Plant Physiology and Biochemistry 86 (2015) 72e81

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Effect of nitrogen and phosphorus deficiency on transcriptional regulation of genes encoding key enzymes of starch metabolism in duckweed (Landoltia punctata) Zhao Zhao a, b, c, Hui-juan Shi a, Mao-lin Wang b, Long Cui d, Hai Zhao c, *, Yun Zhao b, * a

School of Basic Medical Sciences, Guiyang Medical University, 550000 Guiyang, Guizhou, China Key Laboratory of Bio-Resources and Eco-Environment, Ministry of Education, College of Life Sciences, Sichuan University, 610064 Chengdu, Sichuan, China c Chengdu Institute of Biology, Chinese Academy of Sciences, 610064 Chengdu, Sichuan, China d Livzon Pharmaceutical Group Co., Ltd, Zhuhai, Guangdong, China b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 27 September 2014 Accepted 13 November 2014 Available online 22 November 2014

The production of starch by plants influences their use as biofuels. Nitrogen (N) and phosphorus (P) regulate starch gene expression during plant growth and development, yet the role of key enzymes such as ADP-glucose pyrophosphorylase (E.C. 2.7.7.27 AGPase) in starch metabolism during N- and P-deficiency remains unknown. We investigated the effect of N- and P-deficiency on the expression of large (LeAPL1, LeAPL2, and LeAPL3) and small (LeAPS) subunits of AGPase in duckweed (Landoltia punctata) and their correlation with starch content. We first isolated the full-length cDNA encoding LeAPL1 (GenBank Accession No. KJ603244) and LeAPS (GenBank Accession No. KJ603243); they contained open reading frames of 1554 bp (57.7-kDa polypeptide of 517 amino acids) and 1578 bp (57.0 kDa polypeptide of 525 amino acids), respectively. Real-time PCR analysis revealed that LeAPL1 and LeAPL3 were highly expressed during early stages of N-deficiency, while LeAPL2 was only expressed during late stage. However, in response to P-deficiency, LeAPL1 and LeAPL2 were upregulated during early stages and LeAPL3 was primarily expressed in the late stage. Interestingly, LeAPS was highly expressed following Ndeficiency during both stages, but was only upregulated in the early stage after P-deficiency. The activities of AGPase and soluble starch synthesis enzyme (SSS EC 2.4.1.21) were positively correlated with changes in starch content. Furthermore, LeAPL3 and LeSSS (SSS gene) were positively correlated with changes in starch content during N-deficiency, while LeAPS and LeSSS were correlated with starch content in response to P-deficiency. These results elevate current knowledge of the molecular mechanisms underlying starch synthesis. © 2014 Elsevier Masson SAS. All rights reserved.

Keywords: Nitrogen Phosphorus Deficiency Starch Enzyme Expression

1. Introduction Renewable energy, such as bioethanol and biodiesel, is considered to be a promising alternative for traditional fossil fuels and has thus attracted growing attention from researchers worldwide. Currently, bioethanol is mainly produced from high starch plants, such as corn, sweet potato, and cassava (Sanchez and Cardona, 2008; Papong and Malakul, 2010). However, these plants compete

* Corresponding authors. E-mail addresses: [email protected] (Z. Zhao), shihuijuan0305@163. com (H.-j. Shi), [email protected] (M.-l. Wang), [email protected] (L. Cui), [email protected] (H. Zhao), [email protected] (Y. Zhao). http://dx.doi.org/10.1016/j.plaphy.2014.11.007 0981-9428/© 2014 Elsevier Masson SAS. All rights reserved.

with crop plants for an insufficient amount of agricultural land and cause adverse impacts on food security. Therefore, there is an urgent need to develop sustainable feed stock for bioethanol production (Tao et al., 2013). Duckweed belongs to the Lemnaceae family and lives in standing and slow-flowing waters all over the world. Moreover, it grows faster and has a longer yearly production period than most other plants (Cheng and Stomp, 2009). In fact, many species of duckweed can double their biomass every 2e3 days (Chang et al., 1977), grow year-round in warm climates (Chaiprapat et al., 2005), and ultimately achieve a biomass of 0.5e1.5 metric tons/ hectare/day fresh weight or 13e38 metric tons/hectare/year dry weight (Skillicorn et al., 1993). In addition, duckweed has also been found to accumulate up to 75% of its dry weight as starch in optimal

