bs_bs_banner
Animal Science Journal (2015) 86, 849–854
doi: 10.1111/asj.12368
ORIGINAL ARTICLE Effect of monensin withdrawal on rumen fermentation, methanogenesis and microbial populations in cattle Arfan ABRAR,1 Takamitsu TSUKAHARA,2 Makoto KONDO,1 Tomomi BAN-TOKUDA,1 Wang CHAO1* and Hiroki MATSUI1 1
Graduate School of Bioresources, Mie University, Tsu and 2Kyoto Institute of Nutrition and Pathology, Ujitawara, Kyoto, Japan
ABSTRACT This study was designed to obtain information on the residual influence of dietary monensin on ruminant fermentation, methanogenesis and bacterial population. Three ruminally cannulated crossbreed heifers (14 months old, 363 ± 11 kg) were fed Italian ryegrass straw and concentrate supplemented with monensin for 21 days before sampling. Rumen fluid samples were collected for analysis of short chain fatty acid (SCFA) profiles, monensin concentration, methanogens and rumen bacterial density. Post-feeding rumen fluid was also collected to determine in vitro gas production. Monensin was eliminated from the rumen fluid within 3 days. The composition of SCFA varied after elimination of monensin, while total production of SCFA was 1.78 times higher than on the first day. Methane production increased 7 days after monensin administration ceased, whereas hydrogen production decreased. The methanogens and rumen bacterial copy numbers were unaffected by the withdrawal of monensin.
Key words: methanogenesis, methanogens, monensin, ruminal fermentation.
INTRODUCTION A recent environmental concern in animal production systems is methane emission, especially from ruminants. Methane is the main cause of global warming and domesticated ruminants are one of the major contributors of methane production. Methane emission from domesticated ruminants was estimated to contribute 15% of the total global methane emission (Takahashi et al. 2005). There are many studies into reduction in methane emissions from ruminants. Kobayashi (2010) reported various methods to reduce methane emission, including hydrogen sink, halogenated compounds and methane-inhibiting chemicals, vaccines, bacteriocins, fats and fatty acids, and the use of plant extracts and ionophore antibiotics such as monensin. Monensin is a feed additive which alters rumen fermentation and the microbial ecosystem in ruminants. Supplementation with monensin increased propionate and decreased acetate production by 35% in a continuous culture (Kone et al. 1989). Monensin supplementation resulted in a higher average daily weight gain and lower feed costs for feedlot cattle (Cooprider et al. 2011). Monensin is also reported to alter other ruminant parameters such as pH, total short chain fatty acid (SCFA) concentration and the © 2015 Japanese Society of Animal Science
acetate : propionate ratio (Aderinboye et al. 2012). Therefore, supplementation with monensin in ruminants can enhance feed efficiency and weight gain, increase milk production and decrease milk fat. Many studies have investigated the biological effects of monensin in the rumen (Schelling 1984). Monensin selectively inhibits Gram-positive bacteria and protozoa which are the main hydrogen producers in the rumen, leading to a rumen microbiota that produces more propionate and less acetate, butyrate, formate and hydrogen (Hook et al. 2009; Kobayashi 2010). These effects resulted in reduced methane production in the rumen. Many studies on the use of ionophores for methane abatement have been reported (Kobayashi et al. 1988; McGinn et al. 2004; Guan et al. 2006; Grainger et al. 2010). Although there was variation in the results of Correspondence: Hiroki Matsui, Graduate School of Bioresources, Mie University, 1577 Kurimamachiya-cho, Tsu, Mie 514-8507, Japan. (Email: [email protected]) *Present address: Institute of Animal Nutrition and Feed Research, Inner Mongolia Academy of Agricultural & Animal Husbandry Sciences, Hohhot, 010031, Inner Mongolia, China. Received 2 July 2014; accepted for publication 20 October 2014.
850 A. ABRAR et al.
the studies, the tendency toward methane reduction was ubiquitous. Interestingly, long-term monensin supplementation did not affect the methanogen population size (Hook et al. 2009). This is because reduced methane emission was not due to a decreased population size of methanogens but was related to the alternative hydrogen-consuming pathway which occurred to allow proliferation of propionate- and succinateproducing bacteria which later enhanced propionate production in the rumen (Kobayashi 2010). Regardless of potential effect of monensin as a methane abatement agent on ruminants, concern on residual effect of monensin should also be put into consideration on animal production. Monensin resistance and its potential impact was comprehensively discussed by Russell and Houlihan (2003); however, studies on post-supplementation effects of monensin to rumen fermentation are very few; therefore, this study aimed to obtain information on the residual influence of monensin on ruminal fermentation parameters, such as SCFA, methanogenesis and microbial population, including methanogens and two major phyla which are normally present in the rumen.
MATERIALS AND METHODS Animals, feeding and sampling Animal handling was performed according to the Mie University guidelines. Three-14-month old ruminally cannulated crossbreed heifers (Holstein × Japanese Black cattle) with average body weight of 363.3 ± 11.0 kg were used. These animals were offered Italian ryegrass straw and commercial concentrate (Soyokaze no Kaori; Nippon Formula Feed Manufacturing, Yokohama, Japan) supplemented with monensin (30 ppm) for 21 days. The amounts of straw and concentrate were 1.6 kg fresh matter/day and 6.4 kg/day, respectively. The concentrate consisted of 44% cereal mix, 27% wheat bran and rice bran, 19% plant oil meal and 10% pellet mineral mix. The concentrate contained 18.0% crude protein, 4.0% crude fat, 7.1% crude fiber, 6.7% crude ash, 0.60% calcium and 0.80% phosphor (dry matter (DM) basis). The total digestible nutrient was 82.9% of DM and no other antimicrobial agents were present in the concentrate. The diet was divided equally and offered twice a day at 10.00 and 17.00 hours. Water and mineral blocks were available ad libitum. During sampling the animals were offered the same diet but without monensin in the concentrate. Rumen fluid samples were collected via cannula just prior to morning feeding for measurement of monensin concentration, microbial density and SCFA profiles. Samples were collected on days 0, 1, 3, 5, 7, 10, 14 and 21 after withdrawal of monensin supplementation. The rumen fluid was stored at −25°C until analysis. Rumen fluid samples for in vitro incubation were collected at 3 h after morning feeding on days 0, 7, 14 and 21. The rumen fluid samples were transferred to the laboratory immediately and incubated in vitro at 39°C.
In vitro incubation In vitro rumen fermentation was performed as described in Watanabe et al. (2010) with some modifications. Rumen © 2015 Japanese Society of Animal Science
fluid was diluted in McDougall’s buffer (McDougall 1948) which had been pre-warmed to 39°C and pre-gassed with nitrogen. Rumen fluid was strained through four layers of surgical gauze under nitrogen and the strained rumen fluid was diluted with buffer at a 1:1 ratio. Diluted rumen fluid (10 mL) was then dispensed into Hungate tubes and flushed with nitrogen without addition of substrate. The tubes were sealed with a butyl-rubber septum and a screw cap. The rumen fluid samples were incubated for 4 h at 39°C with vigorous shaking at 180 rpm. The pressure of headspace gas was then measured via a needle-attached pressure gauge (Aϕ60B; GL Science, Tokyo, Japan). Composition of the headspace gas was analyzed using gas chromatography (Shimadzu GC-8A, Kyoto, Japan) as described in Matsui et al. (2013).
