G Model IJHEH-12761; No. of Pages 7
ARTICLE IN PRESS International Journal of Hygiene and Environmental Health xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
International Journal of Hygiene and Environmental Health journal homepage: www.elsevier.com/locate/ijheh
Effect of polymorphic metabolizing genes on micronucleus frequencies among benzene-exposed shoe workers in China Guang-hui Zhang a,1 , Ling-li Ye b,1 , Jin-wei Wang a,1 , Jing-chao Ren c,1 , Xiao-wen Xu a,1 , Nan-nan Feng a,1 , Li-fang Zhou a , Jian-guo Ru a , Yan-hui Hao a , Wei tian a , Pin Sun a , William W. Au d , David C. Christiani e , Zhao-lin Xia a,∗ a
Department of Occupational Health and Toxicology, School of Public Health, Fudan University, 138 Yixueyuan Road, Shanghai 200032, China Department of Clinical Laboratory, Wenzhou People’s Hospital, 57 Canghou Road, Wenzhou 325000, China c Department of Epidemiology and Biostatistics, School of Public Health, Xinxiang Medical University, 601 Jinsui Road, Xinxiang 453003, China d MPH Education Center, Shantou University Medical College, Shantou, Guangdong Province, China e Environmental & Occupational Medicine & Epidemiology Program, Department of Environmental Health, Harvard School of Public Health, Boston, MA 02115, USA b
a r t i c l e
i n f o
Article history: Received 22 December 2013 Received in revised form 22 February 2014 Accepted 7 March 2014 Keywords: Benzene Micronuclei Polymorphism CYP2E1 GSTs mEH
a b s t r a c t It is well-known that metabolism of benzene is required for the induction of toxicity and consequent health problems. Therefore, genetic variation in benzene (BZ) metabolism genes can influence health outcomes. However, large population studies are needed to provide more evidence for such relationship. We have conducted a large population investigation (385 BZ-exposed shoe workers and 197 matched healthy controls) on the association between inheritance of certain BZ metabolizing genes and the expression of micronuclei (MN). The latter was based on the cytokinesis-blocked MN assay. We analyzed the polymorphisms of GSTM1, GSTT1, GSTP1 (rs1695), CYP2E1 (rs3813867), CYP2E1 (rs2031920), CYP2E1 (rs6413432), mEH exon 3 (rs1051740), mEH exon 4 (rs2234922). Univariate Poisson regression analysis demonstrated that the BZ-exposed workers had significantly increased MN frequency compared with the controls (FR = 1.84, 95% CI: 1.56–2.18; P < 0.001), and showed a cumulative exposure dose–response relationship. The CYP2E1 rs3813867 mutant allele (CC + GC) (FR 1.15, 95% CI 1.02–1.29; P = 0.020) and rs2031920 variant allele (CT + TT) (FR = 1.23, 95% CI: 1.09–1.37, P < 0.01) was associated with higher MN frequency significantly compared with the wild genotype separately. Furthermore, the MN frequency in rs2031920 variant allele (CT + TT) (FR = 1.17, 95% CI: 1.04–1.31, P < 0.01) was also higher than the wild genotype when the age, gender and cumulative exposure dose was adjusted in Poisson regression. In addition, the CYP2E1, however, GSTM1null, GSTT1null, GSTP1 rs1695, rs6413432, rs1051740 and rs2234922 polymorphisms showed no association with MN frequency. Our results indicate that two promoter polymorphisms in the CYP2E1 gene, especially the rs2031920 variant allele, were involved with the BZ-induction of MN and may contribute to risk of cancer among exposed workers. © 2014 Elsevier GmbH. All rights reserved.
Introduction Benzene (C6 H6 , BZ) is an important industrial chemical which is used to synthesize a series of derivatives and as component of many organic solvents. As a known environmental carcinogen, BZ contributes to the risk of blood and bone marrow disorders, including myelodysplastic syndrome, hematotoxicity, genotoxicity, and leukemia (McHale et al., 2012), even in workers exposed to less than
∗ Corresponding author. Tel.: +86 21 54237050; fax: +86 21 54237050. E-mail address: [email protected] (Z.-l. Xia). 1 These authors contributed equally to this work.
