CED
Experimental dermatology • Original article
Clinical and Experimental Dermatology
Effect of mycophenolic acid on proliferation of dermal papilla cells and induction of anagen hair follicles K. H. Jeong,1 H. J. Joo,1 J. E. Kim,1 Y. M. Park2 and H. Kang1 1 Department of Dermatology, St. Paul’s Hospital, College of Medicine, Catholic University of Korea, Seoul, Korea; and 2Department of Dermatology, Seoul St. Mary’s Hospital, College of Medicine, Catholic University of Korea, Seoul, Korea
doi:10.1111/ced.12650
Summary
Background. Mycophenolic acid (MPA), the active metabolite of mycophenolate mofetil, has anti-inflammatory effects, and is widely used as an immunomodulatory agent. However, the beneficial effect of MPA in hair-loss disorders is not fully understood. Aim. To investigate the direct effect of MPA on dermal papilla cells (DPCs), and to examine the hair growth-stimulating effects of MPA topically applied to mouse skin. Methods. Cultured DPCs were treated with various concentrations of MPA and analysed by MTT assay. Expressions of hair growth-related genes, including Wnt/ b-catenin pathway-related genes and cellular apoptosis-regulating genes, such as Bcl-2, Bax and caspase-9, were examined using reverse transcription (RT)-PCR and western blotting. The Wnt/extracellular signal-regulated kinase (ERK) pathway was analysed by western blotting. The effect of topically applied MPA on anagen hair follicle induction after microneedle (MN) treatment with or without minoxidil (MXD) was evaluated by histopathological examination and RT-PCR. Results. MPA showed a promoting effect on DPC proliferation, which was associated with increased Axin2 transcription levels. In addition, phospho-ERK protein was detected in the MPA-treated DPCs. An increased Bcl-2/Bax transcript ratio contributed to cellular proliferation, and this was maintained in the MPA-treated environment. Topically applied MPA promoted anagen hair follicle induction in mice. The effect of MPA on hair follicles was compatible with that of MXD, and this effect was accelerated by MN treatment. Conclusions. MPA promotes proliferation of DPCs and induction of anagen hair follicles in mice. This finding raises the possibility that MPA could be used as a treatment option for hair-loss disorders.
Introduction Mycophenolate mofetil (MMF) is an anti-inflammatory drug that has been widely used as an immunosuppressant in organ transplantation and treatment of autoimmune disease. Mycophenolic acid (MPA) is the active metabolite of MMF, and has high (94%) Correspondence: Dr Hoon Kang, Department of Dermatology, St. Paul’s Hospital, 180, Wangsan-ro, Dongdaemun-gu, Seoul, Korea E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. Accepted for publication 21 October 2014
894
Clinical and Experimental Dermatology (2015) 40, pp894–902
bioavailability once it is absorbed into the body.1 MPA is a potent inhibitor of inosine monophosphate dehydrogenase (IMPDH) II, the rate-limiting enzyme in the de novo biosynthesis of guanine nucleotides, which are required for cell proliferation.2 MPA is highly reactive to lymphocytes, especially T cells, which depend on the de novo biosynthesis of guanine nucleotides.3 Since MPA was introduced into the dermatological field in the 1970s, it has been used for the treatment of various kinds of inflammatory skin disorders, either as monotherapy or in combination with other therapeutic agents.4 A beneficial effect of MPA is expected in lymphocyte-mediated disorders, so some clinical
ª 2015 British Association of Dermatologists
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
trials have been conducted with systemic MMF to treat lymphocyte-mediated types of severe hair-loss disorders. However, conflicting results have been reported regarding the effectiveness of systemic MMF to treat hair-loss disorders.5–8 The number of patients with hair loss is increasing, so effective and patient-friendly therapeutic options are needed to treat lymphocytemediated hair-loss disorders. To address this issue, we examined the effects of MPA on dermal papilla cells (DPCs) and in vivo hair growth, with the aims of clarifying the mechanism of action of MPA in hair components, assessing the effectiveness of MPA in promoting hair growth and exploring the potential of MPA as a topical therapeutic option for hair-loss disorders.
Methods All animal experimental protocols were approved by the Institutional Animal Care and Use Committee of our medical institution. Cell culture and MTT assay
DPCs (Promocell GmbH, Heidlberg, Germany) were cultured as previously described,9 and then seeded (3.0 9 104 cells per well) into 24-well culture plates. The cells were treated with MPA at various concentrations of 0.001, 0.01, 0.1, 1 and 10 lmol/L in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum (FBS) for 3 days. To investigate if ERK was involved in the proliferative effect of MPA on DPCs, cells were pretreated with an ERK inhibitor, PD98059 (0, 5, 10 lmol) 1 h, and then incubated with various concentrations of MPA (the control used non-MPA). At the end of the incubation, MTT assay was performed. Absorbance was measured at a wavelength of 570 nm with an ELISA reader. Western blot analysis
Western blot analyses were performed as previously described,10 using the following antibodies: b-catenin, caspase-3/9, cleaved caspase-3/9, mitogen-activated protein kinase kinase (MEK), phospho-MEK, extracellular signal-regulated kinase (ERK) and phospho-ERK (all Cell Signaling Technology, Beverly, MA, USA), and Bax, Bcl-2, Wnt5a and b-actin (all Santa Cruz Biotechnology Inc. Santa Cruz, CA, USA). The membrane was probed with anti-rabbit IgG-horseradish peroxidase conjugates at room temperature for 1 h. Bands were visualized with an enhanced chemiluminescence (ECL)
ª 2015 British Association of Dermatologists
technique (ECL kit; Amersham Pharmacia Biotech, Amersham, Buckinghamshire, UK). Animal experiments
Female C3H/HeJ mice (Japan SLC, Inc. Shizuoka, Japan) at 7 weeks old were used. After depilating the dorsal skin of the mice, we performed a comparative study to examine the effectiveness of MPA. For the positive control, 5% minoxidil (MXD; Hyundai Pharmaceutical Co. Ltd. Seoul, Korea) was used, and a microneedle (MN) was introduced to increase the degree of drug delivery to the dermis. The back of each mouse was treated using a 0.25 or 0.5 mm MN with slight pressure once daily for a total of 10 cycles, and then 0.1 mL of 1 lmol/L MPA and 5% MXD were applied to the MN-treated skin 5 times a week for a total period of 21 days. Reverse transcription PCR analysis