Z. Zhao et al. / Plant Physiology and Biochemistry 86 (2015) 72e81

conditions (Reid and Bieleski, 1970), thereby making it an excellent feedstock for bioenergy production with ethanol yields of 6.42
103 l ha1, a value 50% higher than that of maize-based ethanol production (Xu et al., 2011). These results clearly show that duckweed is a competitive starch source for bioethanol production. As such, it is becoming very important to identify new techniques for increasing the biomass and/or starch content of duckweed. Growth and starch content are affected by many factors, including nutrition concentration, CO2 aeration, temperature, and light intensity. Among these, the nutrient content of water has been found to have a direct influence on duckweed growth and starch accumulation. In our previous experiments, the total starch weight of duckweed increased by 42 fold from 1 to 7d when cultured in distilled water (Tao et al., 2013). Two major mineral nutrients for plant growth and development are nitrogen (N) and phosphorus (P) (Cai et al., 2013), which are known to be important components of key molecules in the cell (ATP, nucleic acids, chlorophyll, and phospholipids) and help modulate the expression of metabolic genes in rice (Sun et al., 2013). Furthermore, deficiencies in nitrogen (N) and phosphorus (P) result in an accumulation of carbohydrates in the leaves and roots and modify the shoot-to-root biomass ratio (Nielsen et al., 1998). Interestingly, photosynthesis and sucrose synthesis-related genes have been shown to change their expression following Pdeficiency, indicating their involvement in the observed increase in growth (Cai et al., 2013). Moreover, it is well known that AGPase and soluble starch synthase (SSS EC 2.4.1.21) play important roles in starch synthesis (Slattery et al., 2000). AGPase is a key regulatory enzyme that catalyzes the ratelimiting step of starch biosynthesis (Sakulsingharoj et al., 2004) and is made of large and small subunits in higher plants (Slattery et al., 2000). As the large subunits play a regulatory role while the small subunits have a more catalytic role, different combinations of large and small subunits are thought to produce AGPase with altered catalytic and regulatory properties. Moreover, AGPase is extremely sensitive to allosteric regulation, with glycerate-3phosphate (3-PGA) acting as an activator and Pi as an inhibitor (Slattery et al., 2000). Overexpression of the large subunit of AGPase (LSU 1) increases the starch content and grain weight of common wheat (Kang et al., 2013), while a rice mutant lacking the large subunit of ADP-glucose pyrophosphorylase in the leaf was found to have a drastically reduced starch content, but to grow normally (Tsai and Nelson, 1966). Other data reveals that the overall activity of AGPase is determined by both the large and small subunits (Dickinson and Preiss, 1969), suggesting that the involvement of both subunits should be considered when investigating N- and Pstarvation conditions. The precise regulation of each individual gene of the AGPase subunits is unknown. Moreover, the molecular regulation of other genes involved in starch synthesis and degradation during N- and P- stress conditions is also unclear (Hermans et al., 2006). SSS, a-amylase (a-AMY EC 3.2.1.1), and b-amylase (b-AMY; EC 3.2.1.2) are also known to play an important role in starch synthesis; a-amylase is the key enzyme for endo-hydrolysis of a-1,4 glucosyl bonds and b-amylase is considered the primary hydrolase that breaks down starch granules (Chen and Wang, 2012). Moreover, for many years, a-amylase was considered to initiate starch degradation, but this point is currently under debate. The objective of this study was to clarify the regulatory mechanisms governing starch accumulation during N- and P- deficiency. We investigated the effect of N and P on the activities of enzymes involved in starch biosynthesis in duckweed (Landoltia punctata) and analyzed alterations in their gene expressions. Our results indicate that N- and P-deficiency promotes the expression of genes

73

involved in starch biosynthesis while inhibiting starch degradation, thereby resulting in robust increases in overall starch accumulation. 2. Materials and methods 2.1. Plant materials and cultivation The strains of L. punctata 0202 used in this study were isolated from the ponds of Chengdu, China, as done previously (Tao et al., 2013). Upon collection, the plants were rinsed gently with distilled water to remove debris and then the healthy fronds were placed in plastic aquaria containing Hoagland solution comprised of macronutrients (1 mM KH2PO4, 10 mM KNO3, 2 mM Ca(NO3)2, and 2 mM MgSO4), micronutrients (46 uM H3BO3, 9 uM MnCl2.4H2O, 0.76 uM ZnSO4.7H2O, 0.32 uM CuSO4, and 0.55 uM H2MoO4), and an iron source (78 uM Fe-EDTA). Duckweed was cultured in 1000 ml-plastic containers (12 cm
18 cm
5 cm) at 25 ± 1  C for 7 days under a 16:8 lightedark cycle and a light intensity of 7000 lux in complete nutrient solution to maximize its production. The culture solution was refreshed every 3 days. Subsequently, the duckweed was transferred into a nutrient solution lacking either N (N) or P (P); a nutrient solution with complete nutrients was used as the control (CKþ). Salt substitutions from the complete nutrient solution were carried out (Hermans et al., 2006). For the N deficient medium, we replaced the KNO3 and Ca(NO3)2 of the standard medium with 10 mM KCl and 2 mM CaCl2, respectively. Similarly, for the P deficient medium, KH2PO4 was replaced by 1 mM KCl. All samples were harvested separately 2 h, 24 h, 3 days, 5 days, 7 days, 11 days, and 15 days following the start of treatment. Every treatment was repeated in triplicate. 2.2. Determination of fresh and dry weights To measure the fresh weight (FW), the duckweed was centrifuged in a washing machine to remove the surplus water and measured with a balance (Bergmann et al., 2000). To measure the dry weight (DW), the samples were dried at 60  C until the weight became constant. 2.3. Determination of starch and protein content Dry duckweed powder was homogenized in 3 mL 6 M HCl and the homogenate was heated in boiling water for 2 h in a water bath. The pH of the homogenate was then adjusted to 7.0 ± 0.5 with HCl (6 M) or KOH (6 M), mixed with 200 uL Pb(COOH)2, and centrifuged at 5000 g for 5 min. The sugars in the supernatant were analyzed by HPLC (Thermo 2795, Thermo Corp., USA) with an Evaporative Lightscattering Detector (All-Tech ELSD 2000, All-tech., Corp., USA). The starch content was determined using the total sugar content (starch content ¼ glucose content
0.909) (Zhang et al., 2011). The microKjeldahl N-digestion protocol was used to determine the total N content of our samples (Markus et al., 1985). The crude protein content was estimated by N
6.25 (Zhao et al., 2014). 2.4. Preparation and assay of enzymatic activity The extraction procedure for AGPase, SSS, and amylase was performed as described previously (Nakamura et al., 1989). Briefly, the samples (0.5 g fresh weight) were blended together with 0.5 g PVP and 5 ml citrate buffer (50 mM HEPES-NaOH (pH 7.4), 8 mM MgCl2, 2 mM EDTA, 12.5% (v/v) glycerol, and 2% PVP-40) in a motordriven glass homogenizer. After centrifugation (12,000 g, 10 min), the supernatant was used as the enzyme extract. All preparations were carried out at 4  C. Enzyme activities were determined as