1 ppm of benzene in air (Lan et al., 2004; Krieg et al., 2012). Although BZ has been known as a human carcinogen for many years, it is still a hot topic in environmental health (Hollins et al., 2013; Ruchirawat et al., 2013) because the safe exposure level to BZ is still arguable and genetic predisposition (polymorphisms) to benzene toxicity is still being investigated (Dougherty et al., 2008). The cytokinesis-block micronucleus (MN) assay in peripheral lymphocytes is widely used to assess chromosome breakage, especially for populations that have been exposed to environmental pollutants (Fenech et al., 2011; Fenech and Bonassi, 2011). The frequency of MN is generally used as a biomarker of genetic damage and genome stability in human populations. Consequently, increased MN can be used to predict elevated health risk from
http://dx.doi.org/10.1016/j.ijheh.2014.03.003 1438-4639/© 2014 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Zhang, G.-h., et al., Effect of polymorphic metabolizing genes on micronucleus frequencies among benzene-exposed shoe workers in China. Int. J. Hyg. Environ. Health (2014), http://dx.doi.org/10.1016/j.ijheh.2014.03.003
G Model IJHEH-12761; No. of Pages 7
ARTICLE IN PRESS G.-h. Zhang et al. / International Journal of Hygiene and Environmental Health xxx (2014) xxx–xxx
2
exposure to mutagenic or carcinogenic agents (Au et al., 2010; Schmid and Speit, 2007). The assay has been proven to be suitable to reflect chromosome damage caused by BZ (Angelini et al., 2012; Yang et al., 2012). However, most of previous reports explored the relationship between MN and benzene exposure with the premise of relatively small number of participants, or lack of airborne exposure measurements. It is generally accepted that benzene carcinogenicity is mediated by its metabolic activation and detoxification, which are modified by metabolizing enzymes (Gu et al., 2007; Atkinson, 2009). The major metabolic pathway of benzene begins with CYP2E1mediated oxidation of benzene to benzene oxide (BO), which is in equilibrium with its tautomer, oxepin (Kim et al., 2007). Benzene oxide can be hydrolyzed by microsomal epoxide hydrolase (mEH) to benzene dihydrodiol that is then converted to a catechol or can undergo ring opening to produce trans, trans-muconaldehyde which can spontaneously rearrange to form phenol, which is then hydroxylated in the liver to form hydroquinone (HQ) (Recio et al., 2005). Glutathione S-transferases (GSTs) are a superfamily of polymorphic enzymes involved in the conjugation of reactive chemical intermediates to soluble forms, and they play an important role in the detoxification of endogenous and exogenous compounds (Silva et al., 2004). In the metabolism of benzene, GSTs produces s-phenylmercapturic acid (s-PMA) as a metabolite. Although a lot of studies have been conducted on the genetic polymorphisms and benzene metabolism, the overall effect of polymorphic sites in some of the genes are not clear, especially the promoter region of CYP2E1 (Dougherty et al., 2008), and GSTs (Pitarque et al., 2002; Leopardi et al., 2003; Garte et al., 2008). Furthermore, most researches focused on the association between genetic polymorphisms of benzene metabolizing genes and biomarkers of exposure (Kim et al., 2007; Dougherty et al., 2008), but the genes of CYP2E1, mEH, and GSTs might account for human variable response to benzene. The aim of the present study was to determine: (i) whether BZ-exposed workers had increased MN and (ii) the effects of polymorphic forms of CYP2E1, mEH, and GSTs on the MN frequency among the workers.
questionnaire surveys and the blood collection were conducted from May to December in 2011. Assessment of benzene exposure For the analysis of the airborne benzene levels, we sampled three times a day at 9, 11, 16 o’clock, with 0.1 L/min for 15 min using the GS – IIIB air sampler (Hongyu, Shanghai, China). Air samples were also collected from different worksites of the plant three times during the study. The samples were analyzed by gas chromatography with flame ionization detector (GC-FID) after desorption of benzene from the active carbon with carbon disulfide. Calculation of the cumulative exposure dose (CED) for each worker was estimated on the base of record of his work history, work location and duration at the plant, and the geometric mean of benzene concentration C was also estimated for each work site. The cumulated exposure dose (CED) was then calculated as, CED (mg/m3 -year) = C (mg/m3 ) × T (year), as described previously (Wang et al., 2011). Cytokinesis-block micronucleus assay The assay was performed according to the standard method described by Fenech (1993, 2007). Briefly, 0.5 ml heparin anticoagulated whole blood was added to 4.5 ml of medium (RMPI 1640) and incubated at 37 ◦ C. Cytochalasin-B (Sigma–Aldrich, St. Louis, MO) was added to each cell culture after 44 h at a final concentration of 6 g/ml to prevent cytokinesis. Twenty-eight hours after the addition of cytochalasin-B, cells were harvested by cytocentrifugation and fixed with methanol and acetic acid at a ratio of 3:1. Slides were air-dried and stained with Giemsa and scored for MN. For each subject, MN in 1000 binucleated lymphocytes with wellpreserved cytoplasms was scored blindly by the trained staff. A PhD candidate and three master students major in occupational health scored the binucleated MN. We took a picture of all the ambiguous and confirmative MNs for each sample at the first counting the 1000 binucleated lymphocytes for each subjects. We checked every picture of MN for each of samples together. Genotyping assays