Monensin concentration Monensin concentration was determined with liquid chromatography - tandem mass spectrometry (UPLC-MS/MS). Rumen fluid samples (500 μL) were mixed with 250 μL acetonitrile and vortexed for 30 seconds. After centrifugation for 3 min at 6000 × g and 4°C the resulting supernatants were mixed with 250 μL acetonitrile and vortexed and centrifuged as previously described. The supernatants were applied to an Oasis HLB cartridge, dried and finally dissolved in 250 μL acetonitrile prior to analysis by UPLC-MS/MS. The chromatographic system used in this study was an Acquity UPLC® system equipped with a triple quadrupole detector (Waters, Milford, PA, USA). Separation was performed using an Acquity UPLC BEH C-18 1.7 μm (50 mm × 2.1 mm, Waters) column at 50°C. The run was performed with a gradient of two different mobile phases: mobile phase A (0.1% formic acid) and mobile phase B (acetonitrile with 0.1% formic acid), at a flow rate of 0.6 mL/ min. The gradient started at 95% A and 5% B and after 0.3 min the gradient increased linearly to 5% A and 95% B up to 1.3 min and this was maintained for 4 min. After 4 min, the gradient was returned to 95% A and 5% B, and the system was equilibrated for 1.1 min. Mass spectrometry detection was conducted using an injection volume of 5 μL and a Xevo-TQ triple quadrupole tandem mass spectrometer (Waters) with an electrospray ionization (ESI) interface. The ESI source was operated in positive mode at 1.0 kV. The desolvation temperature was 600°C and the ion source temperature was 150°C. Nitrogen gas was used for desolvation at a flow rate of 1200 L/h. For collision-induced dissociation, nitrogen was used as the collision gas at a flow rate of 50 L/h. A single ion mode (SIM) was used for quantification at m/z 693.9. The control of the system and data acquisition was done using Mass Lynx version 4.1 software (Waters).
Short-chain fatty acid analysis SCFA concentration was determined using high-performance liquid chromatography (HPLC) as described by Uddin et al. (2010).
DNA extraction from the rumen fluid Microbial DNA in the rumen fluid was extracted using a QIAamp DNA Stool kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The DNA concentration of all samples was adjusted to the same concentration (10 ng/μL) with an A260/280 ratio higher than 1.8. The DNA solution was stored at −25°C until analysis. Animal Science Journal (2015) 86, 849–854
DIETARY MONENSIN EFFECT IN THE RUMEN
Real-time PCR Real-time PCR was performed on a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The α-subunit of the methyl coenzyme-M reductase gene (mcrA) was used for quantification of methanogens. The mcrA copy number was measured as described by Lwin et al. (2012). Primers (qmcrA-f and -r) were used in the reaction mixture at the concentrations shown in Table 1. Standard DNA was prepared from a clone originally obtained from a rumen sample as described by Lwin et al. (2012). The reaction mixture (20 μL) for detection of methanogens comprised 10 μL of SYBR green PCR Master Mix (Applied Biosystems), sterile Milli-Q water, forward and reverse primers and 1 μL of template DNA. The assay was carried out under the following cycle conditions: one cycle of 95°C for 10 min, 40 cycles at 95°C for 15 s, and 60°C for 1 min. Amplicon specificity was determined via dissociation curve analysis of the PCR end products by increasing the temperature at a rate of 1°C/30 sec from 60 to 95°C. The DNA copy number of 16S ribosomal RNA gene (rDNA) of Bacteroidetes and Firmicutes was quantified according to the method of Guo et al. (2008). The primer sequences and concentrations used for quantification of Firmicutes and Bacteriodetes are shown in Table 1. Gene fragments encoding 16S rDNA from Eubacterium limosum and Bacteroides thetaeotaomicron were used as DNA standards for Firmicutes and Bacteroidetes, respectively. Almost the full length of the gene was cloned into pCR 2.1 (Invitrogen, Carlsbad, CA, USA). PCR products from cloned DNA were purified using a QIAquick PCR purification kit (Qiagen, Hilden, Germany) according to manufacturer’s protocol. Purified PCR products were quantified using a spectrophotometer (NanoVue; GE Healthcare UK Ltd, Buckinghamshire, UK) at 260 nm for use as standards. The reaction mixture (20 μL) for Firmicutes
Table 1
851
comprised of 10 μL of SYBR green Master Mix, 5.2 μL of sterile Milli-Q water, forward and reverse primers, and 1 μL of template DNA. The reaction mixture (20 μL) for Bacteroidetes was comprised of 10 μL SYBR green Master Mix, 7.6 μL sterile Milli-Q water, 0.2 μL forward primer, 1.2 μL reverse primer and 1 μL DNA template. The thermal cycle conditions for detection of both Firmicutes and Bacteroidetes was one cycle of 95°C for 10 min and 40 cycles each of 95°C for 15 sec and 60°C for 1 min. Amplicon specificity was determined via dissociation curve analysis of PCR end products by increasing the temperature at a rate of 1°C/30 sec from 60°C to 95°C.
Statistical analysis All parameters in the study were analyzed using repeated measurement of general linear model by SPSS 13 for Windows (SPSS Inc., Chicago, IL, USA). The significance was set at P < 0.05 and Tukey’s pairwise comparisons were performed as a post hoc test.