74

Z. Zhao et al. / Plant Physiology and Biochemistry 86 (2015) 72e81

described previously: AGPase (Nakamura et al., 1989), SSS (Nishi et al., 2001), a-amylase and b-amylase (Bernfeld, 1955). Protein content was determined using bovine serum albumin as the standard (Bradford, 1976). 2.5. RNA extraction and cDNA preparation from the duckweed High-quality total RNA was extracted from 100 mg samples with an RNeasy Plant Mini Kit (Invitrogen, Carlsbad, CA, USA). The contaminating genomic DNA was removed with DNase I. Firststrand cDNA synthesis of all samples was generated with a SuperScript™ III First-Strand Synthesis System for RT-PCR (Invitrogen, 18080) using oligo-dT as the primers. 2.6. Cloning of full-length cDNA encoding AGPase large subunit and small subunit All primers were designed according to the sequences of the known AGPase subunits genes from Spirodela polyrhiza, Arabidopsis, and transcriptome data of L. punctata in the GenBank database. The forward primer for the AGPase large subunit gene (LeAGPL1) was 50 ATGGCGCTGCGGATTGAG-30 and the reverse primer was 50 -TCAGATGACAAGGCCATCCTT-30 . The forward primer for the AGPase small subunit gene (LeAPS) was 50 -ATGGCGGCGACGAGCTTC-30 and the reverse primer was 50 -TCATATGATGGTTCCGCTAGGG-30 . PCR was performed using rTaq DNA polymerase (TaKaRa Biotechnology, Dalian, China) under the following conditions: 94  C for 5 min, followed by 40 cycles of 94  C for 45 s, 50  C for 45 s, and 72  C for 90 s, with a final extension of 72  C for 10 min. The PCR products were separated by electrophoresis on a 1% (w/v) ethidium bromide-stained agarose gel and the PCR fragment of the predicted size (1500 bp) was excised from the agarose gel and purified using a Montages DNA Gel Extraction Kit (Tiangen, Beijing, China). Finally, the purified PCR products were ligated into a pMD19-T vector (TaKaRa Biotechnology, Dalian, China) for identification and sequencing.

LeAMY, and LeBMY according to the transcription sequencing data of our previous experiment (Tao et al., 2013), while the primers of LeAPL1 and LeAPS were designed based on the cDNA of LeAPL1(Genbank accession number KJ603244) and LeAPS (Genbank accession number KJ603243), respectively (Table 1). We performed qRT-PCR with the gene-specific primer pairs listed in Table 1 using the following parameters: 30 s at 95  C, 40 cycles of 5 s at 95  C, and 30 s at 60  C. PCR products were melted by gradually increasing the temperature from 55 to 95 in 0.5  C increments. 3. Results 3.1. Effect of nutrient deficiency on growth and starch content in duckweed We observed noticeable morphological changes in duckweed following N- and P-deficiency. N-deficiency resulted in short, thick, pale fronds and long, thick roots while P-deficient duckweed tended to have long roots and dark green fronds (data not shown). Moreover, the total dry biomass was significantly decreased following 15d of growth (P < N < CKþ), indicating an inhibition in the growth rate (Fig. 1A, B, Table 2). N- and P-deficiency caused a significant accumulation of starch. The starch content rose from 8.86% under control conditions (CKþ) to 23.0 and 32.5% during P- and N-deprivation, respectively (Fig. 1C). Furthermore, the starch content during N-deficiency increased from 2.4 % to 24.5 % during the first 7d, while under Pdeficient conditions it only increased from 2.4 % to 10.0 % (Fig. 1C). These results show that N-deficiency is more effective than Pdeficiency in promoting starch accumulation in L. punctata (Table 2). We found that P-deficiency did not significantly affect the protein content compared to CKþ (Fig. 1D). However, N-deficiency clearly decreased the crude protein content. By the end of the culture, the crude protein content in N-deficient duckweed was 12.5%, while CKþ duckweed was 20.5%.

2.7. Analysis of LeAPL1-and LeAPS-deduced amino acid sequence 3.2. Changes in starch metabolism and enzyme activities The yielded sequences were analyzed for their theoretical molecular weight and isoelectric point with the deduced amino acid sequence using ProtParam software. The signal peptide of the protein sequence was predicted by SignalP 4.0 Server, and the TMHMM Server version 2.0 program was used to analyze the transmembrane topological structure. The SOPMA program was applied to predict the secondary structure of LeAPL1 and LeAPS.

AGPase activity dramatically increased in N-deficient duckweed, rising from 2.1 to 16.7 U by 168 h, whereas it only increased from 2.1 to 5.8 U by 168 h in P-deficient plants (Fig. 2A). Moreover, the activity of SSS initially increased in response to both N- or P-deficiency, but fluctuated before decreasing towards control levels (Fig. 2B).

2.8. Phylogenetic analysis The amino acid sequences of LeAPL1 and LeAPS were aligned with homologous proteins previously identified in other species utilizing the ClustalX2.0.12 software. Phylogenetic trees were constructed with MEGA4.0.2 software (Sun et al., 2013) using the neighbor-joining (N-J) method in conjunction with a boot strap analysis setting at 1000 replicates in order to evaluate the reliability of the different phylogenetic groups produced. The tree files were viewed and edited using MEGA4.0.2.software. 2.9. Quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) analysis Total cDNA (1 ul) was used as the template for qRT-PCR using the SYBR® Premix Ex Taq™ II (TaKaRaBiotechnolgy, Dalian, China). The PCR reactions were performed utilizing Real-Time PCR System iQ5 (Bio-Rad, USA). We designed the primers for LeAPL2, LeAPL3, LeSSS,

Table 1 List of primers. Primer name

Sequences (5e30 )

LeAPS-F LeAPS-R LeAPL1-F LeAPL1-R LeAPL2-F LeAPL2-R LeAPL3-F LeAPL3-R LeAMY-F LeAMY-R LeBMY-F LeBMY-R LeSSS-F LeSSS-R b-actinF b-actinR

ATGGGAGCCGATTACTATGAGAC GCCCAATCCGAGCATTCTTAT GCAGATGTAGTTCGCCAGTTT GTTGTTTCCCTCCCATAATAGG GGGAGGACATAGGGACGATAAA CAGAAAGCGAGGAGAGGTGAAG TCGTCCGTCTCCTTCCCTTC GCGGAACTGGGCTGAAACTC TCCCGCTGTAAATAAGGTGGC GGGGGCATTCTTGGCAT CATCGGCACTTTTGGGCTC CGTCGGTTTCCTTCTCCATTATTAC GTGCCTGTCGTCCACTCTACTG TCTTTTGCCATCCCTCGCTT GAATGGGACAGAAGGATGCG TTCGGTGAGAAGAATAGGATGCT

Z. Zhao et al. / Plant Physiology and Biochemistry 86 (2015) 72e81

75

Fig. 1. Effect of N- and P-deficiency on the starch content, crude protein, and dry weight of duckweed. Values represent mean ± S.E. (n ¼ 3). Abbreviations: N (N-deficiency); P (P-deficiency); CKþ (full medium, control group).