Materials and methods Study population On the basis of employment records, 385 (190 men and 195 women, and from 19 to 57 year old) BZ-exposed workers were recruited from shoe manufacturers, who used similar materials and production work flow, during routine medical evaluations in Wenzhou, Zhejiang province, China. After written informed consent was obtained, each subject underwent an interviewer-administered questionnaire, which consisted of demographic characteristics, medication, smoking and drinking habits, and occupational history. Study subjects exposed to benzene for a period at least 1 year were selected if the following criteria were met: detailed questionnaires had been completed; blood samples had been collected as part of the routine medical evaluations. Additionally two groups of indoor and non-exposed workers who were matched by gender and age with the cases served as controls. And 102 indoor workers (50 men and 52 women) from the same city of the exposed workers served as internal control whereas 95 teachers (49 men and 46 women) from Shanghai served as external control. Both of the two groups were from 19 to 57 years old. Both groups were ethnically Han Chinese. After obtaining informed consent, a total of 5 ml anticoagulated peripheral blood was collected from each subject. The
Genomic DNA was isolated from peripheral blood using a DNA isolation kit (Life Feng Biotechnology Co, Shanghai) according to the manufacturer’s instructions, and frozen at −80 ◦ C. We analyzed the polymorphisms of GSTM1, GSTT1, GSTP1 (rs1695), CYP2E1 (rs3813867, rs2031920, rs6413432), mEH exon 3 (rs1051740), mEH exon 4 (rs2234922) by restriction fragment length polymorphism (RFLP) analysis. For each genotype RFLP method, several positive and negative samples were selected randomly to do DNA sequencing to verify the accuracy of the method, and about 20% of samples were repeated secondly to prove the repeatability. The GSTT1, GSTM1 and ALB were determined by using multiplex PCR as described in previous investigation (Zhu et al., 2005). The primers and details of the CYP2E1 (rs3813867), CYP2E1 (rs2031920), CYP2E1 (rs6413432) were exactly as described previously (Omer et al., 2001; Yang et al., 2001; Zhu et al., 2005). The list of SNPs studied, and the primers and restriction enzymes used are summarized in Table 1. Statistical analysis SAS software package (version 9.12) was used for the statistical analysis. The significance level (alpha) was set at 5% for all analyses. Poisson regression was used to estimate the effects of BZ exposure and lifestyles on MN frequency. Genotype distributions
Please cite this article in press as: Zhang, G.-h., et al., Effect of polymorphic metabolizing genes on micronucleus frequencies among benzene-exposed shoe workers in China. Int. J. Hyg. Environ. Health (2014), http://dx.doi.org/10.1016/j.ijheh.2014.03.003
G Model
ARTICLE IN PRESS
IJHEH-12761; No. of Pages 7
G.-h. Zhang et al. / International Journal of Hygiene and Environmental Health xxx (2014) xxx–xxx
3
Table 1 Primers and enzymes used for PCR-RFLP genotyping. Gene (polymorphism)
ID
Primers
Restriction enzyme
Banding pattern
GSTM1
–
–
219 bp
GSTT1
–
–
459 bp
ALB
–
–
350 bp
CYP2E1-1293 G>C
rs3813867
GAACTCCCTGAAAAGCTAAAGC GTTGGGCTCAAATATACGGTGG TTCCTTACTGGTCCTCACATCTC TCACCGGATCATGGCCAGCA GCCCTCTGCTAACAAGTCCTAC GCCCTAAAAAGAAAATCGCCAATC CAGTCGAGTCTACATTGTC TTCATTCTGTCTTCTAACTG
RsaI
CYP2E1-1019 C > T
rs2031920
CCCGTGAGCCAGTCGAGT ATACAGACCCTCTTCCAC
PstI
CYP2E1 intro6 T > A
rs6413432
CTGCTGCTAATGGTCACTTG GGAGTTCAAGACCAGCCTAC
HinfI
GSTP1 EX5 A > G
rs1695
CTTCCACGCACATCCTCTTCC AAGCCCCTTTCTTTGTTCAGC
Alw261
mEH EX3–28T > C
rs1051740
GATCGATAAGTTCCGTTTCACC ATCCTTAGTCTTGAAGTGAGGAT
EcoR V
mEH EX4 + 52A > G
rs2234922
ACATCCACTTCATCCACGT ATGCCTCTGAGAAGCCAT
RsaI
GG: 410 bp GC: 410 bp, 290 bp, 120 bp CC: 290 bp, 120 bp CC: 510 bp CT: 510 bp, 360 bp, 150 bp TT: 150 bp, 360 bp TT: 688 bp TA: 688 bp, 350 bp, 338 bp AA: 350 bp, 338 bp Ile/Ile(AA):289 bp Val/Val (GG): 218 bp, 71 bp Ile/Val (AG): 289 bp, 218 bp, 71 bp His/His(TT): 140 bp, 22 bp Tyr/Tyr (CC):162 bp His/Tyr (CT): 162 bp, 140 bp, 22 bp His/His (AA):210 bp Arg/Arg(GG):164 bp, 46 bp His/Arg (AG): 210 bp, 64 bp, 46 bp
in the general control population were tested for to ensure conformity with the Hardy–Weinberg equilibrium by means of Pearson’s 2 test. The frequencies of cytokinesis-block micronuclei per 1000 binucleated cells associated with the genotypes were estimated by computing frequency ratios (FR = eˇ , e = 2.71828, ˇ: regression coefficient), and 95% confidence intervals (CI) from univariate and multivariate Poisson regression models with adjustments for age, sex, smoking status, and alcohol drinking (Wang et al., 2013). The interaction between the SNP sites and benzene exposure were conducted in Poisson regression. PHASE software (version 2.0.2) was used to obtain maximum-likelihood estimates of the CYP2E1 and mEH diplotype frequencies as previously described (Wang et al., 2013). For categorical variables, the FR indicated a proportional increase/decrease of the micronucleus frequency in a comparison group relative to the referent. Results MN frequency and its variation by demographics and life styles Table 2 displays the demographic and lifestyle characteristics of the exposed and control workers, along with their associations with MN frequency. The MN frequency in the older (>30 years) group was significantly higher than the younger (≤30 years) one both in the control (FR = 1.88, 95% CI: 1.51–2.36; P < 0.05) and exposure groups (FR = 1.13, 95% CI: 1.02–1.25; P < 0.05). There was a small increase in MN frequency among women, smoker, and alcohol drinkers, but no statistically difference. The detailed information about the two controls’ (Wenzhou and Shanghai) MN frequency by gender, age, smoking and drinking was described in supplemental Table S1, and the MN frequency in older of two controls was higher than the younger group separately (P < 0.05).