RESULTS AND DISCUSSION Monensin concentration and short chain fatty acids profiles in the rumen Monensin concentration, total SCFA, SCFA composition and acetate : propionate ratios in the rumen during the sampling period are shown in Table 2. A rapid clearance of monensin from the rumen was observed once supplementation was withdrawn. The concentration of monensin decreased significantly (P < 0.05) by 60% within 1 day of withdrawal of monensin (day 0). Despite the low detection limits of
PCR primers used in the study
Target
Name
Sequence (5′→3′)
Product size (bp)
Concentration (μmol/L)
Reference
Methanogen
q-mcrA-f q-mcrA-r Firm 934-f Firm 1060-r Bact 934-f Bact 1060-r
TTCGGTGGATCDCARAGRGC GBARGTCGWAWCCGTAGAATCC GGAGYATGTGGTTTAATTCGAAGCA AGCTGACGACAACCATGCAC GGARCATGTGGTTTAATTCGATGAT AGCTGACGACAACCATGCAG
141
0.3 0.3 0.05 0.9 0.05 0.3
Denman et al. (2007)
Firmicutes Bacteroidetes
126 126
Guo et al. (2008) Guo et al. (2008)
Table 2 Monensin concentration (μmol/L), total SCFA (mmol/L), proportion of SCFA (%) and acetate : propionate (A:P) ratio in the rumen of cows following cessation of monensin administration
Sampling Time
Monensin (μmol/L)
Day 0 Day 1 Day 3 Day 5 Day 7 Day 10 Day 14 Day 21 Significance
0.40 ± 0.08 0.16 ± 0.16b nd nd nd nd nd nd *
Total SCFA (mmol/L)
Proportion of SCFA (%) Acetate
a
38.20 ± 4.78 68.34 ± 13.20 52.70 ± 23.28 67.59 ± 15.57 73.51 ± 12.16 63.46 ± 29.25 66.73 ± 28.52 84.88 ± 16.97 ns
Propionate
71.67 ± 3.30 67.35 ± 2.84b 68.30 ± 3.74ab 68.12 ± 3.41b 68.21 ± 2.63b 71.05 ± 3.96a 67.65 ± 1.13b 66.94 ± 3.08c * a
A:P ratio
n-Butyrate
15.50 ± 2.91 21.30 ± 2.21a 17.06 ± 2.72bc 18.11 ± 2.70bc 17.22 ± 2.37bc 16.71 ± 1.47bc 20.78 ± 0.53a 19.94 ± 1.70ab * c
12.83 ± 3.26 11.36 ± 0.96 14.64 ± 3.01 13.77 ± 0.71 14.57 ± 0.35 12.24 ± 2.66 11.57 ± 1.14 13.12 ± 1.73 ns
4.73 ± 0.91a 3.19 ± 0.45d 4.08 ± 0.75b 3.84 ± 0.77c 4.02 ± 0.68b 4.29 ± 0.58ab 3.26 ± 0.10cd 3.38 ± 0.45cd *
*P < 0.05. Values are means ± standard deviations (n = 3). Values in same column with different superscripts are significantly different (P < 0.05). SCFA, short chain fatty acid; nd, not detected; ns, not significant.
Animal Science Journal (2015) 86, 849–854
© 2015 Japanese Society of Animal Science
852 A. ABRAR et al.
the analytical instruments used, the concentration of monensin reached an undetectable level during the remaining sampling times. These results were consistent with the previous findings of Rogers et al. (1997) who reported that monensin disappeared from the rumen within 24 h. Although the levels of total SCFA did not differ statistically during the sampling period, the concentration tended to increase during the experimental period. The concentration at day 1 was 1.8 times higher than at day 0. A high concentration of total SCFA was maintained until the end of the experiment. Wallace et al. (1980) similarly reported an experiment using artificial rumen fluid where total SCFA production was higher in the absence of monensin with hay and concentrated substrate. Rogers et al. (1997) also reported that suppression of rumen volatile fatty acid concentration by monensin was recovered within 24 h of monensin withdrawal. There was no significant difference in the proportions of butyrate during sampling (Table 2). However, the proportions of acetate and propionate changed significantly (P < 0.05) compared to day 0. Acetate proportions decreased during sampling while propionate proportions increased. One proposed mode of action of monensin is that it increases propionate production in the rumen by stimulating propionateproducing bacteria (Schelling 1984). Increase in proportion of propionate in the present study was observed despite monensin withdrawal. Propionate proportion was increased significantly only on day 1 and day 14 over day 0. Rumen ecosystem stability on present experimental animals was disrupted due to supplementation and cessation of monensin, and recovery of rumen environment seems unlikely to be precisely as the initial condition, therefore such an unexpected phenomenon occurred. Moreover, variation on propionate proportion was bearable since comparison on day 0 to average propionate values from day 1 to day 21 showed only slight increase (data not shown). Nevertheless, the present study does not have sufficient data to explain clearly such phenomenon and needs further experiments to show information on rumen condition due to withdrawal of monensin. Furthermore, the increased production of propionate in subsequent sampling resulted in a decline in the acetate : propionate ratio (Table 2).
Profile of gas production and rumen bacteria population Methane and hydrogen production were indirectly assessed using an in vitro rumen fermentation technique as described by Watanabe et al. (2010). The profiles shown in Table 3 indicate that methane production increased significantly (P < 0.05) after monensin administration ceased. Methane production © 2015 Japanese Society of Animal Science
Table 3 Profile of incubation gas production (mL) following cessation of monensin administration
Sampling time
Methane (mL)
Hydrogen (mL)
Day 0 Day 7 Day 14 Day 21 Significance
0.17 ± 0.16 0.75 ± 0.45c 0.41 ± 0.17b 0.45 ± 0.16b *
0.0148 ± 0.0132 0.0053 ± 0.0028 0.0046 ± 0.0011 0.0048 ± 0.0010 ns
a
*P < 0.05. Values are means ± standard deviations (n = 3). Values in same column with different superscripts are significantly different (P < 0.05). ns, not significant.
Figure 1 Changes in the population of methanogens, Firmicutes and Bacteroidetes in the rumen following withdrawal of monensin supplementation. (●) Methanogens, (■) Firmicutes, (▲) Bacteriodetes, each line with vertical bars represents standard deviations. Different superscripts above vertical bars denote significant differences (P < 0.05).
increased while hydrogen production rapidly decreased at day 7 after withdrawal of monensin. These results are consistent with the observation that hydrogen is the major precursor of methane production in the rumen (Hungate 1967). According to Castro-Montoya et al. (2012), monensin acts in vitro by modifying the fermentation pattern regarding its substrate rather than directly affecting methane formation. In this study, methane production was estimated from in vitro rumen fermentation without additional substrate, which means that methane production originated from feed ingested by the animal. This indicates that the increasing methane production on days 7, 14 and 21 was most likely due to the absence of monensin in the rumen. Changes in the microbial population in the rumen were estimated by real-time PCR (Fig. 1). Because monensin inhibits Gram-positive bacteria and enhances Gram-negative bacteria, these bacterial groups were estimated at the phylum level of Firmicutes and Bacteroidetes, respectively. Microbial density of methanogens and Bacteroidetes after withdrawal of monensin administration differed (P < 0.05) Animal Science Journal (2015) 86, 849–854
DIETARY MONENSIN EFFECT IN THE RUMEN 853
during the sampling days. The population density of methanogens on day 1 increased but the density then decreased to the same level as on day 0. Similarly, the Bacteroidetes population density also increased on day 1 but then decreased until day 7 before increasing again on day 14. Although the trend for the Firmcutes population density was similar to that of methanogens, the change was moderate. Terminal restriction fragment length polymorphism (T-RFLP) analysis also showed that there was no major change in bacterial composition (data not shown). The significant differences in production of methane and hydrogen, propionate ratio, and A:P ratio after day 1 (Tables 2 and 3) would be expected to lead to changes in the bacterial composition. T-RFLP analysis can only detect major changes in bacterial populations and therefore it is likely that only minor changes in bacterial groups were present in this study. Thus monensin administration causes dysfunction rather than elimination of methanogens. These data confirm the results of Weimar et al. (2008) who reported that the population of methanogens and Gram-positive bacteria in the rumen of lactating cows was not significantly changed during supplementation and withdrawal of monensin. They suggested that the mode of action of monensin could not be fully explained by suppression of Grampositive bacteria in the rumen. Similarly, studies on long-term monensin administration showed that the duration of supplementation did not affect the number of methanogens present in the rumen of lactating cows (Hook et al. 2009). Our results are supported by these reports and thus we propose that monensin acts on the metabolic activities of related microbes rather than on microbial populations. Many Gram-positive ruminant bacteria are more sensitive to ionophores than Gram-negative bacteria. However, some Gram-negatives are initially ionophore-sensitive, and even Gram-positive bacteria can be resistant (Russell & Houlihan 2003). The mode of action of monensin on the suppression of methane production may be complex as suggested by Weimar et al. (2008). Further studies on the effect of monensin on metabolic activities of monensin-sensitive microbes are required. Furthermore, the effect of monensin on ruminant fermentation and microbial activities in different phases after supplementation should be investigated to clarify the mode of action of monensin.