Table 2 Crude, starch, and biomass productivity of L. punctata in solutions lacking P or N. Element Protein Starch content (%) content (%)

Dry weight Protein Starch (g/m2) productivity (g/ productivity (g/ m2) m2)

N P CKþ

81.6 80.1 90.1

12.5 20.0 20.5

32.6 23.0 8.86

10.2 16.0 18.5

26.6 18.4 8.0

Data were obtained from 15-day culture in 1000 ml-plastic container. N (N-deficiency); P (P-deficiency); CKþ (full medium, control group).

Both N- and P-deficiency caused a significant increase in the activity levels of a-amylase during the early stage of deprivation as compared to CKþ (Fig. 2C). N-deficiency had a more significant effect on a-amylase than P-deficiency, as it gradually increased to its maximum value at 120 h, then declined to levels similar to Pdeficient duckweed thereafter. Interestingly, P-deficiency seemed to stabilize a-amylase activity throughout the duration of the experiment, relative to CKþ. Alternatively, N- and P-deficient plants showed a steady decline in b-amylase activity from 62.9 U to 26.5 U and from 62.9 U to 14.2 U, respectively (Fig. 2D). 3.3. Isolation and characterization of AGPase, LeAPL1, and LeAPS genes We next isolated the cDNA clone encoding the AGPase large (designated LeAPL1) and small (designated LeAPS) subunits from L. punctata. Our results reveal that LeAPL1 contains an open reading frame of 1554 bp encoding a putative 57.7-kDa polypeptide of 517

amino acids with an isoelectric point of 8.55 (GenBank Accession No. KJ603244). Maximal values of the original shearing site (C score), signal peptide (S score), and synthesized shearing site (Y score) were 0.111, 0.122, and 0.148, respectively, indicating that there was no signal peptide in the deduced amino acid sequence. Transmembrane topological structure analysis indicated that most parts of LeAPL1 were outside the membrane. In addition, secondary structure prediction revealed that the proportions of a-helix, extended strand, b-turn, and random coil were 29.4%, 22.44%, 6.96%, and 41.20%, respectively, suggesting that the a-helix and random coil are major components of LeAPL1. LeAPS contains an open reading frame of 1578 bp, encoding a putative 57.0-kDa polypeptide of 525 amino acids with an isoelectric point of 6.30 (GenBank Accession No. KJ603243). Maximal values of the original shearing site (C score), signal peptide (S score), and synthesized shearing site (Y score) were 0.133, 0.127, and 0.153, respectively, indicating that there was no signal peptide in the deduced amino acid sequence. Furthermore, transmembrane topological structure analysis suggested that all parts of LeAPS were outside the membrane and secondary structure prediction revealed that the proportions of a-helix, extended strand, b-turn, and random coil were 25.9%, 22.48%, 8.57%, and 43.05%, respectively. Similar to LeAPL1, based on these results, we hypothesize that the ahelix and random coil are the major components of LeAPS. 3.4. Structural prediction and phylogenetic analysis of LeAPL1 and LeAPS The deduced amino acid sequence of LeAPL1 was found to have a high degree of homology with those of AGPase large subunit

76

Z. Zhao et al. / Plant Physiology and Biochemistry 86 (2015) 72e81

Fig. 2. Changes in the starch metabolism enzyme activities of AGPase (A), SSS (B), a-amylase (C), and b-amylase (D) in duckweed during N- and P-deficiency. Data are presented as mean ± SE (n ¼ 3). Abbreviations: N (N-deficiency); P (P-deficiency); CKþ (full medium, control group).

proteins from various biological sources, including S. polyrhiza (94%), Oryza sativa (81%), and Actinidia chinensis (79%). It also contained an N-terminal catalytic domain that resembled a dinucleotide-binding Rossmann fold in addition to a C-terminal PbH1 domain with parallel beta-helix repeats (each coil of the helix represents a structural repeat that, in some homologues, can be recognized from sequence information alone). Proteins containing these repeats are most often enzymes with polysaccharide substrates (Fig. 3). Moreover, amino acid sequence alignment with the APL1 regulatory site of S. tuberosm and S. polyrhiza showed four key conserved residues (P99, P107, P151, and K470) in LeAPL1 (Fig. 3). We further compared the deduced amino acid sequence of LeAPL1 with additional AGPase large subunits from various biological sources via a molecular phylogenetic tree analysis and found that its amino acid sequence was conserved with an average homology of 84.85% with other 10 known plants. We hypothesized that the differences in the AGPase large subunits are likely sufficient to distinguish monocot plants from dicot plants (Fig. 4A). Of note, LeAPL1 was found to be more closely related to dicot plants than to monocot plants. Furthermore, the phylogenetic tree also revealed that L. punctata LeAPL1 has the closest relationship with SpAPL1 from S. polyrhiza (GenBank Accession No. JN180634); we propose that they may have come from the same genus. Analysis of the small subunit LeAPS showed that it had a similar structure (PbH1) as LeAPL1 (Fig. 5). In addition, it contained an SAR domain comparable to Sar1p-like members of the Ras-family of small GTPases. This superfamily contains proteins that control a vast number of important processes and possess a common, structurally preserved GTP-binding domain.