Total RNA was extracted from DPCs and from mouse skin (obtained during the animal experiments described in the previous paragraph) using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized with a QuantiTect Rev Transcription kit (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions. The cDNA was used for reverse transcription (RT)-PCR, which was carried out using ExTaq polymerase (TaKaRa, Otsu, Japan). The primer sequences and PCR conditions are listed in Table 1. The PCR products were quantified with the use of analysis software (Quantity One 1-D analysis; Bio-Rad, Hercules, CA, USA). Measurement of transforming growth factor-b1 by ELISA
After incubating the cultures DPC with MPA, we harvested the conditioned medium and measured concentrations of transforming growth factor (TGF)-b1 with an ELISA kit (Human TGF-b1 immunoassay; KOMA Biotech, Seoul, Korea) in accordance with the manufacturer’s instructions. Flow cytometry assay
Cell apoptosis was examined with an Annexin V detection kit (556670; BD Biosciences, San Jose, CA, USA) in accordance with the manufacturer’s instructions. Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) assay was performed to discriminate
Clinical and Experimental Dermatology (2015) 40, pp894–902
895
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
Table 1 Primers used for PCR amplications. Species
Primer name
Forward
Reverse
Tm, °C
Cycles, n
Human
Wnt5a TGFb1 Lef1 Axin2 b-catenin GAPDH mVEGF mWnt10b mb-catenin mGAPDH
AATTCTGGCTCCACTTGTTG GCAGAAGGATCACCACAACC CAGTGACGAGCACTTTTCTC CAGTGGATGCTGGAGAGTGA AACTTGCTCAGGACAAGGAA GAAGGTGAAGGTCGGAGTCAA TCTTCAAGCCATCCTGTGTG CCCGGGACATCCAGGCGAGA GGCAGCGGCAGGATACACGG CCCCAGCAAGGACACTGAGCAA
CAATTACAACCTGGGCGAAG TGTCTGCACTGCGGAGGTAT CGTGATGGGATATACAGGCT TGCCAGTTTCTTTGGCTCTT TCCTAAAGGATGATTTACAGGTC GCTCCTGGAAGATGGTGATG GCGAGTCTGTGTTTTTGCAG CTCTGGCGCTGCCCTCCAAC CAGGACACGAGCTGACGCGG GGCTCCCTAGGCCCCTCCTGTTAT
58 60 58 55 55 60 56 65 60.6 60
37 35 35 35 36 30 37 37 37 30
Mouse
Axin2, axin-related protein; GADPH, glyceraldehydes 3-phosphate dehydrogenase; Lef1, lymphoid enhancer-binding factor-1; m, Mouse; TGFb1, transforming growth factor b1; Tm, melting temperature; VEGF, vascular endothelial growth factor; Wnt5a, wingless type MMTV integration site family, member 5A; Wnt10b, wingless type MMTV integration site family, member 10B.
between viable, early apoptotic, late apoptotic and necrotic cells. Data acquisition and analysis were conducted on a flow cytometer (FACSCanto II; BD Biosciences). Statistical analysis
For statistical analysis, we performed ANOVA and Wilcoxon signed rank test. All tests were one-sided, and P < 0.05 was considered statistically significant. All data are expressed as mean SD.
Results Effect of mycophenolic acid on cell proliferation and apoptosis
Compared with control cells, DPC proliferation was increased by 96%, 90%, 82%, 64% and 34%, respectively, after treatment with MPA at concentrations of 0.001, 0.01, 0.1, 1 and 10 lmol/L, and decreased by 10% after treatment with MPA at 100 lmol/L (Fig. 1a). Treatment with MPA at a concentration of 100 lmol/L significantly increased the number of necrotic DPCs by 1.95%, as observed in annexin V+/ PI-stained cells vs. the vehicle-treated control cells (Fig. 1b). Expression of cleaved caspase-3, cleaved caspase-9, Bax and Bcl-2 was evaluated to elucidate the apoptotic effect of MPA on the DPCs by western blot assay. Low concentrations of MPA (0.01, 0.1 and 1 lmol/L) did not affect apoptosis, such as the Bax/ Bcl-2 ratio and caspase pathway, for 24 h. By contrast, high concentrations of MPA (10 and 100 lmol/ L) induced the expression of cleaved caspase-9 for 48 h (Fig. 1c,d).
896
Clinical and Experimental Dermatology (2015) 40, pp894–902
Expression of Wnt/b-catenin (Wnt5a, Axin2, Lef1, bcatenin and glycogen synthase kinase 3b) signal and transforming growth factor-b1 in dermal papilla cells
We performed RT-PCR and western blotting to determine the Wnt/b-catenin pathway, including Wnt5a, Axin2, Lef1, b-catenin and phosphorylation of glycogen synthase kinase (GSK)3b. mRNA expression of Wnt5a and b-catenin (Fig. 2a) as well as protein expression of b-catenin and phospho-GSK3b (Fig. 2b) were significantly increased with 0.1 and 1 lmol/L MPA, whereas TGF-b1 mRNA expression did not significantly change in the DPCs. TGF-b1 levels in the culture environment of the DPCs were evaluated after treatment with MPA at various time intervals. The TGF-b1 protein level was decreased by MPA in a dose-dependent manner, and the concentration of TGF-b1 was not significantly changed at the different time intervals in the DPC supernatant (Fig. 2c). Mycophenolic acid regulation of the mitogen-activated protein kinase kinase/extracellular signal-regulated kinase pathway
MPA concentrations of 0.1 and 1 lmol/L were selected to determine the effect of MPA on the phosphorylation of MEK and ERK in the DPCs at 24 h; both phospho-ERK and MEK increased (Fig. 3a). The role of ERK in the MPA-induced proliferation of the DPCs was also examined. The DPCs were pretreated with the ERK inhibitor, PD98059 (10 lmol/L), for 1 h and then incubated with or without MPA for 24 h. PD98059 abolished the phospho-ERK and MEK expression, but this abolition was reversed by MPA at 0.1 and 1 lmol/L (Fig. 3b,c).
ª 2015 British Association of Dermatologists
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
(a)
(b)
(c)
(d)
Figure 1 Effect of mycophenolic acid (MPA) on proliferation and apoptisis of cultured dermal papilla cells (DPCs). (a) DPCs (3 9 104
cells/well) were cultured in DMEM supplemented 10% FBS and then treated with MPA at concentrations of 0.001, 0.01, 0.1, 1, 10 or 100 lmol/L for 3 days. (b) Cultured human DPCs (2 9 105 cell/well) were treated with MPA (0, 0.1, 1, 10 and 100 lmol/L) for 48 h, and stained with annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI). This group represents the state of normal cell growth. The apoptotic cells are located in the left upper quadrant (Q1; necrosis), right upper quadrant (Q2; late apoptosis) and right lower quadrant (Q4; early apoptosis) (Annexin V+/PI ). (c) Protein expression bands of Bcl-2 and Bax treated for 24 and 48 h. (d) DPCs were incubated in DMEM + 5% FBS for 48 h. MPA 100 lmol/L induced cleavage of caspase-9 at 48 h. Results are normalized relative to b-actin. The experiment was repeated three times. Data are expressed as mean SD. *P < 0.05 compared with controls.