exposed workers were divided into four groups (≥5.02 mg/m3 year, >19.90 mg/m3 -year, >31.81 mg/m3 -year, >59.00 mg/m3 -year) by quarter cumulative exposure concentration, and the other way were classified into three groups according to US (1 ppm, equal to 3.25 mg/m3 ) and China standards (6.00 mg/m3 ) by worksite benzene concentrations. Poisson regression showed the dose–response relationship between the MN frequency and exposure (supplemental Table S2). The MN frequency increased with the aggregated CED after adjusting for age, gender, smoking and drinking (P < 0.05). However, there was an interaction between the CED and age (FR (95% CI): 0.9999 (0.9998, 1.0), P < 0.01). Table 3 indicates that MN frequency was significantly increased with the elevated CED or BZ concentrations, compared with the control. In the exposed group, the MN frequency (3.35 ± 1.91) was significantly higher than that of the control group (1.92 ± 1.44) (P < 0.01). Considering the influencing of age and gender, the exposed was stratified by age and gender in supplemental Table S3. Distribution of genotypes and risk assessment for gene polymorphisms The distributions of genotypes and allele frequencies among BZexposed workers are summarized in Table 4. All polymorphisms were in Hardy–Weinberg equilibrium. In addition, Table 4 presents the association between their genotypes and MN frequency in BZexposed workers. A significantly increased risk of MN frequency was observed for carriers of the CYP2E1 (rs3813867) variant allele (genotypes CC + GC) (FR 1.15, 95% CI 1.02–1.25; P = 0.020). The CYP2E1 (rs2031920) variant allele (CT + TT) was also shown to be associated with a significantly higher MN frequency, when compared with the wild CC genotype (FR = 1.23, 95% CI: 1.09–1.37, P < 0.001).
BZ exposure and its correlation with MN frequency The intensity of benzene concentration for the exposed group ranged from 2.6 mg/m3 to 57.0 mg/m3 (median, 6.4 mg/m3 ) in the air. The cumulative benzene exposure was from 5.02 to 1183.34 mg/m3 -year, with a median at 32.19 mg/m3 -year. The
Multiple Poisson regression model for frequencies of total micronucleus Table 5 presents the results of multivariate analysis using a backward stepwise selection of variables, including age, sex,
Please cite this article in press as: Zhang, G.-h., et al., Effect of polymorphic metabolizing genes on micronucleus frequencies among benzene-exposed shoe workers in China. Int. J. Hyg. Environ. Health (2014), http://dx.doi.org/10.1016/j.ijheh.2014.03.003
G Model
ARTICLE IN PRESS
IJHEH-12761; No. of Pages 7
G.-h. Zhang et al. / International Journal of Hygiene and Environmental Health xxx (2014) xxx–xxx
4
Table 2 MN frequency of BZ-exposed workers and the controls by various demographic characteristics. Group
Number
Control Gender Male Female Age (years) ≤30 >30 Smoking Non-smoker Smoker Drinking Non-user User Exposure Gender Male Female Age (years) ≤30 >30 Smoking Non-smoker Smoker Drinking Non-user User
MeanMNa ± SD (‰)
2
FRb (95% CI)
P
99 98
1.84 ± 1.45 2.01 ± 1.43
0.88
0.347
Reference 1.12 (0.88, 1.43)
89 108
1.29 ± 1.16 2.44 ± 1.44
31.25
19.90 >31.81 >59.00
385 96 96 96 97
3.35 2.97 3.33 3.29 3.81
± ± ± ± ±
1.91 1.69 1.82 1.94 2.11
60.57 51.14 73.23 71.06 110.89
ARTICLE IN PRESS International Journal of Hygiene and Environmental Health xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
International Journal of Hygiene and Environmental Health journal homepage: www.elsevier.com/locate/ijheh