The average homology of the LeAPS amino acid sequence was 87.35% of the other 11 known plants. Moreover, the plant AGPase small subunits (including L. punctata) all appeared to be very similar to each other with only a very low degree of divergence observed in the members of this protein group among the plant species (Fig. 5). However, we believe that differences in the small subunits are more sufficient to distinguish monocot plants from dicot plants. We hypothesized that LeAPS is also more closely related to that of dicot plants than it is to monocots (Fig. 4B). 3.5. Alterations in the expression patterns of LeAPL1, LeAPL2, LeAPL3, and LeAPS in response to N and P-deficiency To measure the expression of each large and small subunit gene copy, we applied qRT-PCR to mRNA samples using specific primer pairs (see Materials and Methods). In response to N-deficiency, the expression of LeAPL1 (Fig. 6A) and LeAPL3 (Fig. 6C) dramatically increased by 3.6- and 3.1- fold, respectively, in the early stage (0e2 h), whereas LeAPL2 appeared to replace LeAPL1 and LeAPL3 with a burst of activity following that time (2e72 h). At 72 h, the expression of LeAPL2 (Fig. 6B) increased 5.9-fold whereas those of LeAPL1 and LeAPL3 decreased by 0.72- and 0.7-fold, respectively, compared with 0 h. In addition, the expression of LeAPS only increased by 13e67 % in response to N-deficiency (Fig. 6D). In response to P-deficiency, the expression of LeAPL1 and LeAPL2 dramatically increased by 3.1- and 3.2- fold during the first 2 h, respectively, whereas LeAPL3 actually decreased by 0.54-fold. Subsequently, the expression of LeAPL3 appeared to supersede that of LeAPL1 and LeAPL2 at 168 h, the expression of LeAPL3 increased

Z. Zhao et al. / Plant Physiology and Biochemistry 86 (2015) 72e81

77

Fig. 3. Amino acid sequence alignment for the regulatory sites of APL1 among Spirodela polyrhiza (GenBank accession no. JN180634), Landoltia punctata (GenBank accession no KJ603244), Solanum tuberosum (GenBank accession no. X61187), and Arabidopsis thaliana (GenBank accession no. NP_197423). Important proline (P99, P107, and P151) and lysine (K470) residues critical for allosteric regulation are numbered corresponding to the L. punctata AGPase large subunit. Identical residues are shaded in black.

3.2- fold whereas LeAPL1 decreased by 0.38-fold and LeAPL2 increased by 2.4-fold, compared with that at 0 h. The expression of LeAPS only increased by 52% at 2 h and then decreased slightly thereafter. 3.6. Expression patterns of LeSSS in response to N and P-deficiency Following N-deficiency, the expression of LeSSS increased at 24 h and remained elevated for the remainder of the experiment. Alternatively, during P-deficiency the expression of LeSSS altered more slowly, peaking at 72 h, then decreasing gradually thereafter. Control plants showed a steady decrease LeSSS expression throughout the extent of the experiment (Fig. 7). 3.7. Expression patterns of LeAMY and LeBMY in response to N and P-deficiency The expression of LeAMY decreased in N-deficient plants during the first 2 h, then increase rapidly and became stable after that. Pdeprivation resulted in very similar results (Fig. 8A). Alternatively, the expression of LeBMY increased during the first 24 h of N-deficiency, then decreased rapidly thereafter; P-deficiency was again similar, increasing during the first 2 h, then decreasing (Fig. 8B). 4. Discussion Nutrients are important in plant growth and development. During times of nutrient deprivation, plants significantly improve their physical and molecular abilities to acquire any deficient nutrients. In this study, we found that duckweed (L. punctata) altered its phenotype in response to N (short, thick, pale fronds and long

roots) and P-deficiency (darker green fronds and long roots). Based on a previous report, we hypothesized that the observed modification in the root morphology occurred due to an accumulation of excess starch in the fronds, thus increasing the transport of sugars to the root (Hermans et al., 2006). In addition, N-deficiency is also known to increase the AGPase activity, which results in starch accumulation and subsequent sugar-mediated alterations of genes involved in photosynthesis (such as RbcS) that cause a reallocation of proteins in nitrogen-limited plants (Nishi et al., 2001). Similarly, the dark green fronds in the P-deficient duckweed can be attributed to higher levels chlorophyll in the leaves (Rao and Terry, 1989). The protein content of duckweed decreased throughout the duration of N-deficiency (Fig. 1D), and reached its minimum level at 11 d (12.9%, 12.9 mg/g); during this time the growth rate (fresh weight) also significantly decreased, as compared to controls (Fig. 1A). However, the growth rate (as shown by dry weight) did not noticeably decrease (Fig. 1B). These results show that protein synthesis is seriously inhibited during N-deficient conditions, since sugar, protein, and lipid are very important in maintaining the function of the cell facing N-deficiency. Duckweed clearly allocates its energy storage into starch. As compared with the CKþ, the starch content of N-deficient duckweed increased by 12.5-fold (Table 2). However, under N-deficient conditions, many microalgae change their metabolic pathways to accumulate neutral lipids mainly in the form of triacylglycerides (TAGs) (Hu et al., 2008). These differences can be attributed to the fact that different plant species have different forms of carbon and energy storage. The exact molecular cause of starch accumulation in response to N-deficiency has been difficult to determine. However, starch is known to be composed of two different glucan chains, amylose and amylopectin, and AGPase is the key enzyme that controls the

78

Z. Zhao et al. / Plant Physiology and Biochemistry 86 (2015) 72e81

Fig. 4. Phylogenetic tree analysis of LeAPL1 (A) and LeAPS (B) from plants using MEGA4.0.2 software. The LeAPL1 (A) sequences were from Actinidia chinensis (GenBank accession no. AFO84093), Cicer arietinum (GenBank accession no. NP_001266131), Citrus sinensis (GenBank accession no. XP_006489328), Landoltia punctata (GenBank accession no. KJ603244), Morus notabilis (GenBank accession no. EXB55008), Oryza sativa (GenBank accession no. NP_001051184), Zea mays (GenBank accession no. NP_001106017), Ricinus communis (GenBank accession no. XP_002517196), Spirodela polyrhiza (GenBank accession no. JN180634), Theobroma cacao (GenBank accession no. XP_007034659), and Arabidopsis thaliana (GenBank accession no. NP_197423). The LeAPS (B) sequences were from Actinidia chinensis (GenBank accession no. AFO84075), Arabidopsis thaliana (GenBank accession no. NP_199641), Brachypodium distachyon (GenBank accession no. XP_003573789), Brassica rapa subsp (GenBank accession no. AF347697), Gossypium hirsutum (GenBank accession no. ABZ01673), Hordeum vulgare (GenBank accession no. P55238), L. punctata (GenBank accession no. KJ603243), Malus domestica (GenBank accession no. ADG27450), O. sativa (GenBank accession no. P15280), Solanum lycopersicum (GenBank accession no. LOC543968), Solanum tuberosum (GenBank accession no. NP_001275124), and Vicia faba (GenBank accession no. P52416).