Effect of mycophenolic acid on anagen hair follicle induction in the microneedle-stimulated mice
The growing hair shafts were visible on the dorsal skin in the groups treated with MPA, 5% MXD, MPA + MN and MXD + MN at 14 days (Fig. 4a), whereas at 21 days, hair growth was incomplete in the MPA + MN 0.5 mm group (Fig. 4b). This result might have been caused by the nonuniform MN treatment
ª 2015 British Association of Dermatologists
technique used. Histological examination showed that anagen hair follicles were increased in the MPA and MX groups. The MPA + MN 0.5 mm and the MX + MN 0.5 mm groups showed particularly effective hair growth (Fig. 4c). Furthermore, the expression of b-catenin and vascular endothelial growth factor was significantly increased in the MPA + MN and 5% MXD + MN groups (Fig. 4d,e).
Clinical and Experimental Dermatology (2015) 40, pp894–902
897
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
(a)
(b)
(c)
Figure 2 Expression of Wnt/b-catenin pathway and transforming growth factor (TGF)-b1 in dermal papilla cells (DPCs). The DPCs (2 9 105 cells/well) were cultured in serum-free DMEM for 24 h and then treated with mycophenolic acid (MPA) at concentrations of 0.001, 0.01, 0.1, 1 and 10 lmol/L for 24 h. (a) Reverse transcription (RT)-PCR bands of Wnt5a, TGF-b1, Axin2, Lef1 and b-catenin, and representative RT-PCR of target genes expression (right panel). (b) Representative band of Wnt5a, b-catenin and phosphorylation of glycogen synthase kinase (GSK)3b expression by western blotting. (c) Protein band of TGF-b1 measured by western blotting assay, and concentration of TGF-b1 by ELISA. Values are mean SD of triplicate experiments. Results are normalized relative to b-actin and GAPDH. *P < 0.05 compared with control.
Discussion The inhibition of cell growth by MPA is related to the decreased biosynthesis of guanine nucleotides (GTP and dGTP) through the inhibition of IMPDH, which impairs the proliferation of T-cell or B-cell response to antigens.2,3 However, we found that MPA also promoted the proliferation of DPCs in a culture environment, suggesting that MPA has a cell growthpromoting effect that is independent of the de novo purine synthesis in lymphocytes. Indeed, MPA has been reported to have an inhibitory effect on the proliferation of T cells without intracellular GTP and pyrimidine synthesis.11,12 This result suggests the exis-
898
Clinical and Experimental Dermatology (2015) 40, pp894–902
tence of an as yet unidentified mechanism that promotes the proliferation of DPCs. The changes in the viability of DPCs demonstrated in this study might also be caused by the stimulation of certain intracellular or extracellular signals. In contrast to previous findings about the effects of MPA on cellular proliferation, our results show that at certain concentrations, MPA can promote cell growth. In the flow cytometry analysis, treatment with 100 lmol/L MPA caused a significant increase in the number of necrotic DPCs, therefore we evaluated expression of Bcl-2, Bax, caspase-3 and caspase-9. We found that MPA increased the expression of the Bcl-2/Bax ratio
ª 2015 British Association of Dermatologists
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
(a)
(b)
(c)
Figure 3 Phosphorylation of extracellular signal-regulated kinase (ERK)1/2 and mitogen-activated protein kinase kinase (MEK) in der-
mal papilla cells (DPCs). (a) Mycophenolic acid (MPA) at 0.1 and 1 lmol/L concentrations phosphorylated ERK (left) and MEK (right), (b) DPCs were pretreated with 0, 1, 5 and 10 lmol/L of PD98059 for 1 h, then (c) stimulated with 0.1 and 1 lmol/L MPA for 24 h. b-actin was used as housekeeping gene for normalization. Representative bands used by western blotting assay and data are expressed as mean SD *P < 0.05: compared with control.
early in the experiment (at 24 h). The balance between Bcl-2 and Bax, which have antagonistic effects, plays a role in regulating cellular growth and apoptosis.13 Apoptosis is related to the activation of caspases, such as caspase-3 and caspase-9. Caspase-9, an initiator caspase, can directly cleave and activate caspase-3. In our study, DPCs treated with a high concentration of MPA showed increased expression of cleaved caspase-9. The caspase pathway mechanisms in DPCs are not fully understood, but our results show that the percentage of apoptosis was increased by treatment with a high concentration of MPA, indicating the direct involvement of the caspase pathway.
ª 2015 British Association of Dermatologists
To clarify the exact mechanisms by which MPA promotes the proliferation of DPCs, we examined changes in the expression of the ERK and Wnt/b-catenin signalling pathway genes. The Wnt family includes several secreted glycoproteins that are involved in differentiation, cell migration and growth. Our results show that treatment with MPA enhances the expression of Axin2, Lef1, Wnt5a and b-catenin, and decreases TGF-b1 mRNA and protein expression levels. These findings indicate that MPA-induced proliferation of DPCs occurs directly through intracellular activation of b-catenin, along with the involvement of Wnt5a. Previous studies have shown that MPA
Clinical and Experimental Dermatology (2015) 40, pp894–902
899
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
(a)
(b)
(c)
(d)
(e)
Figure 4 Effects of mycophenolic acid (MPA) and minoxidil (MXD) with microneedle (MN) in C3H/HeJ mice. Mice were treated with
MN after which MPA 1 lmol/L or 5% MXD was applied for (a) 14 or (b) 21 days (n = 4, per group). (c) Histopathological changes of hair follicles (haematoxylin and eosin, original magnification 9 100). (d) Expression of b-catenin, Wnt10b and vascular endothelial growth factor (VEGF) in MPA + MN groups with 0.25 or 0.5 mm needle length. (e) Representative reverse transcription (RT)-PCR of target gene expression. *Significant changes compared with control (P < 0.05) (n = 4 per group). Data are mean SD).
decreases cellular viability through the depletion of intracellular guanosine nucleotide, activation of the mitogen-activated protein kinase (MAPK) pathway and induction of an anergy state of immune function.14–17 MPA-induced proliferation of DPCs might occur as a result of cell growth because of the activation of b-catenin and increased ERK activity. The ERK inhibitor PD98059 is known to regulate the proliferation of DPCs. Our results show that MPA has a reversal effect on the PD98059-induced decrease in the phosphorylation of ERK. Based on this result, we suggest that MPA may stimulate the proliferation of DPCs via the Wnt/ERK pathway.18,19 Other members of the MAPK family, including Jun kinase (JNK) and p38,
900
Clinical and Experimental Dermatology (2015) 40, pp894–902
have been reported to play important roles in cell proliferation and death, and activation of p38 and JNK was shown to be involved in cell death and stress.20 In our study, ERK was increased by MPA, but phosphorylation of p38 and JNK was not observed (data not shown), a finding that is consistent with previous results.14,21 Furthermore, the effect of the ERK inhibitor on the DPCs was normalized by MPA treatment. This result suggests that ERK is involved in the MPAinduced proliferation of DPCs. In this study, we attempted to evaluate the hair growth-stimulating effect of topically applied MPA + MN. In mice, MPA increased the formation of anagen hair follicles to the same extent as 5% MXD.