ACKNOWLEDGMENTS A part of this study was financially supported by Grants-in-Aid for Scientific Research, Japan Society for the Promotion of Science (25450393). Real-time PCR was carried out at The Life Science Research Center (Center for Molecular Biology and Genetics), Mie University (Tsu, Japan). The authors are grateful to Ms. Noriko Matsukawa at Kyoto Institute of NutriAnimal Science Journal (2015) 86, 849–854
tion and Pathology for technical assistance with monensin detection by LC-MS/MS.
REFERENCES Aderinboye RY, Onwuka CFI, Arigbede OM, Oduguwa OO, Aina ABJ. 2012. Effect of dietary monensin inclusion on performance, nutrient utilisation, rumen volatile fatty acid concentration and blood status of West African dwarf bucks fed with basal diets of forages. Tropical Animal Health and Production 44, 1079–1087. Castro-Montoya JM, De Campeneere S, Van Ranst G, Fievez V. 2012. Interaction between methane mitigation additives and basal substrates on in vitro methane and VFA production. Animal Feed Science and Technology 176, 47–60. Cooprider EKL, Mitloehner FM, Famula TR, Kebreab E, Zhao Y, Van AL. 2011. Feedlot efficiency implications on greenhouse gas emissions and sustainability. Journal of Animal Science 89, 2643–2656. Denman SE, Tomkins NW, McSweeney CS. 2007. Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane. FEMS Microbiology Ecology 62, 313–322. Grainger C, Williams R, Eckard RJ, Hannah MC. 2010. A high dose of monensin does not reduce methane emissions of dairy cows offered pasture supplemented with grain. Journal of Dairy Science 93, 5300–5308. Guan H, Wittenberg KM, Ominski KH, Krause DO. 2006. Efficacy of ionophores in cattle diets for mitigation of enteric methane. Journal of Animal Science 84, 1896–1906. Guo X, Xia X, Tang R, Zhou J, Zhao H, Wang K. 2008. Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs. Letters in Applied Microbiology 47, 367–373. Hook SE, Northwood KS, Wright ADG, McBride BW. 2009. Long-term monensin supplementation does not significantly affect the quantity or diversity of methanogens in the rumen of the lactating dairy cow. Applied and Environmental Microbiology 75, 374–380. Hungate RE. 1967. Hydrogen as an intermediate in the rumen fermentation. ArchivfürMikrobiologie 59, 158–164. Kobayashi Y. 2010. Abatement of methane production from ruminants:Trends in the manipulation of rumen fermentation. Asian-Australasian Journal of Animal Science 23, 410– 416. Kobayashi Y, Wakita M, Hoshino S. 1988. Persistency of salinomycin effect on ruminal fermentation in wethers. Nutrition Reports International 38, 987–999. Kone P, Machado F, Cook RM. 1989. Effect of the combination of monensin and isoacids on rumen fermentation in vitro. Journal of Dairy Science 72, 2767–2771. Lwin KO, Kondo M, Ban-Tokuda T, Lapitan RM, Del Barrio AN, Fujihara T, Matsui H. 2012. Ruminal fermentation and microbial ecology of buffaloes and cattle fed the same diet. Animal Science Journal 83, 767–776. Matsui H, Wakabayashi H, Fukushima N, Ito K, Nishikawa A, Yoshimi R, et al. 2013. Effect of raw rice bran supplementation on rumen methanogen population density and in vitro rumen fermentation. Grassland Science 59, 129–134. McDougall EI. 1948. Studies on ruminant saliva. 1. The composition and output of sheep’s saliva. Biochemical Journal 43, 99–109. © 2015 Japanese Society of Animal Science
854 A. ABRAR et al.
McGinn SM, Beauchemin KA, Coates T, Colombatto D. 2004. Methane emissions from beef cattle: effects of monensin, sunflower oil, enzymes, yeast, and fumaric acid. Journal of Animal Science 82, 3346–3356. Rogers M, Jouany JP, Thivend P. 1997. The effect of short term and long termmonensin supplementation and its subsequent withdrawal on digestion in sheep. Animal Feed Science and Technology 65, 113–127. Russell JB, Houlihan AJ. 2003. Ionophore resistance of ruminal bacteria and its potential impact on human health. FEMS Microbiology Reviews 27, 65–74. Schelling GT. 1984. Monensin mode of action in the rumen. Journal of Animal Science 58, 1518–1527. Takahashi J, Mwenya B, Santoso B, Sar C, Umetsu K, Kishimoto T, et al. 2005. Mitigation of methane emission and energy recycling in animal agricultural systems. Asian-Australasian Journal of Animal Science 18, 1199–1208. Uddin MK, Kondo M, Kita J, Matsui H, Karita S, Goto M. 2010. Effect of supplementation of soy sauce cake and
© 2015 Japanese Society of Animal Science
vinegar brewer’s cake with total mixed ration silage-based diet on nutrient utilization by Holstein steers. Journal of Food, Agriculture & Environment 8, 282–287. Wallace RJ, Cheng KJ, Czerkawski JW. 1980. Effects of monensin on fermentation characteristics of the artificial rumen. Applied and Environmental Microbiology 40, 672– 674. Watanabe Y, Suzuki R, Koike S, Nagashima K, Mochizuki M, Forster RJ, Kobayashi Y. 2010. In vitro evaluation of cashew nut shell liquid as a methane-inhibiting and propionate-enhancing agent for ruminants. Journal of Dairy Science 93, 5258–5267. Weimar PJ, Stevenson DM, Mertens DR, Thomas EE. 2008. Effect of monensin feeding and withdrawal on populations of individual bacterial species in the rumen of lactating dairy cows fed high-starch rations. Applied Microbiology and Biotechnology 80, 135–145.