biosynthesis of ADP-glucose that provides a glucose substrate for amylose and amylopectin chain elongation (Sakulsingharoj et al., 2004). Moreover, SSS then transfers the glucose unit to the amylopectin molecule. In addition, a-amylase and b-amylase are considered key hydrolases for the breakdown of starch granules. In the current paper, N-deficiency increased AGPase activity by 8 fold, SSS increased by 3 fold, a-amylase initially increased from 15.1 U to 28.6 U then decreased to control levels, while b-amylase activity decreased from 62.9 U to 26.5 U by the end of experiment. Regardless of the initial increase in a-amylase, these results indicate that N-deficiency primarily affects starch accumulation by inhibiting its hydrolysis of b-amylase. The initial increase in aamylase can be explained by the fact that the secretion of aamylase is known to be induced by abiotic stress and senescence (Doyle et al., 2007). Moreover, a-amylase cannot directly degrade plastid-related starch in the living cell, but is capable of breaking down starch following cell death, thus providing glucose to the neighboring cells (Stitt and Baker, 1996).

Almost all upstream regulation of AGPase depends on the ratio of 3-phosphoglyceric acid to inorganic phosphate (3PGA/Pi) (Slattery et al., 2000); the function of 3-PGA is the main stimulator and Pi is the primary inhibitor of enzyme activity. Our results show that AGPase activity increases by approximately 2 fold under Pdeficient conditions, which can be explained by the fact that when the rate of carbon fixation exceeds the rate of sucrose synthesis and other end products in P-deprived plants, the phosphorylated intermediates also increase, resulting in a decrease of Pi and an increase of 3PGA, thus stimulating the subsequent activation of AGPase (Stitt and Baker, 1996). We also found that P-deficiency resulted in an increase in the SSS activity in the early stage of Pdeficiency and a slightly elevated a-amylase level, as compared to controls, in addition to a decrease in b-amylase activity during Pdeficiency. These results show that P deprivation ultimately inhibits the hydrolysis of starch. As stated above, AGPase plays an important role in regulating starch levels and determining patterns of starch deposition in plants (Wang and Messing, 2012). Depending on the plant species, the large subunit of AGPase is known to range from 51 to 60 kDa, whereas the small subunits range from 50 to 56 kDa. In the current paper, we found that the L. punctata subunits LeAPL1 and LeAPS encode for putative polypeptides that are 57.7 and 57.0 kDa, respectively. To gain further insight into the function of LeAPL1 and LeAPS in starch synthesis, we next cloned the L. punctata genes, then analyzed and quantified their expression. The alignment between the amino acid sequence homology sequences of LeAPL1 and LeAPS revealed a 48% identity (data not shown). In a previous study, the large subunit of iAGPLI-1 was found to share 30.9% and 28.8% homology with the small subunit of iAGPS1 and iAGPS2, respectively, in sweet potato AGPase (Harn et al., 2000). However, bacterial AGPase only consists of a single subunit. The results here may reveal that the large subunit shares less homology with the small subunit in higher evolution plants. In addition, analysis of the identity of the deduced amino acid sequence among other known AGPases revealed that the small subunits were highly conserved while the large subunits were relatively divergent (Figs. 3 and 5). In the deduced amino acids of LeAPL1, P99 was previously found to play roles in accommodating ATP phosphate groups, as it was located between a conserved GGXGXRL loop region and the strongly conserved “PAV” region involved in catalysis and allosteric regulation (Jin et al., 2005). Furthermore, site-directed mutagenesis of P107 and P151 in potato revealed significant changes affecting the enzyme regulatory properties, while P44 mutants resulted in a nearly catalytically-inactive enzyme (Hwang et al., 2007). On the other hand, K470 was shown to be involved in an increased affinity for the activator 3-PGA (Jin et al., 2005). The amino acid sequences of LeAPL1 and LeAPS were also conserved, and phylogenetic topology revealed that LeAPL1 and LeAPS were more closely related to dicot plants than to monocots (Fig. 4A, B). Moreover, gene expression analysis showed that LeAPL1, LeAPL2, and LeAPL3 were differentially expressed in response to Nand P-deficiency. For instance, during N-deficiency, LeAPL1 and LeAPL3 were both highly expressed during the early stage, while LeAPL2 was highly expressed in the late stage. Alternatively, during P-deficiency, LeAPL1 and LeAPL2 were highly expressed in the early stage, while LeAPL3 was highly expressed during the late stage. At the same time, we found LeAPLS to be highly expressed in response to N-deficiency throughout the duration of the experiment, while it was only highly expressed during the early stage of P-deficiency. Previous studies have shown that N or P-deficiency in tobacco leads to a rapid elevation in the transcript level of AgpS2 and an increase in the high levels of starch content. The expression of AgpS2 is regulated via an interaction between the nitrogen and the

Z. Zhao et al. / Plant Physiology and Biochemistry 86 (2015) 72e81

79

Fig. 5. Amino acid sequence alignment for the regulatory sites of APS from Hordeum vulgare (GenBank accession no. P55238), Landoltia punctata (GenBank accession no. KJ603243), Oryza sativa (GenBank accession no. P15280), and Arabidopsis thaliana (GenBank accession no. NP_199641). Identical residues are shaded in black.