Effect of polymorphic metabolizing genes on micronucleus frequencies among benzene-exposed shoe workers in China Guang-hui Zhang a,1 , Ling-li Ye b,1 , Jin-wei Wang a,1 , Jing-chao Ren c,1 , Xiao-wen Xu a,1 , Nan-nan Feng a,1 , Li-fang Zhou a , Jian-guo Ru a , Yan-hui Hao a , Wei tian a , Pin Sun a , William W. Au d , David C. Christiani e , Zhao-lin Xia a,∗ a
Department of Occupational Health and Toxicology, School of Public Health, Fudan University, 138 Yixueyuan Road, Shanghai 200032, China Department of Clinical Laboratory, Wenzhou People’s Hospital, 57 Canghou Road, Wenzhou 325000, China c Department of Epidemiology and Biostatistics, School of Public Health, Xinxiang Medical University, 601 Jinsui Road, Xinxiang 453003, China d MPH Education Center, Shantou University Medical College, Shantou, Guangdong Province, China e Environmental & Occupational Medicine & Epidemiology Program, Department of Environmental Health, Harvard School of Public Health, Boston, MA 02115, USA b
a r t i c l e
i n f o
Article history: Received 22 December 2013 Received in revised form 22 February 2014 Accepted 7 March 2014 Keywords: Benzene Micronuclei Polymorphism CYP2E1 GSTs mEH
a b s t r a c t It is well-known that metabolism of benzene is required for the induction of toxicity and consequent health problems. Therefore, genetic variation in benzene (BZ) metabolism genes can influence health outcomes. However, large population studies are needed to provide more evidence for such relationship. We have conducted a large population investigation (385 BZ-exposed shoe workers and 197 matched healthy controls) on the association between inheritance of certain BZ metabolizing genes and the expression of micronuclei (MN). The latter was based on the cytokinesis-blocked MN assay. We analyzed the polymorphisms of GSTM1, GSTT1, GSTP1 (rs1695), CYP2E1 (rs3813867), CYP2E1 (rs2031920), CYP2E1 (rs6413432), mEH exon 3 (rs1051740), mEH exon 4 (rs2234922). Univariate Poisson regression analysis demonstrated that the BZ-exposed workers had significantly increased MN frequency compared with the controls (FR = 1.84, 95% CI: 1.56–2.18; P < 0.001), and showed a cumulative exposure dose–response relationship. The CYP2E1 rs3813867 mutant allele (CC + GC) (FR 1.15, 95% CI 1.02–1.29; P = 0.020) and rs2031920 variant allele (CT + TT) (FR = 1.23, 95% CI: 1.09–1.37, P < 0.01) was associated with higher MN frequency significantly compared with the wild genotype separately. Furthermore, the MN frequency in rs2031920 variant allele (CT + TT) (FR = 1.17, 95% CI: 1.04–1.31, P < 0.01) was also higher than the wild genotype when the age, gender and cumulative exposure dose was adjusted in Poisson regression. In addition, the CYP2E1, however, GSTM1null, GSTT1null, GSTP1 rs1695, rs6413432, rs1051740 and rs2234922 polymorphisms showed no association with MN frequency. Our results indicate that two promoter polymorphisms in the CYP2E1 gene, especially the rs2031920 variant allele, were involved with the BZ-induction of MN and may contribute to risk of cancer among exposed workers. © 2014 Elsevier GmbH. All rights reserved.
Introduction Benzene (C6 H6 , BZ) is an important industrial chemical which is used to synthesize a series of derivatives and as component of many organic solvents. As a known environmental carcinogen, BZ contributes to the risk of blood and bone marrow disorders, including myelodysplastic syndrome, hematotoxicity, genotoxicity, and leukemia (McHale et al., 2012), even in workers exposed to less than
∗ Corresponding author. Tel.: +86 21 54237050; fax: +86 21 54237050. E-mail address: [email protected] (Z.-l. Xia). 1 These authors contributed equally to this work.