Animal Science Journal (2015) 86, 849–854
Animal Science Journal (2015) 86, 849–854
doi: 10.1111/asj.12368
ORIGINAL ARTICLE Effect of monensin withdrawal on rumen fermentation, methanogenesis and microbial populations in cattle Arfan ABRAR,1 Takamitsu TSUKAHARA,2 Makoto KONDO,1 Tomomi BAN-TOKUDA,1 Wang CHAO1* and Hiroki MATSUI1 1
Graduate School of Bioresources, Mie University, Tsu and 2Kyoto Institute of Nutrition and Pathology, Ujitawara, Kyoto, Japan
ABSTRACT This study was designed to obtain information on the residual influence of dietary monensin on ruminant fermentation, methanogenesis and bacterial population. Three ruminally cannulated crossbreed heifers (14 months old, 363 ± 11 kg) were fed Italian ryegrass straw and concentrate supplemented with monensin for 21 days before sampling. Rumen fluid samples were collected for analysis of short chain fatty acid (SCFA) profiles, monensin concentration, methanogens and rumen bacterial density. Post-feeding rumen fluid was also collected to determine in vitro gas production. Monensin was eliminated from the rumen fluid within 3 days. The composition of SCFA varied after elimination of monensin, while total production of SCFA was 1.78 times higher than on the first day. Methane production increased 7 days after monensin administration ceased, whereas hydrogen production decreased. The methanogens and rumen bacterial copy numbers were unaffected by the withdrawal of monensin.
Key words: methanogenesis, methanogens, monensin, ruminal fermentation.
INTRODUCTION A recent environmental concern in animal production systems is methane emission, especially from ruminants. Methane is the main cause of global warming and domesticated ruminants are one of the major contributors of methane production. Methane emission from domesticated ruminants was estimated to contribute 15% of the total global methane emission (Takahashi et al. 2005). There are many studies into reduction in methane emissions from ruminants. Kobayashi (2010) reported various methods to reduce methane emission, including hydrogen sink, halogenated compounds and methane-inhibiting chemicals, vaccines, bacteriocins, fats and fatty acids, and the use of plant extracts and ionophore antibiotics such as monensin. Monensin is a feed additive which alters rumen fermentation and the microbial ecosystem in ruminants. Supplementation with monensin increased propionate and decreased acetate production by 35% in a continuous culture (Kone et al. 1989). Monensin supplementation resulted in a higher average daily weight gain and lower feed costs for feedlot cattle (Cooprider et al. 2011). Monensin is also reported to alter other ruminant parameters such as pH, total short chain fatty acid (SCFA) concentration and the © 2015 Japanese Society of Animal Science
acetate : propionate ratio (Aderinboye et al. 2012). Therefore, supplementation with monensin in ruminants can enhance feed efficiency and weight gain, increase milk production and decrease milk fat. Many studies have investigated the biological effects of monensin in the rumen (Schelling 1984). Monensin selectively inhibits Gram-positive bacteria and protozoa which are the main hydrogen producers in the rumen, leading to a rumen microbiota that produces more propionate and less acetate, butyrate, formate and hydrogen (Hook et al. 2009; Kobayashi 2010). These effects resulted in reduced methane production in the rumen. Many studies on the use of ionophores for methane abatement have been reported (Kobayashi et al. 1988; McGinn et al. 2004; Guan et al. 2006; Grainger et al. 2010). Although there was variation in the results of Correspondence: Hiroki Matsui, Graduate School of Bioresources, Mie University, 1577 Kurimamachiya-cho, Tsu, Mie 514-8507, Japan. (Email: [email protected]) *Present address: Institute of Animal Nutrition and Feed Research, Inner Mongolia Academy of Agricultural & Animal Husbandry Sciences, Hohhot, 010031, Inner Mongolia, China. Received 2 July 2014; accepted for publication 20 October 2014.
850 A. ABRAR et al.
the studies, the tendency toward methane reduction was ubiquitous. Interestingly, long-term monensin supplementation did not affect the methanogen population size (Hook et al. 2009). This is because reduced methane emission was not due to a decreased population size of methanogens but was related to the alternative hydrogen-consuming pathway which occurred to allow proliferation of propionate- and succinateproducing bacteria which later enhanced propionate production in the rumen (Kobayashi 2010). Regardless of potential effect of monensin as a methane abatement agent on ruminants, concern on residual effect of monensin should also be put into consideration on animal production. Monensin resistance and its potential impact was comprehensively discussed by Russell and Houlihan (2003); however, studies on post-supplementation effects of monensin to rumen fermentation are very few; therefore, this study aimed to obtain information on the residual influence of monensin on ruminal fermentation parameters, such as SCFA, methanogenesis and microbial population, including methanogens and two major phyla which are normally present in the rumen.
MATERIALS AND METHODS Animals, feeding and sampling Animal handling was performed according to the Mie University guidelines. Three-14-month old ruminally cannulated crossbreed heifers (Holstein × Japanese Black cattle) with average body weight of 363.3 ± 11.0 kg were used. These animals were offered Italian ryegrass straw and commercial concentrate (Soyokaze no Kaori; Nippon Formula Feed Manufacturing, Yokohama, Japan) supplemented with monensin (30 ppm) for 21 days. The amounts of straw and concentrate were 1.6 kg fresh matter/day and 6.4 kg/day, respectively. The concentrate consisted of 44% cereal mix, 27% wheat bran and rice bran, 19% plant oil meal and 10% pellet mineral mix. The concentrate contained 18.0% crude protein, 4.0% crude fat, 7.1% crude fiber, 6.7% crude ash, 0.60% calcium and 0.80% phosphor (dry matter (DM) basis). The total digestible nutrient was 82.9% of DM and no other antimicrobial agents were present in the concentrate. The diet was divided equally and offered twice a day at 10.00 and 17.00 hours. Water and mineral blocks were available ad libitum. During sampling the animals were offered the same diet but without monensin in the concentrate. Rumen fluid samples were collected via cannula just prior to morning feeding for measurement of monensin concentration, microbial density and SCFA profiles. Samples were collected on days 0, 1, 3, 5, 7, 10, 14 and 21 after withdrawal of monensin supplementation. The rumen fluid was stored at −25°C until analysis. Rumen fluid samples for in vitro incubation were collected at 3 h after morning feeding on days 0, 7, 14 and 21. The rumen fluid samples were transferred to the laboratory immediately and incubated in vitro at 39°C.
In vitro incubation In vitro rumen fermentation was performed as described in Watanabe et al. (2010) with some modifications. Rumen © 2015 Japanese Society of Animal Science
fluid was diluted in McDougall’s buffer (McDougall 1948) which had been pre-warmed to 39°C and pre-gassed with nitrogen. Rumen fluid was strained through four layers of surgical gauze under nitrogen and the strained rumen fluid was diluted with buffer at a 1:1 ratio. Diluted rumen fluid (10 mL) was then dispensed into Hungate tubes and flushed with nitrogen without addition of substrate. The tubes were sealed with a butyl-rubber septum and a screw cap. The rumen fluid samples were incubated for 4 h at 39°C with vigorous shaking at 180 rpm. The pressure of headspace gas was then measured via a needle-attached pressure gauge (Aϕ60B; GL Science, Tokyo, Japan). Composition of the headspace gas was analyzed using gas chromatography (Shimadzu GC-8A, Kyoto, Japan) as described in Matsui et al. (2013).