Fig. 6. Expression of the LeAPL1 (A), LeAPL2 (B), LeAPL3 (C), and LeAPS (D) gene over time in L. punctata during N- (black bar) or P- (gray bar) deficiency and in controls (white bar). Relative expression was quantified by qRT-PCR and normalized to b-actin. Each bar represents three repetitions from each RNA sample (derived from pools of 10 plants per line). Error bars representing standard errors are shown in each case. Abbreviations: N (N-deficiency); P (P-deficiency); CKþ (full medium, control group).

phosphate status of the plant, rather than the assimilation of nitrate or phosphate to ammonium and amino acids (Nielsen et al., 1998). We also found that the expression of LeSSS was highly upregulated in response to N- or P-deficiency, especially 24 h following

deprivation. Moreover, the expression of LeAMY decreased during the first 2 h, then increased in response to N- and P-deficiency. To identify the key enzyme involved in determining the starch content of duckweed in response to N- and P-deficiency, we

80

Z. Zhao et al. / Plant Physiology and Biochemistry 86 (2015) 72e81

showed highly negative correlations (Table 3) while a-amylase activity and its gene expression (LeAMY) lacked significant correlation with starch content. During P-deficient conditions, AGPase, SSS activity, and the transcript accumulation of LeAPS and LeSSS were highly and positively correlated with starch content, while bamylase activity and the expression of LeBMY and LeAMY genes showed a strong, negative correlation (Table 3). These results showed that AGPase, working in combination with SSS, was the key enzyme controlling starch synthesis during N- and P-deficiency. In addition, starch content was highly correlated with the expression of the AGPase small subunit gene (LeAPS), but not the large subunits (LeAPL1, LeAPL2, and LeAPL3) during P-deficiency. However, the large subunit (LeAPL3), but not the small subunit (LeAPS), was highly correlated with starch content under N-deficiency. 5. Conclusion

Fig. 7. Expression of the LeSSS gene over time in L. punctata during N- (black bar) or P(gray bar) deficiency and in controls (white bar). Relative expression was quantified by qRT-PCR and normalized to b-actin. Each bar represents three repetitions from each RNA sample (derived from pools of 10 plants per line). Error bars representing standard errors are shown in each case. Abbreviations: N (N-deficiency); P (P-deficiency); CKþ (full medium, control group).

The large subunit gene (LeAPL1) and small subunit gene (LeAPS) of ADP-glucose pyrophosphorylase enzyme were cloned and their transcription expression levels and other genes encoding key enzymes of starch metabolism expression in N and P-deficiency were analyzed in L. punctata. We found differences in the expression of LeAPL1, LeAPL2, and LeAPL3 in response to N- and P-deficiency: LeAPL1 and LeAPL3 increased under N-deficient conditions while

Fig. 8. Expression of LeAMY (A) and LeBMY (B) genes over time in L. punctata during N- (black bar) or P- (gray bar) deficiency and in controls (white bar). The relative expression was quantified by qRT-PCR and normalized to b-actin. Each bar represents three repetitions from each RNA sample (derived from pools of 10 plants per line). Error bars representing standard errors are shown in each case. Abbreviations: N (N-deficiency); P (P-deficiency); CKþ (full medium, control group).

calculated the correlation of enzyme activity or gene expression to starch content. During N-deficient conditions, AGPase, SSS enzyme activity, and the transcript accumulation of LeAPL3 and LeSSS were highly and positively correlated with increases in starch content. Alternatively, b-amylase activity and its gene (LeBMY) expression

Table 3 Relationships between starch content and starch metabolism enzyme genes in duckweed in response to N- and P- deficiency. N-deficiency Enzyme AGPase

SSS

P-deficiency

r 0.863

0.657

a-amylase 0.032 b-amylase 0.878

Gene

r

Enzyme

LeAPL1 LeAPL2 LeAPL3 LeAPS LeSSS LeAMY LeBMY

0.078 0.368 0.959 0.157 0.552 0.175 0.939

AGPase

SSS

r 0.689

0.624

a-amylase 0.656 b-amylase 0.847

Gene

r

LeAPL1 LeAPL2 LeAPL3 LeAPS LeSSS LeAMY LeBMY

0.547 0.502 0.428 0.791 0.302 0.707 0.902

r: correlation coefficient between enzyme activity/expression and starch content.

LeAPL1 and LeAPL2 were upregulated under P-deficient conditions during the early stages of nutrient deficiency. In addition, transcript accumulation of LeAPL3 and LeSSS during N-deficiency was positively correlated with starch content. Alternatively, LeAPS and LeSSS were positively correlated with starch content in response to Pdeficiency. We conclude that N- and P-deficiency promotes the expression of genes involved in starch biosynthesis while inhibiting starch degradation, resulting in robust increases in overall starch accumulation. Increasing the ability of plants to produce starch will ultimately lead to a higher efficiency in the future production of biofuels.

Contributions Zhao Zhao and Hui-juan Shi did the experiment and analyzed the data. Long Cui and Mao-lin Wang reviewed the manuscript and analyzed date. Dr. Hai Zhao, Yun Zhao designed the experiment and provided the helpful comments and discussions.

Z. Zhao et al. / Plant Physiology and Biochemistry 86 (2015) 72e81

Acknowledgments The authors are very grateful to part of the Ministry of Science and Technology of the People's Republic of China (2011BAD22B03) and the Chinese Academy of Sciences (KSCX2-EW-J-22 and Y2C5021100) for their financial support. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.plaphy.2014.11.007. References Bergmann, B.A., Cheng, J., Classen, J., Stomp, A.M., 2000. In vitro selection of duckweed geographical isolates for potential use in swine lagoon effluent renovation. Bioresour. Technol. 73, 13e20. Bernfeld, P., 1955. Amylases, a and b. Methods Enzymol. 1, 149e158. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248e254. Cai, H.M., Xie, W.B., Lian, X.M., 2013. Comparative analysis of differentially expressed genes in rice under nitrogen and phosphorus starvation stress conditions. Plant Mol. Biol. Report. 31, 160e173. Chaiprapat, S., Cheng, J.J., Classen, J.J., Liehr, S.K., 2005. Role of internal nutrient storage in duckweed growth for swine wastewater treatment. TAsae 48, 2247e2258. Chang, S.M., Yang, C.C., Sung, S.C., 1977. The cultivation and the nutritional value of Lemnaceae. Bull. Inst. Chem. Acad. Sin. 24, 19e30. Chen, H.J., Wang, S.J., 2012. Abscisic acid enhances starch degradation and sugar transport in rice upper leaf sheaths at the post-heading stage. Acta Physiol. Plant. 34, 1493e1500. Cheng, J.J., Stomp, A.M., 2009. Growing duckweed to recover nutrients from wastewaters and for production of fuel ethanol and animal feed. Clean. Soil Air Water 37, 17e26. Dickinson, D.B., Preiss, J., 1969. Presence of ADP-glucose pyrophosphorylase in Shrunken-2 and Brittle-2 mutants of maize endosperm. Plant Physiol. 44, 1058e1062. Doyle, E.A., Lane, A.M., Sides, J.M., Mudgett, M.B., Monroe, J.D., 2007. An a-amylase (At4g25000) in Arabidopsis leaves is secreted and induced by biotic and abiotic stress. Plant Cell Environ. 30, 388e398. Harn, C.H., Bae, J.M., Lee, S.S., Min, S.R., Liu, J.R., 2000. Presence of multiple cDNAs encoding an isoform of ADP-glucose pyrophosphorylase large subunit from sweet potato and characterization of expression levels. Plant Cell Physiol. 41, 1235e1242. Hermans, C., Hammond, J.P., White, P.J., Verbruggen, N., 2006. How do plants respond to nutrient shortage by biomass allocation? Trends Plant Sci. 11, 610e617. Hu, Q., Sommerfeld, M., Jarvis, E., Ghirardi, M., Posewitz, M., Seibert, M., Darzins, A., 2008. Microalgal triacylglycerols as feedstocks for biofuel production: perspectives and advances. Plant J. 54 (4), 621e639. Hwang, S.K., Hamada, S., Okita, T.W., 2007. Catalytic implications of the higher plant ADP-glucose pyrophosphorylase large subunit. Phytochemistry 68 (4), 464e477.