1 ppm of benzene in air (Lan et al., 2004; Krieg et al., 2012). Although BZ has been known as a human carcinogen for many years, it is still a hot topic in environmental health (Hollins et al., 2013; Ruchirawat et al., 2013) because the safe exposure level to BZ is still arguable and genetic predisposition (polymorphisms) to benzene toxicity is still being investigated (Dougherty et al., 2008). The cytokinesis-block micronucleus (MN) assay in peripheral lymphocytes is widely used to assess chromosome breakage, especially for populations that have been exposed to environmental pollutants (Fenech et al., 2011; Fenech and Bonassi, 2011). The frequency of MN is generally used as a biomarker of genetic damage and genome stability in human populations. Consequently, increased MN can be used to predict elevated health risk from
http://dx.doi.org/10.1016/j.ijheh.2014.03.003 1438-4639/© 2014 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Zhang, G.-h., et al., Effect of polymorphic metabolizing genes on micronucleus frequencies among benzene-exposed shoe workers in China. Int. J. Hyg. Environ. Health (2014), http://dx.doi.org/10.1016/j.ijheh.2014.03.003
G Model IJHEH-12761; No. of Pages 7
ARTICLE IN PRESS G.-h. Zhang et al. / International Journal of Hygiene and Environmental Health xxx (2014) xxx–xxx
2
exposure to mutagenic or carcinogenic agents (Au et al., 2010; Schmid and Speit, 2007). The assay has been proven to be suitable to reflect chromosome damage caused by BZ (Angelini et al., 2012; Yang et al., 2012). However, most of previous reports explored the relationship between MN and benzene exposure with the premise of relatively small number of participants, or lack of airborne exposure measurements. It is generally accepted that benzene carcinogenicity is mediated by its metabolic activation and detoxification, which are modified by metabolizing enzymes (Gu et al., 2007; Atkinson, 2009). The major metabolic pathway of benzene begins with CYP2E1mediated oxidation of benzene to benzene oxide (BO), which is in equilibrium with its tautomer, oxepin (Kim et al., 2007). Benzene oxide can be hydrolyzed by microsomal epoxide hydrolase (mEH) to benzene dihydrodiol that is then converted to a catechol or can undergo ring opening to produce trans, trans-muconaldehyde which can spontaneously rearrange to form phenol, which is then hydroxylated in the liver to form hydroquinone (HQ) (Recio et al., 2005). Glutathione S-transferases (GSTs) are a superfamily of polymorphic enzymes involved in the conjugation of reactive chemical intermediates to soluble forms, and they play an important role in the detoxification of endogenous and exogenous compounds (Silva et al., 2004). In the metabolism of benzene, GSTs produces s-phenylmercapturic acid (s-PMA) as a metabolite. Although a lot of studies have been conducted on the genetic polymorphisms and benzene metabolism, the overall effect of polymorphic sites in some of the genes are not clear, especially the promoter region of CYP2E1 (Dougherty et al., 2008), and GSTs (Pitarque et al., 2002; Leopardi et al., 2003; Garte et al., 2008). Furthermore, most researches focused on the association between genetic polymorphisms of benzene metabolizing genes and biomarkers of exposure (Kim et al., 2007; Dougherty et al., 2008), but the genes of CYP2E1, mEH, and GSTs might account for human variable response to benzene. The aim of the present study was to determine: (i) whether BZ-exposed workers had increased MN and (ii) the effects of polymorphic forms of CYP2E1, mEH, and GSTs on the MN frequency among the workers.
questionnaire surveys and the blood collection were conducted from May to December in 2011. Assessment of benzene exposure For the analysis of the airborne benzene levels, we sampled three times a day at 9, 11, 16 o’clock, with 0.1 L/min for 15 min using the GS – IIIB air sampler (Hongyu, Shanghai, China). Air samples were also collected from different worksites of the plant three times during the study. The samples were analyzed by gas chromatography with flame ionization detector (GC-FID) after desorption of benzene from the active carbon with carbon disulfide. Calculation of the cumulative exposure dose (CED) for each worker was estimated on the base of record of his work history, work location and duration at the plant, and the geometric mean of benzene concentration C was also estimated for each work site. The cumulated exposure dose (CED) was then calculated as, CED (mg/m3 -year) = C (mg/m3 ) × T (year), as described previously (Wang et al., 2011). Cytokinesis-block micronucleus assay The assay was performed according to the standard method described by Fenech (1993, 2007). Briefly, 0.5 ml heparin anticoagulated whole blood was added to 4.5 ml of medium (RMPI 1640) and incubated at 37 ◦ C. Cytochalasin-B (Sigma–Aldrich, St. Louis, MO) was added to each cell culture after 44 h at a final concentration of 6 g/ml to prevent cytokinesis. Twenty-eight hours after the addition of cytochalasin-B, cells were harvested by cytocentrifugation and fixed with methanol and acetic acid at a ratio of 3:1. Slides were air-dried and stained with Giemsa and scored for MN. For each subject, MN in 1000 binucleated lymphocytes with wellpreserved cytoplasms was scored blindly by the trained staff. A PhD candidate and three master students major in occupational health scored the binucleated MN. We took a picture of all the ambiguous and confirmative MNs for each sample at the first counting the 1000 binucleated lymphocytes for each subjects. We checked every picture of MN for each of samples together. Genotyping assays