Monensin concentration Monensin concentration was determined with liquid chromatography - tandem mass spectrometry (UPLC-MS/MS). Rumen fluid samples (500 μL) were mixed with 250 μL acetonitrile and vortexed for 30 seconds. After centrifugation for 3 min at 6000 × g and 4°C the resulting supernatants were mixed with 250 μL acetonitrile and vortexed and centrifuged as previously described. The supernatants were applied to an Oasis HLB cartridge, dried and finally dissolved in 250 μL acetonitrile prior to analysis by UPLC-MS/MS. The chromatographic system used in this study was an Acquity UPLC® system equipped with a triple quadrupole detector (Waters, Milford, PA, USA). Separation was performed using an Acquity UPLC BEH C-18 1.7 μm (50 mm × 2.1 mm, Waters) column at 50°C. The run was performed with a gradient of two different mobile phases: mobile phase A (0.1% formic acid) and mobile phase B (acetonitrile with 0.1% formic acid), at a flow rate of 0.6 mL/ min. The gradient started at 95% A and 5% B and after 0.3 min the gradient increased linearly to 5% A and 95% B up to 1.3 min and this was maintained for 4 min. After 4 min, the gradient was returned to 95% A and 5% B, and the system was equilibrated for 1.1 min. Mass spectrometry detection was conducted using an injection volume of 5 μL and a Xevo-TQ triple quadrupole tandem mass spectrometer (Waters) with an electrospray ionization (ESI) interface. The ESI source was operated in positive mode at 1.0 kV. The desolvation temperature was 600°C and the ion source temperature was 150°C. Nitrogen gas was used for desolvation at a flow rate of 1200 L/h. For collision-induced dissociation, nitrogen was used as the collision gas at a flow rate of 50 L/h. A single ion mode (SIM) was used for quantification at m/z 693.9. The control of the system and data acquisition was done using Mass Lynx version 4.1 software (Waters).
Short-chain fatty acid analysis SCFA concentration was determined using high-performance liquid chromatography (HPLC) as described by Uddin et al. (2010).
DNA extraction from the rumen fluid Microbial DNA in the rumen fluid was extracted using a QIAamp DNA Stool kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The DNA concentration of all samples was adjusted to the same concentration (10 ng/μL) with an A260/280 ratio higher than 1.8. The DNA solution was stored at −25°C until analysis. Animal Science Journal (2015) 86, 849–854
DIETARY MONENSIN EFFECT IN THE RUMEN
Real-time PCR Real-time PCR was performed on a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The α-subunit of the methyl coenzyme-M reductase gene (mcrA) was used for quantification of methanogens. The mcrA copy number was measured as described by Lwin et al. (2012). Primers (qmcrA-f and -r) were used in the reaction mixture at the concentrations shown in Table 1. Standard DNA was prepared from a clone originally obtained from a rumen sample as described by Lwin et al. (2012). The reaction mixture (20 μL) for detection of methanogens comprised 10 μL of SYBR green PCR Master Mix (Applied Biosystems), sterile Milli-Q water, forward and reverse primers and 1 μL of template DNA. The assay was carried out under the following cycle conditions: one cycle of 95°C for 10 min, 40 cycles at 95°C for 15 s, and 60°C for 1 min. Amplicon specificity was determined via dissociation curve analysis of the PCR end products by increasing the temperature at a rate of 1°C/30 sec from 60 to 95°C. The DNA copy number of 16S ribosomal RNA gene (rDNA) of Bacteroidetes and Firmicutes was quantified according to the method of Guo et al. (2008). The primer sequences and concentrations used for quantification of Firmicutes and Bacteriodetes are shown in Table 1. Gene fragments encoding 16S rDNA from Eubacterium limosum and Bacteroides thetaeotaomicron were used as DNA standards for Firmicutes and Bacteroidetes, respectively. Almost the full length of the gene was cloned into pCR 2.1 (Invitrogen, Carlsbad, CA, USA). PCR products from cloned DNA were purified using a QIAquick PCR purification kit (Qiagen, Hilden, Germany) according to manufacturer’s protocol. Purified PCR products were quantified using a spectrophotometer (NanoVue; GE Healthcare UK Ltd, Buckinghamshire, UK) at 260 nm for use as standards. The reaction mixture (20 μL) for Firmicutes
Table 1
851
comprised of 10 μL of SYBR green Master Mix, 5.2 μL of sterile Milli-Q water, forward and reverse primers, and 1 μL of template DNA. The reaction mixture (20 μL) for Bacteroidetes was comprised of 10 μL SYBR green Master Mix, 7.6 μL sterile Milli-Q water, 0.2 μL forward primer, 1.2 μL reverse primer and 1 μL DNA template. The thermal cycle conditions for detection of both Firmicutes and Bacteroidetes was one cycle of 95°C for 10 min and 40 cycles each of 95°C for 15 sec and 60°C for 1 min. Amplicon specificity was determined via dissociation curve analysis of PCR end products by increasing the temperature at a rate of 1°C/30 sec from 60°C to 95°C.
Statistical analysis All parameters in the study were analyzed using repeated measurement of general linear model by SPSS 13 for Windows (SPSS Inc., Chicago, IL, USA). The significance was set at P < 0.05 and Tukey’s pairwise comparisons were performed as a post hoc test.
