier, J. C. 2004. Replacing chopped alfalfa hay with alfalfa silage in barley grain and alfalfa-based total mixed rations for lactating dairy cows. J. Dairy Sci. 87:2495–2505. Raeth-Knight, M. L., J. G. Linn, and H. G. Jung. 2007. Effect of directfed microbials on performance, diet digestibility, and rumen characteristics of Holstein dairy cows. J. Dairy Sci. 90:1802–1809. Rehberger, J., and B. Glatz. 1998. Response of cultures of Propionibacterium to acid and low pH: Tolerance and inhibition. J. Food Prot. 61:211–216. Rossi, F., S. Torriani, and F. Dellaglio. 1999. Genus-and species-specific PCR-based detection of dairy propionibacteria in environmental samples by using primers targeted to the genes encoding 16S rRNA. Appl. Environ. Microbiol. 65:4241–4244. Sims, G. K., T. R. Ellsworth, and R. L. Mulvaney. 1995. Microscale determination of inorganic nitrogen in water and soil extracts. Commun. Soil Sci. Plant Anal. 26:303–316. Sniffen, C. J., J. D. O’Connor, P. J. Van Soest, D. G. Fox, and J. B. Russell. 1992. A net carbohydrate and protein system for evaluating cattle diets: II. Carbohydrate and protein availability. J. Anim. Sci. 70:3562–3577. Stein, D. R., D. T. Allen, E. B. Perry, J. C. Bruner, K. W. Gates, T. G. Rehberger, K. Mertz, D. Jones, and L. J. Spicer. 2006. Effects of feeding propionibacteria to dairy cows on milk yield, milk components, and reproduction. J. Dairy Sci. 89:111–125. Stevenson, D. M., and P. J. Weimer. 2007. Dominance of Prevotella and low abundance of classical ruminal bacterial species in the bovine rumen revealed by relative quantification real-time PCR. Appl. Microbiol. Biotechnol. 75:165–174. Stewart, C. S., H. J. Flint, and M. P. Bryant. 1997. The rumen bacteria. In: P.N. Hobson and C.S. Stewart, editors, The rumen microbial ecosystem. 2nd ed. Blackie Acad. Prof., London. p. 10–72. Van Soest, P. J., J. B. Robertson, and B. A. Lewis. 1991. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 74:3583–3597. Wallace, R. J. 1994. Ruminal microbiology, and ruminant nutrition: Progress and problems. J. Anim. Sci. 72:2992–3003. Weiss, W. P., D. J. Wyatt, and T. R. McKelvey. 2008. Effect of feeding Propionibacteria on milk production by early lactation dairy cows. J. Dairy Sci. 91:646–652. Yu, Y., C. Lee, J. Kim, and S. Hwang. 2005. Group-specific primer and probe sets to detect methanogenic communities using quantitative real-time polymerase chain reaction. Biotechnol. Bioeng. 89:670–679. Zhou, M., E. Hernandez-Sanabria, and L. Guan. 2009. Assessment of the microbial ecology of ruminal methanogens in cattle with different feed efficiencies. Appl. Environ. Microbiol. 75:6524–6533.

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014

References

This article cites 49 articles, 17 of which you can access for free at: http://www.journalofanimalscience.org/content/92/5/2192#BIBL

Downloaded from www.journalofanimalscience.org at Universite Laval on July 1, 2014