81

Jin, X., Ballicora, M.A., Preiss, J., Geiger, J.H., 2005. Crystal structure of potato tuber ADP-glucose pyrophosphorylase. Embo J. 24 (4), 694e704. Kang, G., Liu, G., Peng, X., Wei, L., Wang, C., Zhu, Y., Ma, Y., Jiang, Y., Guo, T., 2013. Increasing the starch content and grain weight of common wheat by overexpression of the cytosolic AGPase large subunit gene. Plant Physiol. Biochem. 73, 93e98. Markus, D.K., McKinnon, J.P., Buccafuri, A.F., 1985. Automated analysis of nitrite, nitrate, and ammonium nitrogen in soils. Soil Sci. Soc. Am. J. 49, 1208e1215. Nakamura, Y., Yuki, K., Park, S.Y., Ohya, T., 1989. Carbohydrate metabolism in the developing endosperm of rice grains. Plant Cell Physiol. 30, 833e839. Nielsen, T.H., Krapp, A., Roper, S.U., Stitt, M., 1998. The sugar-mediated regulation of genes encoding the small subunit of Rubisco and the regulatory subunit of ADP glucose pyrophosphorylase is modified by phosphate and nitrogen. Plant Cell Environ. 21, 443e454. Nishi, A., Nakamura, Y., Tanaka, N., Satoh, H., 2001. Biochemical and genetic analysis of the effects of amylose-extender mutation in rice endosperm. Plant Physiol. 127, 459e472. Papong, S., Malakul, P., 2010. Life-cycle energy and environmental analysis of bioethanol production from cassava in Thailand. Bioresour. Technol. 101, 112e118. Rao, I.M., Terry, N., 1989. Leaf phosphate status, photosynthesis, and carbon partitioning in sugar beet: I. Changes in growth, gas exchange, and Calvin cycle enzymes. Plant Physiol. 90, 814e819. Reid, M.S., Bieleski, R.L., 1970. Response of Spirodela oligorrhiza to phosphorus deficiency. Plant Physiol. 46, 609e613. Sakulsingharoj, C., Choi, S.B., Hwang, S.K., Edwards, G.E., Bork, J., Meyer, C.R., Preiss, J.T., Okita, W., 2004. Engineering starch biosynthesis for increasing rice seed weight: the role of the cytoplasmic ADP-glucose pyrophosphorylase. Plant Sci. 167, 1323e1333. Sanchez, O.J., Cardona, C.A., 2008. Trends in biotechnological production of fuel ethanol from different feedstocks. Bioresour. Technol. 99, 5270e5295. Skillicorn, P., Spira, W., Journey, W., 1993. Duckweed Aquaculture: a New Aquatic Farming System for Developing Countries. Banco Mundial. Slattery, C.J., Kavakli, I.H., Okita, T.W., 2000. Engineering starch for increased quantity and quality. Trends Plant Sci. 5, 291e298. Stitt, M., 1996. Metabolic regulation of the photosynthesis. In: Baker, N. (Ed.), Advances in Photosynthetic Research. Academic Press, New York, pp. 151e190. Sun, W., Huang, A., Sang, Y., Fu, Y., Yang, Z., 2013. Carbon-nitrogen interaction modulates plant growth and expression of metabolic genes in rice. J. Plant Growth Regul. 32, 575e584. Tao, X., Fang, Y., Xiao, Y., Jin, Y.L., Ma, X.R., Zhao, Y., He, K.Z., Zhao, H., Wang, H.Y., 2013. Comparative transcriptome analysis to investigate the high starch accumulation of duckweed (Landoltia punctata) under nutrient starvation. Biotechnol. Biofuels 6, 72e87. Tsai, C.Y., Nelson, O.E., 1966. Starch-deficient maize mutant lacking adenosine dephosphate glucose pyrophosphorylase activity. Science 151, 341e343. Wang, W.Q., Messing, J., 2012. Analysis of ADP-glucose pyrophosphorylase expression during turion formation induced by abscisic acid in Spirodela polyrhiza (greater duckweed). BMC Plant Biol. 12, 5e19. Xu, J., Cui, W., Cheng, J.J., Stomp, A.M., 2011. Production of high-starch duckweed and its conversion to bioethanol. Biosyst. Eng. 110 (2), 67e72. Zhang, L., Zhao, H., Gan, M., Jin, Y.L., Gao, X., Chen, Q., Guan, J.F., Wang, Z., 2011. Application of simultaneous saccharification and fermentation (SSF) from viscosity reducing of raw sweet potato for bioethanol production at laboratory, pilot and industrial scales. Bioresour. Technol. 102, 4573e4579. Zhao, Z., Shi, H.J., Liu, Y., Zhao, H., Su, H.F., Zhao, Y., 2014. The influence of duckweed species diversity on biomass productivity and nutrient removal efficiency in swine wastewater. Bioresour. Technol. 168, 383e389.