RESULTS AND DISCUSSION Monensin concentration and short chain fatty acids profiles in the rumen Monensin concentration, total SCFA, SCFA composition and acetate : propionate ratios in the rumen during the sampling period are shown in Table 2. A rapid clearance of monensin from the rumen was observed once supplementation was withdrawn. The concentration of monensin decreased significantly (P < 0.05) by 60% within 1 day of withdrawal of monensin (day 0). Despite the low detection limits of
PCR primers used in the study
Target
Name
Sequence (5′→3′)
Product size (bp)
Concentration (μmol/L)
Reference
Methanogen
q-mcrA-f q-mcrA-r Firm 934-f Firm 1060-r Bact 934-f Bact 1060-r
TTCGGTGGATCDCARAGRGC GBARGTCGWAWCCGTAGAATCC GGAGYATGTGGTTTAATTCGAAGCA AGCTGACGACAACCATGCAC GGARCATGTGGTTTAATTCGATGAT AGCTGACGACAACCATGCAG
141
0.3 0.3 0.05 0.9 0.05 0.3
Denman et al. (2007)
Firmicutes Bacteroidetes
126 126
Guo et al. (2008) Guo et al. (2008)
Table 2 Monensin concentration (μmol/L), total SCFA (mmol/L), proportion of SCFA (%) and acetate : propionate (A:P) ratio in the rumen of cows following cessation of monensin administration
Sampling Time
Monensin (μmol/L)
Day 0 Day 1 Day 3 Day 5 Day 7 Day 10 Day 14 Day 21 Significance
0.40 ± 0.08 0.16 ± 0.16b nd nd nd nd nd nd *
Total SCFA (mmol/L)
Proportion of SCFA (%) Acetate
a
38.20 ± 4.78 68.34 ± 13.20 52.70 ± 23.28 67.59 ± 15.57 73.51 ± 12.16 63.46 ± 29.25 66.73 ± 28.52 84.88 ± 16.97 ns
Propionate
71.67 ± 3.30 67.35 ± 2.84b 68.30 ± 3.74ab 68.12 ± 3.41b 68.21 ± 2.63b 71.05 ± 3.96a 67.65 ± 1.13b 66.94 ± 3.08c * a
A:P ratio
n-Butyrate
15.50 ± 2.91 21.30 ± 2.21a 17.06 ± 2.72bc 18.11 ± 2.70bc 17.22 ± 2.37bc 16.71 ± 1.47bc 20.78 ± 0.53a 19.94 ± 1.70ab * c
12.83 ± 3.26 11.36 ± 0.96 14.64 ± 3.01 13.77 ± 0.71 14.57 ± 0.35 12.24 ± 2.66 11.57 ± 1.14 13.12 ± 1.73 ns
4.73 ± 0.91a 3.19 ± 0.45d 4.08 ± 0.75b 3.84 ± 0.77c 4.02 ± 0.68b 4.29 ± 0.58ab 3.26 ± 0.10cd 3.38 ± 0.45cd *
*P < 0.05. Values are means ± standard deviations (n = 3). Values in same column with different superscripts are significantly different (P < 0.05). SCFA, short chain fatty acid; nd, not detected; ns, not significant.
Animal Science Journal (2015) 86, 849–854
© 2015 Japanese Society of Animal Science
852 A. ABRAR et al.
the analytical instruments used, the concentration of monensin reached an undetectable level during the remaining sampling times. These results were consistent with the previous findings of Rogers et al. (1997) who reported that monensin disappeared from the rumen within 24 h. Although the levels of total SCFA did not differ statistically during the sampling period, the concentration tended to increase during the experimental period. The concentration at day 1 was 1.8 times higher than at day 0. A high concentration of total SCFA was maintained until the end of the experiment. Wallace et al. (1980) similarly reported an experiment using artificial rumen fluid where total SCFA production was higher in the absence of monensin with hay and concentrated substrate. Rogers et al. (1997) also reported that suppression of rumen volatile fatty acid concentration by monensin was recovered within 24 h of monensin withdrawal. There was no significant difference in the proportions of butyrate during sampling (Table 2). However, the proportions of acetate and propionate changed significantly (P < 0.05) compared to day 0. Acetate proportions decreased during sampling while propionate proportions increased. One proposed mode of action of monensin is that it increases propionate production in the rumen by stimulating propionateproducing bacteria (Schelling 1984). Increase in proportion of propionate in the present study was observed despite monensin withdrawal. Propionate proportion was increased significantly only on day 1 and day 14 over day 0. Rumen ecosystem stability on present experimental animals was disrupted due to supplementation and cessation of monensin, and recovery of rumen environment seems unlikely to be precisely as the initial condition, therefore such an unexpected phenomenon occurred. Moreover, variation on propionate proportion was bearable since comparison on day 0 to average propionate values from day 1 to day 21 showed only slight increase (data not shown). Nevertheless, the present study does not have sufficient data to explain clearly such phenomenon and needs further experiments to show information on rumen condition due to withdrawal of monensin. Furthermore, the increased production of propionate in subsequent sampling resulted in a decline in the acetate : propionate ratio (Table 2).
Profile of gas production and rumen bacteria population Methane and hydrogen production were indirectly assessed using an in vitro rumen fermentation technique as described by Watanabe et al. (2010). The profiles shown in Table 3 indicate that methane production increased significantly (P < 0.05) after monensin administration ceased. Methane production © 2015 Japanese Society of Animal Science
Table 3 Profile of incubation gas production (mL) following cessation of monensin administration
Sampling time
Methane (mL)
Hydrogen (mL)
Day 0 Day 7 Day 14 Day 21 Significance
0.17 ± 0.16 0.75 ± 0.45c 0.41 ± 0.17b 0.45 ± 0.16b *
0.0148 ± 0.0132 0.0053 ± 0.0028 0.0046 ± 0.0011 0.0048 ± 0.0010 ns
a
*P < 0.05. Values are means ± standard deviations (n = 3). Values in same column with different superscripts are significantly different (P < 0.05). ns, not significant.
Figure 1 Changes in the population of methanogens, Firmicutes and Bacteroidetes in the rumen following withdrawal of monensin supplementation. (●) Methanogens, (■) Firmicutes, (▲) Bacteriodetes, each line with vertical bars represents standard deviations. Different superscripts above vertical bars denote significant differences (P < 0.05).
increased while hydrogen production rapidly decreased at day 7 after withdrawal of monensin. These results are consistent with the observation that hydrogen is the major precursor of methane production in the rumen (Hungate 1967). According to Castro-Montoya et al. (2012), monensin acts in vitro by modifying the fermentation pattern regarding its substrate rather than directly affecting methane formation. In this study, methane production was estimated from in vitro rumen fermentation without additional substrate, which means that methane production originated from feed ingested by the animal. This indicates that the increasing methane production on days 7, 14 and 21 was most likely due to the absence of monensin in the rumen. Changes in the microbial population in the rumen were estimated by real-time PCR (Fig. 1). Because monensin inhibits Gram-positive bacteria and enhances Gram-negative bacteria, these bacterial groups were estimated at the phylum level of Firmicutes and Bacteroidetes, respectively. Microbial density of methanogens and Bacteroidetes after withdrawal of monensin administration differed (P < 0.05) Animal Science Journal (2015) 86, 849–854
DIETARY MONENSIN EFFECT IN THE RUMEN 853
during the sampling days. The population density of methanogens on day 1 increased but the density then decreased to the same level as on day 0. Similarly, the Bacteroidetes population density also increased on day 1 but then decreased until day 7 before increasing again on day 14. Although the trend for the Firmcutes population density was similar to that of methanogens, the change was moderate. Terminal restriction fragment length polymorphism (T-RFLP) analysis also showed that there was no major change in bacterial composition (data not shown). The significant differences in production of methane and hydrogen, propionate ratio, and A:P ratio after day 1 (Tables 2 and 3) would be expected to lead to changes in the bacterial composition. T-RFLP analysis can only detect major changes in bacterial populations and therefore it is likely that only minor changes in bacterial groups were present in this study. Thus monensin administration causes dysfunction rather than elimination of methanogens. These data confirm the results of Weimar et al. (2008) who reported that the population of methanogens and Gram-positive bacteria in the rumen of lactating cows was not significantly changed during supplementation and withdrawal of monensin. They suggested that the mode of action of monensin could not be fully explained by suppression of Grampositive bacteria in the rumen. Similarly, studies on long-term monensin administration showed that the duration of supplementation did not affect the number of methanogens present in the rumen of lactating cows (Hook et al. 2009). Our results are supported by these reports and thus we propose that monensin acts on the metabolic activities of related microbes rather than on microbial populations. Many Gram-positive ruminant bacteria are more sensitive to ionophores than Gram-negative bacteria. However, some Gram-negatives are initially ionophore-sensitive, and even Gram-positive bacteria can be resistant (Russell & Houlihan 2003). The mode of action of monensin on the suppression of methane production may be complex as suggested by Weimar et al. (2008). Further studies on the effect of monensin on metabolic activities of monensin-sensitive microbes are required. Furthermore, the effect of monensin on ruminant fermentation and microbial activities in different phases after supplementation should be investigated to clarify the mode of action of monensin.
