Cytotherapy, 2014; 16: 1197e1206

ORIGINAL PAPERS

Effect of bone marrowederived mesenchymal stromal cells on hepatoma

SOMIA H. ABD-ALLAH1, SALLY M. SHALABY1, AMAL S. EL-SHAL1, EMAN ABD ELKADER1, SAMIA HUSSEIN1, EMAD EMAM2, NEHAD F. MAZEN3, MOHAMMED EL KATEB4 & MHA ATFY5 1 4

Medical Biochemistry Department, 2Internal Medicine Department, 3Histology and Cell Biology Department, Pathology Department and 5Clinical Pathology Department, Faculty of Medicine, Zagazig University, Zagazig, Egypt

Abstract Background aims. The aim of the study was to evaluate the effect of mesenchymal stromal cells (MSCs) on tumor cell growth in vitro and in vivo and to elucidate the apoptotic and anti-proliferative mechanisms of MSCs on a hepatocellular carcinoma (HCC) murine model. Methods. The growth-inhibitory effect of MSCs on the Hepa 1e6 cell line was tested by means of methyl thiazolyl diphenyl-tetrazolium assay. Eighty female mice were randomized into four groups: group 1 consisted of 20 mice that received MSCs only by intrahepatic injection; group 2 consisted of 20 HCC mice induced by inoculation of Hepa 1e6 cells into livers without MSC treatment; group 3 consisted of 20 mice that received MSCs after induction of liver cancer; group 4 consisted of 20 mice that received MSCs after induction of liver cancer on top of induced biliary cirrhosis. Results. MSCs exhibited a growth-inhibitory effect on Hepa 1e6 murine cell line in vitro. Concerning in vivo study, decreases of serum alanine transaminase, aspartate transaminase and albumin levels after MSC transplantation in groups 2 and 3 were found. Gene expression of a-fetoprotein was significantly downregulated after MSC injection in the HCC groups. We found that gene expression of caspase 3, P21 and P53 was significantly upregulated, whereas gene expression of Bcl-2 and survivin was downregulated in the HCC groups after MSC injection. Liver specimens of the HCC groups confirmed the presence of dysplasia. The histopathological picture was improved after administration of MSCs to groups 2 and 3. Conclusions. MSCs upregulated genes that help apoptosis and downregulated genes that reduce apoptosis. Therefore, MSCs could inhibit cell division of HCC and potentiate their death. Key Words: apoptosis, gene expression, hepatocellular carcinoma, MSCs

Introduction Hepatocellular carcinoma (HCC) is the sixth most common malignant disease worldwide and the third greatest cause of cancer-related death (1). The etiology of HCC has been related to a variety of diseases such as viral hepatitis (2), alcoholic hepatitis (3), nonalcoholic fatty liver disease (4) and metabolic syndrome, including diabetes mellitus (5). HCC is strongly associated with chronic hepatitis and cirrhosis (6). Most cases of HCC, approximately 80%, occur in combination with underlying cirrhosis (7); less than 10% are observed in non-cirrhotic livers, rarely without hepatitis (8). Notably, once cirrhosis is established, there is no proven effective

HCC prevention (9). Malignant hepatocellular transformation is characterized by a shortened halflife and increased proliferation and regeneration of hepatocytes secondary to ongoing inflammation (10). This leads to accumulation of genomic mutations and instability, alterations that sometimes accumulate in a neoplastic phenotype (11). Dysregulation of the balance between proliferation and cell death represents a pro-tumorigenic principle in human hepatocarcinogenesis. Molecular alterations were reported for HCC that induce an imbalance in the regulation of apoptosis. Alterations in the expression and/or activation of p53 are frequent in HCC cells, which confer on them

Correspondence: Somia H. Abd-Allah, MD, Medical Biochemistry Department, Faculty of Medicine, Zagazig University, Zagazig, Egypt 44 519; Amal S. El-Shal, MD, Medical Biochemistry Department, Faculty of Medicine, Zagazig University, Zagazig, Egypt 44 519. E-mail: [email protected] (Received 27 February 2014; accepted 1 May 2014) ISSN 1465-3249 Copyright Ó 2014, International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jcyt.2014.05.006