Materials and methods Study population On the basis of employment records, 385 (190 men and 195 women, and from 19 to 57 year old) BZ-exposed workers were recruited from shoe manufacturers, who used similar materials and production work flow, during routine medical evaluations in Wenzhou, Zhejiang province, China. After written informed consent was obtained, each subject underwent an interviewer-administered questionnaire, which consisted of demographic characteristics, medication, smoking and drinking habits, and occupational history. Study subjects exposed to benzene for a period at least 1 year were selected if the following criteria were met: detailed questionnaires had been completed; blood samples had been collected as part of the routine medical evaluations. Additionally two groups of indoor and non-exposed workers who were matched by gender and age with the cases served as controls. And 102 indoor workers (50 men and 52 women) from the same city of the exposed workers served as internal control whereas 95 teachers (49 men and 46 women) from Shanghai served as external control. Both of the two groups were from 19 to 57 years old. Both groups were ethnically Han Chinese. After obtaining informed consent, a total of 5 ml anticoagulated peripheral blood was collected from each subject. The
Genomic DNA was isolated from peripheral blood using a DNA isolation kit (Life Feng Biotechnology Co, Shanghai) according to the manufacturer’s instructions, and frozen at −80 ◦ C. We analyzed the polymorphisms of GSTM1, GSTT1, GSTP1 (rs1695), CYP2E1 (rs3813867, rs2031920, rs6413432), mEH exon 3 (rs1051740), mEH exon 4 (rs2234922) by restriction fragment length polymorphism (RFLP) analysis. For each genotype RFLP method, several positive and negative samples were selected randomly to do DNA sequencing to verify the accuracy of the method, and about 20% of samples were repeated secondly to prove the repeatability. The GSTT1, GSTM1 and ALB were determined by using multiplex PCR as described in previous investigation (Zhu et al., 2005). The primers and details of the CYP2E1 (rs3813867), CYP2E1 (rs2031920), CYP2E1 (rs6413432) were exactly as described previously (Omer et al., 2001; Yang et al., 2001; Zhu et al., 2005). The list of SNPs studied, and the primers and restriction enzymes used are summarized in Table 1. Statistical analysis SAS software package (version 9.12) was used for the statistical analysis. The significance level (alpha) was set at 5% for all analyses. Poisson regression was used to estimate the effects of BZ exposure and lifestyles on MN frequency. Genotype distributions
Please cite this article in press as: Zhang, G.-h., et al., Effect of polymorphic metabolizing genes on micronucleus frequencies among benzene-exposed shoe workers in China. Int. J. Hyg. Environ. Health (2014), http://dx.doi.org/10.1016/j.ijheh.2014.03.003
G Model
ARTICLE IN PRESS
IJHEH-12761; No. of Pages 7
G.-h. Zhang et al. / International Journal of Hygiene and Environmental Health xxx (2014) xxx–xxx
3
Table 1 Primers and enzymes used for PCR-RFLP genotyping. Gene (polymorphism)
ID
Primers
Restriction enzyme
Banding pattern
GSTM1
–
–
219 bp
GSTT1
–
–
459 bp
ALB
–
–
350 bp
CYP2E1-1293 G>C
rs3813867
GAACTCCCTGAAAAGCTAAAGC GTTGGGCTCAAATATACGGTGG TTCCTTACTGGTCCTCACATCTC TCACCGGATCATGGCCAGCA GCCCTCTGCTAACAAGTCCTAC GCCCTAAAAAGAAAATCGCCAATC CAGTCGAGTCTACATTGTC TTCATTCTGTCTTCTAACTG
RsaI
CYP2E1-1019 C > T
rs2031920
CCCGTGAGCCAGTCGAGT ATACAGACCCTCTTCCAC
PstI
CYP2E1 intro6 T > A
rs6413432
CTGCTGCTAATGGTCACTTG GGAGTTCAAGACCAGCCTAC
HinfI
GSTP1 EX5 A > G
rs1695
CTTCCACGCACATCCTCTTCC AAGCCCCTTTCTTTGTTCAGC
Alw261
mEH EX3–28T > C
rs1051740
GATCGATAAGTTCCGTTTCACC ATCCTTAGTCTTGAAGTGAGGAT
EcoR V
mEH EX4 + 52A > G
rs2234922
ACATCCACTTCATCCACGT ATGCCTCTGAGAAGCCAT
RsaI
GG: 410 bp GC: 410 bp, 290 bp, 120 bp CC: 290 bp, 120 bp CC: 510 bp CT: 510 bp, 360 bp, 150 bp TT: 150 bp, 360 bp TT: 688 bp TA: 688 bp, 350 bp, 338 bp AA: 350 bp, 338 bp Ile/Ile(AA):289 bp Val/Val (GG): 218 bp, 71 bp Ile/Val (AG): 289 bp, 218 bp, 71 bp His/His(TT): 140 bp, 22 bp Tyr/Tyr (CC):162 bp His/Tyr (CT): 162 bp, 140 bp, 22 bp His/His (AA):210 bp Arg/Arg(GG):164 bp, 46 bp His/Arg (AG): 210 bp, 64 bp, 46 bp
in the general control population were tested for to ensure conformity with the Hardy–Weinberg equilibrium by means of Pearson’s 2 test. The frequencies of cytokinesis-block micronuclei per 1000 binucleated cells associated with the genotypes were estimated by computing frequency ratios (FR = eˇ , e = 2.71828, ˇ: regression coefficient), and 95% confidence intervals (CI) from univariate and multivariate Poisson regression models with adjustments for age, sex, smoking status, and alcohol drinking (Wang et al., 2013). The interaction between the SNP sites and benzene exposure were conducted in Poisson regression. PHASE software (version 2.0.2) was used to obtain maximum-likelihood estimates of the CYP2E1 and mEH diplotype frequencies as previously described (Wang et al., 2013). For categorical variables, the FR indicated a proportional increase/decrease of the micronucleus frequency in a comparison group relative to the referent. Results MN frequency and its variation by demographics and life styles Table 2 displays the demographic and lifestyle characteristics of the exposed and control workers, along with their associations with MN frequency. The MN frequency in the older (>30 years) group was significantly higher than the younger (≤30 years) one both in the control (FR = 1.88, 95% CI: 1.51–2.36; P < 0.05) and exposure groups (FR = 1.13, 95% CI: 1.02–1.25; P < 0.05). There was a small increase in MN frequency among women, smoker, and alcohol drinkers, but no statistically difference. The detailed information about the two controls’ (Wenzhou and Shanghai) MN frequency by gender, age, smoking and drinking was described in supplemental Table S1, and the MN frequency in older of two controls was higher than the younger group separately (P < 0.05).