ª 2015 British Association of Dermatologists
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
MPA + MN treatment accelerated hair-follicle induction and increased the expression of genes involved in the anagen stage (14–21 days). These results raise the possibility of using MPA as a treatment option for various types of hair-loss disorders. We believe the effects of MPA in promoting hair growth are caused by activation of intracellular signals and the maintenance of apoptosis inhibition rather than by direct stimulation of the Wnt/b-catenin signalling pathway.
Conclusion Our results indicate that the topical application of MPA is a potential treatment option for patients with chronic or recurrent alopecia who are unwilling to undergo systemic treatment or whose disease is refractory to other treatment options.
Acknowledgements This study was supported by a grant of the Korean Health Technology R&D Project, Ministry for Health & Welfare, Republic of Korea (HI09C1555).
What’s already known about this topic? Studies on the effectiveness of systemic MMF in
the treatment of T cell-infiltrating hair-loss disorders have shown conflicting results.
What does this study add? MPA has a promoting effect on proliferation of
DPCs and induction of anagen hair follicles. The cellular proliferative effect of MPA is exert-
edthrough the activation Axin2 and ERK, and its effect is maintained by the Bcl2/Bax ratio balance. The effect on hair growth of topical MPA combined with MN is comparable with that of MXD.
References 1 Bullingham RE, Nicholls AJ, Kamm BR. Clinical pharmacokinetics of mycophenolate mofetil. Clin Pharmacokinet 1998; 34: 429–55.
ª 2015 British Association of Dermatologists
2 Allison AC, Eugui EM. Mycophenolate mofetil and its mechanisms of action. Immunopharmacology 2000; 47: 85–118. 3 Mydlarski PR. Mycophenolate mofetil: a dermatologic perspective. Skin Therapy Lett 2005; 10: 1–6. 4 Gomez EC, Menendez L, Frost P. Efficacy of mycophenolic acid for the treatment of psoriasis. J Am Acad Dermatol 1979; 1: 531–7. 5 Cho BK, Sah D, Chwalek J et al. Efficacy and safety of mycophenolate mofetil for lichen planopilaris. J Am Acad Dermatol 2010; 62: 393–7. 6 Kose O, Safali M, Bulent Tastan H et al. Mycophenolate mofetil in extensive Alopecia areata: no effect in seven patients. Dermatology 2004; 209: 69–70. 7 Tursen U, Api H, Kaya T et al. Treatment of lichen planopilaris with mycophenolate mofetil. Dermatol Online J 2004; 10: 24. 8 Samrao A, Chew AL, Price V. Frontal fibrosing alopecia: a clinical review of 36 patients. Br J Dermatol 2010; 163: 1296–300. 9 Messenger AG, Senior HJ, Bleehen SS. The in vitro properties of dermal papilla cell lines established from human hair follicles. Br J Dermatol 1986; 114: 425–30. 10 Leiros GJ, Attorresi AI, Balana ME. Hair follicle stem cell differentiation is inhibited through cross-talk between Wnt/beta-catenin and androgen signalling in dermal papilla cells from patients with androgenetic alopecia. Br J Dermatol 2012; 166: 1035–42. 11 Qiu Y, Fairbanks LD, Ruckermann K et al. Mycophenolic acid-induced GTP depletion also affects ATP and pyrimidine synthesis in mitogen-stimulated primary human T-lymphocytes. Transplantation 2000; 69: 890–7. 12 Sankatsing SU, Prins JM, Yong SL et al. Mycophenolate mofetil inhibits T-cell proliferation in kidney transplant recipients without lowering intracellular dGTP and GTP. Transpl Int 2008; 21: 1066–71. 13 Adams JM, Cory S. Bcl-2-regulated apoptosis: mechanism and therapeutic potential. Curr Opin Immunol 2007; 19: 488–96. 14 Kim JY, Yoon SY, Park J et al. Mycophenolic acid induces islet apoptosis by regulating mitogen-activated protein kinase activation. Transplant Proc 2006; 38: 3277–9. 15 He X, Smeets RL, Koenen HJ et al. Mycophenolic acidmediated suppression of human CD4+ T cells: more than mere guanine nucleotide deprivation. Am J Transplant 2011; 11: 439–49. 16 Ha H, Kim MS, Park J et al. Mycophenolic acid inhibits mesangial cell activation through p38 MAPK inhibition. Life sci 2006; 79: 1561–7. 17 Zacharias LC, Damico FM, Kenney MC et al. In vitro evidence for mycophenolic acid dose-related cytotoxicity in human retinal cells. Retina 2013; 33: 2155–61. 18 Li W, Man XY, Li CM et al. VEGF induces proliferation of human hair follicle dermal papilla cells through
Clinical and Experimental Dermatology (2015) 40, pp894–902
901
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
VEGFR-2-mediated activation of ERK. Exp Cell Res 2012; 318: 1633–40. 19 Yun MS, Kim SE, Jeon SH, Lee JS, Choi KY. Both ERK and Wnt/beta-catenin pathways are involved Wnt3ainduced proliferation. J Cell Sci 2005; 118: 313–22. 20 Paraskevas S, Aikin R, Maysinger D et al. Activation and expression of ERK, JNK, and p38 MAP-kinases in isolated
902
Clinical and Experimental Dermatology (2015) 40, pp894–902
islets of Langerhans: implications for cultured islet survival. FEBS Lett 1999; 455: 203–8. 21 Shui H, Gao P, Si X et al. Mycophenolic acid inhibits albumin-induced MCP-1 expression in renal tubular epithelial cells through the p38 MAPK pathway. Mol Biol Rep 2010; 37: 1749–54.