1198

S. H. Abd-Allah et al.

resistance to chemotherapeutic drugs. Although the expression of some pro-apoptotic genes is decreased, the balance between death and survival is dysregulated in HCC mainly because of over-activation of anti-apoptotic pathways (12). Indeed, some molecules involved in counteracting apoptosis, such as Bcl-2 and survivin, are over-expressed in HCC cells. It was indicated that inflammatory processes, as well as the epithelial-mesenchymal transitions that occur in HCC cells to facilitate their dissemination, are related to cell survival. Therefore, therapeutic strategies to selectively inhibit anti-apoptotic signals in liver tumor cells have the potential to provide powerful tools to treat HCC (12). Mesenchymal stromal cells (MSCs) have been identified as bone marrowederived cell populations that can differentiate into mesodermal cell lineages that are easily isolated and propagated in vitro. They can differentiate into a number of mesodermal cell lineages including bone, cartilage, stroma, adipose, connective tissue, muscle and tendon. Therefore, MSCs that maintain their capacity for self-renewal contribute to a wide variety of endogenous organ and tissue repair (13). Despite their distinct origins, stem cells and tumor cells share many characteristics (14). In particular, they have similar signaling pathways that regulate self-renewal and differentiation, including the Wnt, Notch, sonic hedgehog and bone morphogenetic proteins pathways (15). Wnt signaling regulates genes that are involved in cell metabolism, proliferation, cellcycle regulation and apoptosis (16). Survivin and Bcl-2 genes are targets of Wnt signaling (17). Regarding the mechanism of interaction between MSCs and tumor cells, Khakoo et al. showed that human MSCs can inhibit proliferation of some tumor cells in vitro through activation of the Akt protein kinase within some but not all tumor and primary cell lines (18). Furthermore, it was reported that MSCs produced transient arrest of tumor cells in the G1 phase of the cell cycle accompanied by a reduction in the apoptotic rate (19). The present work aimed at evaluating the effects of MSCs on tumor cell proliferation in vitro and the in vivo progression of liver cancer and to investigate the mechanistic actions of MSCs in tumor suppression by assessing the gene expression profile of caspase-3, P21, P53, survivin and Bcl-2.

Preparation of bone marrowederived MSCs Mouse stromal cells were isolated according to a protocol modified from Pulavendran et al. (20), with some modifications. Bone marrow cells were collected by flushing the femurs and tibias of 6week-old BALB/c male mice with the use of culture medium [low-glucose Dulbecco’s modified Eagle’s medium (DMEM, 1.0 g/L glucose; Lonza Bioproducts, Basel, Switzerland) supplemented with 10% fetal bovine serum (Lonza Bioproducts)]. After aspiration, a 29-gauge needle was used to disturb aggregation; the whole aspirate was then centrifuged at 2000 rpm for 10 min. The pellet was seeded in 25-cm2 culture plate with the culture medium, supplemented with 1% penicillin streptomycineAmphotericin B Mixture (10 IU/10 IU/25 mg, 100 mL; Lonza Bioproducts). Cells were cultured at a concentration of 5000/cm2/0.2e0.3 mL of media and then were incubated at 37
C in 5% humidified Co2 in a Co2 incubator (Heraeus, Langenselbold, Germany). Non-adherent cells were eliminated by half medium change at 1, 2 and 3 days, and the whole medium was replaced with fresh medium every week. The cells were grown for 2e3 weeks until 80e90% confluence. The whole adherent cells were detached by trypsinization with 0.25% trypsin/ ethylene diamine tetra acetic acid (EDTA) (trypsin, 1:250; EDTA, 1 mmol/L; Lonza Bioproducts) and then were re-plated. Third-passage cells were used for experiments (Figure 1). Cell cultures were routinely assessed with the use of an inverted microscope, and cell viability was determined by means of trypan blue staining. MSCs in culture were characterized by their adhesiveness and fusiform shape, which was detected by means of an inverted microscope and through determination of surface markers of bone marrow MSCs. The latter was performed through evaluation of the positive expression of nonhematopoietic origin [by use of the monoclonal antibodies that recognize an epitope on endoglin (CD105, CD44)] and the negative expression of hematopoietic markers, such as CD34, which were analyzed by means of flow cytometer according to Calabro et al. (21).