exposed workers were divided into four groups (≥5.02 mg/m3 year, >19.90 mg/m3 -year, >31.81 mg/m3 -year, >59.00 mg/m3 -year) by quarter cumulative exposure concentration, and the other way were classified into three groups according to US (1 ppm, equal to 3.25 mg/m3 ) and China standards (6.00 mg/m3 ) by worksite benzene concentrations. Poisson regression showed the dose–response relationship between the MN frequency and exposure (supplemental Table S2). The MN frequency increased with the aggregated CED after adjusting for age, gender, smoking and drinking (P < 0.05). However, there was an interaction between the CED and age (FR (95% CI): 0.9999 (0.9998, 1.0), P < 0.01). Table 3 indicates that MN frequency was significantly increased with the elevated CED or BZ concentrations, compared with the control. In the exposed group, the MN frequency (3.35 ± 1.91) was significantly higher than that of the control group (1.92 ± 1.44) (P < 0.01). Considering the influencing of age and gender, the exposed was stratified by age and gender in supplemental Table S3. Distribution of genotypes and risk assessment for gene polymorphisms The distributions of genotypes and allele frequencies among BZexposed workers are summarized in Table 4. All polymorphisms were in Hardy–Weinberg equilibrium. In addition, Table 4 presents the association between their genotypes and MN frequency in BZexposed workers. A significantly increased risk of MN frequency was observed for carriers of the CYP2E1 (rs3813867) variant allele (genotypes CC + GC) (FR 1.15, 95% CI 1.02–1.25; P = 0.020). The CYP2E1 (rs2031920) variant allele (CT + TT) was also shown to be associated with a significantly higher MN frequency, when compared with the wild CC genotype (FR = 1.23, 95% CI: 1.09–1.37, P < 0.001).
BZ exposure and its correlation with MN frequency The intensity of benzene concentration for the exposed group ranged from 2.6 mg/m3 to 57.0 mg/m3 (median, 6.4 mg/m3 ) in the air. The cumulative benzene exposure was from 5.02 to 1183.34 mg/m3 -year, with a median at 32.19 mg/m3 -year. The
Multiple Poisson regression model for frequencies of total micronucleus Table 5 presents the results of multivariate analysis using a backward stepwise selection of variables, including age, sex,
Please cite this article in press as: Zhang, G.-h., et al., Effect of polymorphic metabolizing genes on micronucleus frequencies among benzene-exposed shoe workers in China. Int. J. Hyg. Environ. Health (2014), http://dx.doi.org/10.1016/j.ijheh.2014.03.003
G Model
ARTICLE IN PRESS
IJHEH-12761; No. of Pages 7
G.-h. Zhang et al. / International Journal of Hygiene and Environmental Health xxx (2014) xxx–xxx
4
Table 2 MN frequency of BZ-exposed workers and the controls by various demographic characteristics. Group
Number
Control Gender Male Female Age (years) ≤30 >30 Smoking Non-smoker Smoker Drinking Non-user User Exposure Gender Male Female Age (years) ≤30 >30 Smoking Non-smoker Smoker Drinking Non-user User
MeanMNa ± SD (‰)
2
FRb (95% CI)
P
99 98
1.84 ± 1.45 2.01 ± 1.43
0.88
0.347
Reference 1.12 (0.88, 1.43)
89 108
1.29 ± 1.16 2.44 ± 1.44
31.25
19.90 >31.81 >59.00
385 96 96 96 97
3.35 2.97 3.33 3.29 3.81
± ± ± ± ±
1.91 1.69 1.82 1.94 2.11
60.57 51.14 73.23 71.06 110.89