ª 2015 British Association of Dermatologists
Experimental dermatology • Original article
Clinical and Experimental Dermatology
Effect of mycophenolic acid on proliferation of dermal papilla cells and induction of anagen hair follicles K. H. Jeong,1 H. J. Joo,1 J. E. Kim,1 Y. M. Park2 and H. Kang1 1 Department of Dermatology, St. Paul’s Hospital, College of Medicine, Catholic University of Korea, Seoul, Korea; and 2Department of Dermatology, Seoul St. Mary’s Hospital, College of Medicine, Catholic University of Korea, Seoul, Korea
doi:10.1111/ced.12650
Summary
Background. Mycophenolic acid (MPA), the active metabolite of mycophenolate mofetil, has anti-inflammatory effects, and is widely used as an immunomodulatory agent. However, the beneficial effect of MPA in hair-loss disorders is not fully understood. Aim. To investigate the direct effect of MPA on dermal papilla cells (DPCs), and to examine the hair growth-stimulating effects of MPA topically applied to mouse skin. Methods. Cultured DPCs were treated with various concentrations of MPA and analysed by MTT assay. Expressions of hair growth-related genes, including Wnt/ b-catenin pathway-related genes and cellular apoptosis-regulating genes, such as Bcl-2, Bax and caspase-9, were examined using reverse transcription (RT)-PCR and western blotting. The Wnt/extracellular signal-regulated kinase (ERK) pathway was analysed by western blotting. The effect of topically applied MPA on anagen hair follicle induction after microneedle (MN) treatment with or without minoxidil (MXD) was evaluated by histopathological examination and RT-PCR. Results. MPA showed a promoting effect on DPC proliferation, which was associated with increased Axin2 transcription levels. In addition, phospho-ERK protein was detected in the MPA-treated DPCs. An increased Bcl-2/Bax transcript ratio contributed to cellular proliferation, and this was maintained in the MPA-treated environment. Topically applied MPA promoted anagen hair follicle induction in mice. The effect of MPA on hair follicles was compatible with that of MXD, and this effect was accelerated by MN treatment. Conclusions. MPA promotes proliferation of DPCs and induction of anagen hair follicles in mice. This finding raises the possibility that MPA could be used as a treatment option for hair-loss disorders.
Introduction Mycophenolate mofetil (MMF) is an anti-inflammatory drug that has been widely used as an immunosuppressant in organ transplantation and treatment of autoimmune disease. Mycophenolic acid (MPA) is the active metabolite of MMF, and has high (94%) Correspondence: Dr Hoon Kang, Department of Dermatology, St. Paul’s Hospital, 180, Wangsan-ro, Dongdaemun-gu, Seoul, Korea E-mail: [email protected] Conflict of interest: the authors declare that they have no conflicts of interest. Accepted for publication 21 October 2014
894
Clinical and Experimental Dermatology (2015) 40, pp894–902
bioavailability once it is absorbed into the body.1 MPA is a potent inhibitor of inosine monophosphate dehydrogenase (IMPDH) II, the rate-limiting enzyme in the de novo biosynthesis of guanine nucleotides, which are required for cell proliferation.2 MPA is highly reactive to lymphocytes, especially T cells, which depend on the de novo biosynthesis of guanine nucleotides.3 Since MPA was introduced into the dermatological field in the 1970s, it has been used for the treatment of various kinds of inflammatory skin disorders, either as monotherapy or in combination with other therapeutic agents.4 A beneficial effect of MPA is expected in lymphocyte-mediated disorders, so some clinical
ª 2015 British Association of Dermatologists
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
trials have been conducted with systemic MMF to treat lymphocyte-mediated types of severe hair-loss disorders. However, conflicting results have been reported regarding the effectiveness of systemic MMF to treat hair-loss disorders.5–8 The number of patients with hair loss is increasing, so effective and patient-friendly therapeutic options are needed to treat lymphocytemediated hair-loss disorders. To address this issue, we examined the effects of MPA on dermal papilla cells (DPCs) and in vivo hair growth, with the aims of clarifying the mechanism of action of MPA in hair components, assessing the effectiveness of MPA in promoting hair growth and exploring the potential of MPA as a topical therapeutic option for hair-loss disorders.
Methods All animal experimental protocols were approved by the Institutional Animal Care and Use Committee of our medical institution. Cell culture and MTT assay
DPCs (Promocell GmbH, Heidlberg, Germany) were cultured as previously described,9 and then seeded (3.0 9 104 cells per well) into 24-well culture plates. The cells were treated with MPA at various concentrations of 0.001, 0.01, 0.1, 1 and 10 lmol/L in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum (FBS) for 3 days. To investigate if ERK was involved in the proliferative effect of MPA on DPCs, cells were pretreated with an ERK inhibitor, PD98059 (0, 5, 10 lmol) 1 h, and then incubated with various concentrations of MPA (the control used non-MPA). At the end of the incubation, MTT assay was performed. Absorbance was measured at a wavelength of 570 nm with an ELISA reader. Western blot analysis
Western blot analyses were performed as previously described,10 using the following antibodies: b-catenin, caspase-3/9, cleaved caspase-3/9, mitogen-activated protein kinase kinase (MEK), phospho-MEK, extracellular signal-regulated kinase (ERK) and phospho-ERK (all Cell Signaling Technology, Beverly, MA, USA), and Bax, Bcl-2, Wnt5a and b-actin (all Santa Cruz Biotechnology Inc. Santa Cruz, CA, USA). The membrane was probed with anti-rabbit IgG-horseradish peroxidase conjugates at room temperature for 1 h. Bands were visualized with an enhanced chemiluminescence (ECL)
ª 2015 British Association of Dermatologists
technique (ECL kit; Amersham Pharmacia Biotech, Amersham, Buckinghamshire, UK). Animal experiments
Female C3H/HeJ mice (Japan SLC, Inc. Shizuoka, Japan) at 7 weeks old were used. After depilating the dorsal skin of the mice, we performed a comparative study to examine the effectiveness of MPA. For the positive control, 5% minoxidil (MXD; Hyundai Pharmaceutical Co. Ltd. Seoul, Korea) was used, and a microneedle (MN) was introduced to increase the degree of drug delivery to the dermis. The back of each mouse was treated using a 0.25 or 0.5 mm MN with slight pressure once daily for a total of 10 cycles, and then 0.1 mL of 1 lmol/L MPA and 5% MXD were applied to the MN-treated skin 5 times a week for a total period of 21 days. Reverse transcription PCR analysis