Preparation of mice (Hepa 1e6) cell line Methods This study was performed in the stem cell research laboratory in the Medical Biochemistry and Molecular Biology Department, in collaboration with Histology and Cell Biology, Pathology and Internal Medicine Departments, Faculty of Medicine, Zagazig University, Zagazig, Egypt.

Hepa 1e6 cells were obtained from American Type Culture Collection and were grown in a sterile 50cm2 tissue culture flask in complete medium containing DMEM supplemented with 10% fetal bovine serum and antibiotics (100 U/mL penicillin and 100 mg/mL streptomycin) in 95% air/5% CO2 at 37
C. Cells were cultured to 100% confluence.

Effect of MSCs on liver cancer

1199

Figure 1. (A) MSC culture after 7 days (magnification 200). (B) MSC subculture (twice) (magnification 200).

Cell proliferation methylthiazolyldiphenyl-tetrazolium assay Cell proliferation was performed with the use of samples of Hepa 1e6 only, MSCs only, Hepa 1e6 treated with MSCs (ratios of Hepa 1e6 cells to MSCs were 1:1 and 1:2) and Hepa 1e6 treated with equal volumes of MSC-conditioned media (collected from the flasks of the third passage of MSCs). MSCs were plated in 96-well tissue culture plates in a final volume of 100 mL per well. Tumor cells were suspended in DMEM and added to wells with or without MSCs or with MSC-conditioned media, 100 mL per well. MSCs and tumor cells were co-cultured for 72 h. Triplicate wells were included for each sample. In the methylthiazolyldiphenyl-tetrazolium (MTT) assay, MTT (Trevigen Inc, Gaithersburg, MD, USA) was added (10 mL per well) and the plate was incubated for 4e6 h to allow for intracellular reduction of the soluble yellow MTT to the insoluble purple formazan dye. Detergent reagent was then added to each well to solubilize the formazan dye before measuring the absorbance of each sample at 570 nm. The inhibitory effect of MSCs on viability of tumor cells was expressed as follows: inhibitory rate (%) ¼ (OD570 of tumor cellseOD570 of tumor with MSCs þ OD570 of MSCs control)/OD570 of tumor cells  100 % (22). Animal model and experimental design Eighty healthy BALB/c female mice of matched age and weight were included in this study. Animals were inbred in the experimental animal unit, Faculty of Medicine, Zagazig University. Mice were maintained according to the standard guidelines of Institutional Animal Care and Use Committee and after institutional review board approval. Mice were maintained on stock diet and kept under fixed appropriate conditions of housing and handling.

All experiments were carried out in accordance with the research protocols, following the recommendations of the Institute Review Board Instruction of Care and Use of Laboratory Animals. Mice were randomly divided into four groups (with 20 animals each): group 1 received MSCs only; group 2 included mice with HCC by inoculation of Hepa 1e6 murine cells in their livers; group 3 received MSCs after induction of liver cancer; group 4 included HCC mice that received MSCs after induction of liver cancer on top of induced biliary cirrhosis. Group 4 was subjected to common bile duct ligation to induce cirrhosis. Groups 2, 3 and 4 were subjected to liver cancer by Hepa 1e6 murine hepatoma cell line injection (intrahepatic). Cirrhosis and HCC patterns were confirmed by histopathological examination after 8 weeks of induction. MSCs were prepared from extracted bone marrow of male mice; they were injected intravenously in mice of groups 1, 3 and 4. Through the period of the study, blood samples (0.5 mL each) were collected from the periorbital vein of mice; the sera were separated and stored at 20
C for alanine transaminase (ALT), aspartate transaminase (AST) and albumin determination. Blood samples were collected from each mouse according to the following protocol: groups 2, 3 and 4: 8 weeks after induction of liver cancer; groups 1, 3 and 4 after 8 weeks from MSCs injection. Mice were killed according to the following protocol: group 3: after induction of hepatoma (six mice) and at the end of the experiment (14 mice); group 4: after common bile duct ligation to confirm cirrhosis (three mice), after injection of Hepa 1e6 murine hepatoma cell line to confirm liver cancer on top of cirrhosis (three mice) and the others (14 mice) at the end of our experiment to detect MSC effects. Liver tissues were collected after perfusing with 4% paraformaldehyde solution and preserved in formalin

1200

S. H. Abd-Allah et al.

Table I. Primer sequences of studied genes and the housekeeping gene.