ACKNOWLEDGMENTS A part of this study was financially supported by Grants-in-Aid for Scientific Research, Japan Society for the Promotion of Science (25450393). Real-time PCR was carried out at The Life Science Research Center (Center for Molecular Biology and Genetics), Mie University (Tsu, Japan). The authors are grateful to Ms. Noriko Matsukawa at Kyoto Institute of NutriAnimal Science Journal (2015) 86, 849–854
tion and Pathology for technical assistance with monensin detection by LC-MS/MS.
REFERENCES Aderinboye RY, Onwuka CFI, Arigbede OM, Oduguwa OO, Aina ABJ. 2012. Effect of dietary monensin inclusion on performance, nutrient utilisation, rumen volatile fatty acid concentration and blood status of West African dwarf bucks fed with basal diets of forages. Tropical Animal Health and Production 44, 1079–1087. Castro-Montoya JM, De Campeneere S, Van Ranst G, Fievez V. 2012. Interaction between methane mitigation additives and basal substrates on in vitro methane and VFA production. Animal Feed Science and Technology 176, 47–60. Cooprider EKL, Mitloehner FM, Famula TR, Kebreab E, Zhao Y, Van AL. 2011. Feedlot efficiency implications on greenhouse gas emissions and sustainability. Journal of Animal Science 89, 2643–2656. Denman SE, Tomkins NW, McSweeney CS. 2007. Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane. FEMS Microbiology Ecology 62, 313–322. Grainger C, Williams R, Eckard RJ, Hannah MC. 2010. A high dose of monensin does not reduce methane emissions of dairy cows offered pasture supplemented with grain. Journal of Dairy Science 93, 5300–5308. Guan H, Wittenberg KM, Ominski KH, Krause DO. 2006. Efficacy of ionophores in cattle diets for mitigation of enteric methane. Journal of Animal Science 84, 1896–1906. Guo X, Xia X, Tang R, Zhou J, Zhao H, Wang K. 2008. Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs. Letters in Applied Microbiology 47, 367–373. Hook SE, Northwood KS, Wright ADG, McBride BW. 2009. Long-term monensin supplementation does not significantly affect the quantity or diversity of methanogens in the rumen of the lactating dairy cow. Applied and Environmental Microbiology 75, 374–380. Hungate RE. 1967. Hydrogen as an intermediate in the rumen fermentation. ArchivfürMikrobiologie 59, 158–164. Kobayashi Y. 2010. Abatement of methane production from ruminants:Trends in the manipulation of rumen fermentation. Asian-Australasian Journal of Animal Science 23, 410– 416. Kobayashi Y, Wakita M, Hoshino S. 1988. Persistency of salinomycin effect on ruminal fermentation in wethers. Nutrition Reports International 38, 987–999. Kone P, Machado F, Cook RM. 1989. Effect of the combination of monensin and isoacids on rumen fermentation in vitro. Journal of Dairy Science 72, 2767–2771. Lwin KO, Kondo M, Ban-Tokuda T, Lapitan RM, Del Barrio AN, Fujihara T, Matsui H. 2012. Ruminal fermentation and microbial ecology of buffaloes and cattle fed the same diet. Animal Science Journal 83, 767–776. Matsui H, Wakabayashi H, Fukushima N, Ito K, Nishikawa A, Yoshimi R, et al. 2013. Effect of raw rice bran supplementation on rumen methanogen population density and in vitro rumen fermentation. Grassland Science 59, 129–134. McDougall EI. 1948. Studies on ruminant saliva. 1. The composition and output of sheep’s saliva. Biochemical Journal 43, 99–109. © 2015 Japanese Society of Animal Science
854 A. ABRAR et al.
McGinn SM, Beauchemin KA, Coates T, Colombatto D. 2004. Methane emissions from beef cattle: effects of monensin, sunflower oil, enzymes, yeast, and fumaric acid. Journal of Animal Science 82, 3346–3356. Rogers M, Jouany JP, Thivend P. 1997. The effect of short term and long termmonensin supplementation and its subsequent withdrawal on digestion in sheep. Animal Feed Science and Technology 65, 113–127. Russell JB, Houlihan AJ. 2003. Ionophore resistance of ruminal bacteria and its potential impact on human health. FEMS Microbiology Reviews 27, 65–74. Schelling GT. 1984. Monensin mode of action in the rumen. Journal of Animal Science 58, 1518–1527. Takahashi J, Mwenya B, Santoso B, Sar C, Umetsu K, Kishimoto T, et al. 2005. Mitigation of methane emission and energy recycling in animal agricultural systems. Asian-Australasian Journal of Animal Science 18, 1199–1208. Uddin MK, Kondo M, Kita J, Matsui H, Karita S, Goto M. 2010. Effect of supplementation of soy sauce cake and
© 2015 Japanese Society of Animal Science
vinegar brewer’s cake with total mixed ration silage-based diet on nutrient utilization by Holstein steers. Journal of Food, Agriculture & Environment 8, 282–287. Wallace RJ, Cheng KJ, Czerkawski JW. 1980. Effects of monensin on fermentation characteristics of the artificial rumen. Applied and Environmental Microbiology 40, 672– 674. Watanabe Y, Suzuki R, Koike S, Nagashima K, Mochizuki M, Forster RJ, Kobayashi Y. 2010. In vitro evaluation of cashew nut shell liquid as a methane-inhibiting and propionate-enhancing agent for ruminants. Journal of Dairy Science 93, 5258–5267. Weimar PJ, Stevenson DM, Mertens DR, Thomas EE. 2008. Effect of monensin feeding and withdrawal on populations of individual bacterial species in the rumen of lactating dairy cows fed high-starch rations. Applied Microbiology and Biotechnology 80, 135–145.
Animal Science Journal (2015) 86, 849–854