Total RNA was extracted from DPCs and from mouse skin (obtained during the animal experiments described in the previous paragraph) using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized with a QuantiTect Rev Transcription kit (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions. The cDNA was used for reverse transcription (RT)-PCR, which was carried out using ExTaq polymerase (TaKaRa, Otsu, Japan). The primer sequences and PCR conditions are listed in Table 1. The PCR products were quantified with the use of analysis software (Quantity One 1-D analysis; Bio-Rad, Hercules, CA, USA). Measurement of transforming growth factor-b1 by ELISA
After incubating the cultures DPC with MPA, we harvested the conditioned medium and measured concentrations of transforming growth factor (TGF)-b1 with an ELISA kit (Human TGF-b1 immunoassay; KOMA Biotech, Seoul, Korea) in accordance with the manufacturer’s instructions. Flow cytometry assay
Cell apoptosis was examined with an Annexin V detection kit (556670; BD Biosciences, San Jose, CA, USA) in accordance with the manufacturer’s instructions. Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI) assay was performed to discriminate
Clinical and Experimental Dermatology (2015) 40, pp894–902
895
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
Table 1 Primers used for PCR amplications. Species
Primer name
Forward
Reverse
Tm, °C
Cycles, n
Human
Wnt5a TGFb1 Lef1 Axin2 b-catenin GAPDH mVEGF mWnt10b mb-catenin mGAPDH
AATTCTGGCTCCACTTGTTG GCAGAAGGATCACCACAACC CAGTGACGAGCACTTTTCTC CAGTGGATGCTGGAGAGTGA AACTTGCTCAGGACAAGGAA GAAGGTGAAGGTCGGAGTCAA TCTTCAAGCCATCCTGTGTG CCCGGGACATCCAGGCGAGA GGCAGCGGCAGGATACACGG CCCCAGCAAGGACACTGAGCAA
CAATTACAACCTGGGCGAAG TGTCTGCACTGCGGAGGTAT CGTGATGGGATATACAGGCT TGCCAGTTTCTTTGGCTCTT TCCTAAAGGATGATTTACAGGTC GCTCCTGGAAGATGGTGATG GCGAGTCTGTGTTTTTGCAG CTCTGGCGCTGCCCTCCAAC CAGGACACGAGCTGACGCGG GGCTCCCTAGGCCCCTCCTGTTAT
58 60 58 55 55 60 56 65 60.6 60
37 35 35 35 36 30 37 37 37 30
Mouse
Axin2, axin-related protein; GADPH, glyceraldehydes 3-phosphate dehydrogenase; Lef1, lymphoid enhancer-binding factor-1; m, Mouse; TGFb1, transforming growth factor b1; Tm, melting temperature; VEGF, vascular endothelial growth factor; Wnt5a, wingless type MMTV integration site family, member 5A; Wnt10b, wingless type MMTV integration site family, member 10B.
between viable, early apoptotic, late apoptotic and necrotic cells. Data acquisition and analysis were conducted on a flow cytometer (FACSCanto II; BD Biosciences). Statistical analysis
For statistical analysis, we performed ANOVA and Wilcoxon signed rank test. All tests were one-sided, and P < 0.05 was considered statistically significant. All data are expressed as mean SD.
Results Effect of mycophenolic acid on cell proliferation and apoptosis
Compared with control cells, DPC proliferation was increased by 96%, 90%, 82%, 64% and 34%, respectively, after treatment with MPA at concentrations of 0.001, 0.01, 0.1, 1 and 10 lmol/L, and decreased by 10% after treatment with MPA at 100 lmol/L (Fig. 1a). Treatment with MPA at a concentration of 100 lmol/L significantly increased the number of necrotic DPCs by 1.95%, as observed in annexin V+/ PI-stained cells vs. the vehicle-treated control cells (Fig. 1b). Expression of cleaved caspase-3, cleaved caspase-9, Bax and Bcl-2 was evaluated to elucidate the apoptotic effect of MPA on the DPCs by western blot assay. Low concentrations of MPA (0.01, 0.1 and 1 lmol/L) did not affect apoptosis, such as the Bax/ Bcl-2 ratio and caspase pathway, for 24 h. By contrast, high concentrations of MPA (10 and 100 lmol/ L) induced the expression of cleaved caspase-9 for 48 h (Fig. 1c,d).
896
Clinical and Experimental Dermatology (2015) 40, pp894–902
Expression of Wnt/b-catenin (Wnt5a, Axin2, Lef1, bcatenin and glycogen synthase kinase 3b) signal and transforming growth factor-b1 in dermal papilla cells
We performed RT-PCR and western blotting to determine the Wnt/b-catenin pathway, including Wnt5a, Axin2, Lef1, b-catenin and phosphorylation of glycogen synthase kinase (GSK)3b. mRNA expression of Wnt5a and b-catenin (Fig. 2a) as well as protein expression of b-catenin and phospho-GSK3b (Fig. 2b) were significantly increased with 0.1 and 1 lmol/L MPA, whereas TGF-b1 mRNA expression did not significantly change in the DPCs. TGF-b1 levels in the culture environment of the DPCs were evaluated after treatment with MPA at various time intervals. The TGF-b1 protein level was decreased by MPA in a dose-dependent manner, and the concentration of TGF-b1 was not significantly changed at the different time intervals in the DPC supernatant (Fig. 2c). Mycophenolic acid regulation of the mitogen-activated protein kinase kinase/extracellular signal-regulated kinase pathway
MPA concentrations of 0.1 and 1 lmol/L were selected to determine the effect of MPA on the phosphorylation of MEK and ERK in the DPCs at 24 h; both phospho-ERK and MEK increased (Fig. 3a). The role of ERK in the MPA-induced proliferation of the DPCs was also examined. The DPCs were pretreated with the ERK inhibitor, PD98059 (10 lmol/L), for 1 h and then incubated with or without MPA for 24 h. PD98059 abolished the phospho-ERK and MEK expression, but this abolition was reversed by MPA at 0.1 and 1 lmol/L (Fig. 3b,c).
ª 2015 British Association of Dermatologists
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
(a)
(b)
(c)
(d)
Figure 1 Effect of mycophenolic acid (MPA) on proliferation and apoptisis of cultured dermal papilla cells (DPCs). (a) DPCs (3 9 104
cells/well) were cultured in DMEM supplemented 10% FBS and then treated with MPA at concentrations of 0.001, 0.01, 0.1, 1, 10 or 100 lmol/L for 3 days. (b) Cultured human DPCs (2 9 105 cell/well) were treated with MPA (0, 0.1, 1, 10 and 100 lmol/L) for 48 h, and stained with annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI). This group represents the state of normal cell growth. The apoptotic cells are located in the left upper quadrant (Q1; necrosis), right upper quadrant (Q2; late apoptosis) and right lower quadrant (Q4; early apoptosis) (Annexin V+/PI ). (c) Protein expression bands of Bcl-2 and Bax treated for 24 and 48 h. (d) DPCs were incubated in DMEM + 5% FBS for 48 h. MPA 100 lmol/L induced cleavage of caspase-9 at 48 h. Results are normalized relative to b-actin. The experiment was repeated three times. Data are expressed as mean SD. *P < 0.05 compared with controls.
Effect of mycophenolic acid on anagen hair follicle induction in the microneedle-stimulated mice
The growing hair shafts were visible on the dorsal skin in the groups treated with MPA, 5% MXD, MPA + MN and MXD + MN at 14 days (Fig. 4a), whereas at 21 days, hair growth was incomplete in the MPA + MN 0.5 mm group (Fig. 4b). This result might have been caused by the nonuniform MN treatment
ª 2015 British Association of Dermatologists
technique used. Histological examination showed that anagen hair follicles were increased in the MPA and MX groups. The MPA + MN 0.5 mm and the MX + MN 0.5 mm groups showed particularly effective hair growth (Fig. 4c). Furthermore, the expression of b-catenin and vascular endothelial growth factor was significantly increased in the MPA + MN and 5% MXD + MN groups (Fig. 4d,e).
Clinical and Experimental Dermatology (2015) 40, pp894–902
897
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
(a)
(b)
(c)
Figure 2 Expression of Wnt/b-catenin pathway and transforming growth factor (TGF)-b1 in dermal papilla cells (DPCs). The DPCs (2 9 105 cells/well) were cultured in serum-free DMEM for 24 h and then treated with mycophenolic acid (MPA) at concentrations of 0.001, 0.01, 0.1, 1 and 10 lmol/L for 24 h. (a) Reverse transcription (RT)-PCR bands of Wnt5a, TGF-b1, Axin2, Lef1 and b-catenin, and representative RT-PCR of target genes expression (right panel). (b) Representative band of Wnt5a, b-catenin and phosphorylation of glycogen synthase kinase (GSK)3b expression by western blotting. (c) Protein band of TGF-b1 measured by western blotting assay, and concentration of TGF-b1 by ELISA. Values are mean SD of triplicate experiments. Results are normalized relative to b-actin and GAPDH. *P < 0.05 compared with control.
Discussion The inhibition of cell growth by MPA is related to the decreased biosynthesis of guanine nucleotides (GTP and dGTP) through the inhibition of IMPDH, which impairs the proliferation of T-cell or B-cell response to antigens.2,3 However, we found that MPA also promoted the proliferation of DPCs in a culture environment, suggesting that MPA has a cell growthpromoting effect that is independent of the de novo purine synthesis in lymphocytes. Indeed, MPA has been reported to have an inhibitory effect on the proliferation of T cells without intracellular GTP and pyrimidine synthesis.11,12 This result suggests the exis-
898
Clinical and Experimental Dermatology (2015) 40, pp894–902
tence of an as yet unidentified mechanism that promotes the proliferation of DPCs. The changes in the viability of DPCs demonstrated in this study might also be caused by the stimulation of certain intracellular or extracellular signals. In contrast to previous findings about the effects of MPA on cellular proliferation, our results show that at certain concentrations, MPA can promote cell growth. In the flow cytometry analysis, treatment with 100 lmol/L MPA caused a significant increase in the number of necrotic DPCs, therefore we evaluated expression of Bcl-2, Bax, caspase-3 and caspase-9. We found that MPA increased the expression of the Bcl-2/Bax ratio
ª 2015 British Association of Dermatologists
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
(a)
(b)
(c)
Figure 3 Phosphorylation of extracellular signal-regulated kinase (ERK)1/2 and mitogen-activated protein kinase kinase (MEK) in der-
mal papilla cells (DPCs). (a) Mycophenolic acid (MPA) at 0.1 and 1 lmol/L concentrations phosphorylated ERK (left) and MEK (right), (b) DPCs were pretreated with 0, 1, 5 and 10 lmol/L of PD98059 for 1 h, then (c) stimulated with 0.1 and 1 lmol/L MPA for 24 h. b-actin was used as housekeeping gene for normalization. Representative bands used by western blotting assay and data are expressed as mean SD *P < 0.05: compared with control.
early in the experiment (at 24 h). The balance between Bcl-2 and Bax, which have antagonistic effects, plays a role in regulating cellular growth and apoptosis.13 Apoptosis is related to the activation of caspases, such as caspase-3 and caspase-9. Caspase-9, an initiator caspase, can directly cleave and activate caspase-3. In our study, DPCs treated with a high concentration of MPA showed increased expression of cleaved caspase-9. The caspase pathway mechanisms in DPCs are not fully understood, but our results show that the percentage of apoptosis was increased by treatment with a high concentration of MPA, indicating the direct involvement of the caspase pathway.
ª 2015 British Association of Dermatologists
To clarify the exact mechanisms by which MPA promotes the proliferation of DPCs, we examined changes in the expression of the ERK and Wnt/b-catenin signalling pathway genes. The Wnt family includes several secreted glycoproteins that are involved in differentiation, cell migration and growth. Our results show that treatment with MPA enhances the expression of Axin2, Lef1, Wnt5a and b-catenin, and decreases TGF-b1 mRNA and protein expression levels. These findings indicate that MPA-induced proliferation of DPCs occurs directly through intracellular activation of b-catenin, along with the involvement of Wnt5a. Previous studies have shown that MPA
Clinical and Experimental Dermatology (2015) 40, pp894–902
899
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
(a)
(b)
(c)
(d)
(e)
Figure 4 Effects of mycophenolic acid (MPA) and minoxidil (MXD) with microneedle (MN) in C3H/HeJ mice. Mice were treated with
MN after which MPA 1 lmol/L or 5% MXD was applied for (a) 14 or (b) 21 days (n = 4, per group). (c) Histopathological changes of hair follicles (haematoxylin and eosin, original magnification 9 100). (d) Expression of b-catenin, Wnt10b and vascular endothelial growth factor (VEGF) in MPA + MN groups with 0.25 or 0.5 mm needle length. (e) Representative reverse transcription (RT)-PCR of target gene expression. *Significant changes compared with control (P < 0.05) (n = 4 per group). Data are mean SD).
decreases cellular viability through the depletion of intracellular guanosine nucleotide, activation of the mitogen-activated protein kinase (MAPK) pathway and induction of an anergy state of immune function.14–17 MPA-induced proliferation of DPCs might occur as a result of cell growth because of the activation of b-catenin and increased ERK activity. The ERK inhibitor PD98059 is known to regulate the proliferation of DPCs. Our results show that MPA has a reversal effect on the PD98059-induced decrease in the phosphorylation of ERK. Based on this result, we suggest that MPA may stimulate the proliferation of DPCs via the Wnt/ERK pathway.18,19 Other members of the MAPK family, including Jun kinase (JNK) and p38,
900
Clinical and Experimental Dermatology (2015) 40, pp894–902
have been reported to play important roles in cell proliferation and death, and activation of p38 and JNK was shown to be involved in cell death and stress.20 In our study, ERK was increased by MPA, but phosphorylation of p38 and JNK was not observed (data not shown), a finding that is consistent with previous results.14,21 Furthermore, the effect of the ERK inhibitor on the DPCs was normalized by MPA treatment. This result suggests that ERK is involved in the MPAinduced proliferation of DPCs. In this study, we attempted to evaluate the hair growth-stimulating effect of topically applied MPA + MN. In mice, MPA increased the formation of anagen hair follicles to the same extent as 5% MXD.
ª 2015 British Association of Dermatologists
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
MPA + MN treatment accelerated hair-follicle induction and increased the expression of genes involved in the anagen stage (14–21 days). These results raise the possibility of using MPA as a treatment option for various types of hair-loss disorders. We believe the effects of MPA in promoting hair growth are caused by activation of intracellular signals and the maintenance of apoptosis inhibition rather than by direct stimulation of the Wnt/b-catenin signalling pathway.
Conclusion Our results indicate that the topical application of MPA is a potential treatment option for patients with chronic or recurrent alopecia who are unwilling to undergo systemic treatment or whose disease is refractory to other treatment options.
Acknowledgements This study was supported by a grant of the Korean Health Technology R&D Project, Ministry for Health & Welfare, Republic of Korea (HI09C1555).
What’s already known about this topic? Studies on the effectiveness of systemic MMF in
the treatment of T cell-infiltrating hair-loss disorders have shown conflicting results.
What does this study add? MPA has a promoting effect on proliferation of
DPCs and induction of anagen hair follicles. The cellular proliferative effect of MPA is exert-
edthrough the activation Axin2 and ERK, and its effect is maintained by the Bcl2/Bax ratio balance. The effect on hair growth of topical MPA combined with MN is comparable with that of MXD.
References 1 Bullingham RE, Nicholls AJ, Kamm BR. Clinical pharmacokinetics of mycophenolate mofetil. Clin Pharmacokinet 1998; 34: 429–55.
ª 2015 British Association of Dermatologists
2 Allison AC, Eugui EM. Mycophenolate mofetil and its mechanisms of action. Immunopharmacology 2000; 47: 85–118. 3 Mydlarski PR. Mycophenolate mofetil: a dermatologic perspective. Skin Therapy Lett 2005; 10: 1–6. 4 Gomez EC, Menendez L, Frost P. Efficacy of mycophenolic acid for the treatment of psoriasis. J Am Acad Dermatol 1979; 1: 531–7. 5 Cho BK, Sah D, Chwalek J et al. Efficacy and safety of mycophenolate mofetil for lichen planopilaris. J Am Acad Dermatol 2010; 62: 393–7. 6 Kose O, Safali M, Bulent Tastan H et al. Mycophenolate mofetil in extensive Alopecia areata: no effect in seven patients. Dermatology 2004; 209: 69–70. 7 Tursen U, Api H, Kaya T et al. Treatment of lichen planopilaris with mycophenolate mofetil. Dermatol Online J 2004; 10: 24. 8 Samrao A, Chew AL, Price V. Frontal fibrosing alopecia: a clinical review of 36 patients. Br J Dermatol 2010; 163: 1296–300. 9 Messenger AG, Senior HJ, Bleehen SS. The in vitro properties of dermal papilla cell lines established from human hair follicles. Br J Dermatol 1986; 114: 425–30. 10 Leiros GJ, Attorresi AI, Balana ME. Hair follicle stem cell differentiation is inhibited through cross-talk between Wnt/beta-catenin and androgen signalling in dermal papilla cells from patients with androgenetic alopecia. Br J Dermatol 2012; 166: 1035–42. 11 Qiu Y, Fairbanks LD, Ruckermann K et al. Mycophenolic acid-induced GTP depletion also affects ATP and pyrimidine synthesis in mitogen-stimulated primary human T-lymphocytes. Transplantation 2000; 69: 890–7. 12 Sankatsing SU, Prins JM, Yong SL et al. Mycophenolate mofetil inhibits T-cell proliferation in kidney transplant recipients without lowering intracellular dGTP and GTP. Transpl Int 2008; 21: 1066–71. 13 Adams JM, Cory S. Bcl-2-regulated apoptosis: mechanism and therapeutic potential. Curr Opin Immunol 2007; 19: 488–96. 14 Kim JY, Yoon SY, Park J et al. Mycophenolic acid induces islet apoptosis by regulating mitogen-activated protein kinase activation. Transplant Proc 2006; 38: 3277–9. 15 He X, Smeets RL, Koenen HJ et al. Mycophenolic acidmediated suppression of human CD4+ T cells: more than mere guanine nucleotide deprivation. Am J Transplant 2011; 11: 439–49. 16 Ha H, Kim MS, Park J et al. Mycophenolic acid inhibits mesangial cell activation through p38 MAPK inhibition. Life sci 2006; 79: 1561–7. 17 Zacharias LC, Damico FM, Kenney MC et al. In vitro evidence for mycophenolic acid dose-related cytotoxicity in human retinal cells. Retina 2013; 33: 2155–61. 18 Li W, Man XY, Li CM et al. VEGF induces proliferation of human hair follicle dermal papilla cells through
Clinical and Experimental Dermatology (2015) 40, pp894–902
901
Effect of mycophenolic acid on dermal papilla cells K. H. Jeong et al.
VEGFR-2-mediated activation of ERK. Exp Cell Res 2012; 318: 1633–40. 19 Yun MS, Kim SE, Jeon SH, Lee JS, Choi KY. Both ERK and Wnt/beta-catenin pathways are involved Wnt3ainduced proliferation. J Cell Sci 2005; 118: 313–22. 20 Paraskevas S, Aikin R, Maysinger D et al. Activation and expression of ERK, JNK, and p38 MAP-kinases in isolated
902
Clinical and Experimental Dermatology (2015) 40, pp894–902
islets of Langerhans: implications for cultured islet survival. FEBS Lett 1999; 455: 203–8. 21 Shui H, Gao P, Si X et al. Mycophenolic acid inhibits albumin-induced MCP-1 expression in renal tubular epithelial cells through the p38 MAPK pathway. Mol Biol Rep 2010; 37: 1749–54.
ª 2015 British Association of Dermatologists