AFP Bcl-2 Survivin Caspase 3 P21 P53 Sry b-Actin

Forward

Reverse

GTGAAACAGACTTCCTGGTCCT AGCTGCACCTGACGCCCTT CATGGGTGCCCCGACGTT ATGTCATCTCGCTCTGGT CCCGAGAACGGTGGAACT AGAGACCGCCGTACAGAAGA AGAGATCAGCAAGCAGCTGG GCCATGTACGTAGCCATCCA

GCCCACAGACCATGAAACAAG GTTCAGGTACTCAGTCATCCAC CTCAATCCATGGCAGCCAGC TCTGTTTCTTTGCGTGGA AGAGGGCAGGCAGCGTAT GCATGGGCATCCTTTAACTC TCTTGCCTGTATGTGATGGC AACCGCTCATTGCCGATAGT

buffer solution for histopathological studies. For total RNA isolation, liver tissues were stored at 80
C. The incorporation of the transplanted MSCs that were extracted from male bone marrow into the female liver in studied groups was examined through RNA extraction from liver tissues of killed female mice from these groups at the end of the study, followed by reverse transcriptaseepolymerase chain reaction (RT-PCR). This method was used to detect the expression of the sex determination region on the Y-chromosome male (Sry gene) on liver tissue in recipient female mice. To compare the results with the Sry gene of male mice, RNA extraction from two different male mouse tissue samples followed by RTPCR amplification for Sry gene was performed (23). Preparation of cirrhosis model Liver cirrhosis was induced in mice by means of common bile duct ligation according to Blomme et al. (24). In a laminar flow cabinet, under aseptic conditions and isoflurane inhalation, mice underwent a midline abdominal incision. The common bile duct was isolated, and two separate points of the duct were identified and ligated with a double ligature of a nonresorbable suture (silk cut, 5e0). The first ligature was made below the junction of the hepatic ducts and the second was made above the entrance of the pancreatic duct. The common bile duct was sectioned between the two ligatures. Preparation of liver cancer model Liver tumorigenesis was accomplished by inoculation of the Hepa 1e6 cell line according to the protocol proposed by Kroger et al. (25). Cells were counted and injected (intrahepatic) in a dose of 1  107cells per mouse. Tumors reached a size of approximately 2500 mm3 after a mean time of 8 weeks. Injection of MSCs into mice The formed colonies of the third-generation MSCs were washed twice with phosphate-buffered saline

Product size 148 192 452 604 493 227 248 373

bp bp bp bp bp bp bp bp

(Lonza Bioproducts), and cells were trypsinized with 0.25% trypsin in 1 mmol/L EDTA for 5 min at 37
C. MSCs in a dose of 1  106 cells were injected intravenously in mice. RT-PCR analysis Liver tissues were homogenized until tissue clumps were no longer visible. Total RNA was isolated from liver tissue homogenate with the use of the IQeasy plus CTB RNA extraction kit (iNtRON Biotechnology, Seongnam, Korea), and the ratio of absorbance values at 260 and 280 nm indicated an estimate of RNA purity. The extracted RNA was used for determination of a-fetoprotein (AFP), Bcl-2, survivin, caspase 3, P21, P53 and Sry gene expression. b-Actin was used as a housekeeping gene. RT-PCR was performed with the use of the one-step Maxime RT-PCR PreMix kit (iNtRON Biotechnology). Template RNA and specific primers were added into the Maxime RT-PCR PreMix tubes. The sequence of the primers used is listed in Table I. RT-PCR reactions for the samples were performed according to the following protocol: reverse transcriptase reaction at 45
C for 30 min, then inactivation of RTase at 94
C for 5 min; initial denaturation at 94
C for 5 min, then 35 cycles of 94
C for 1 min; 56
C for 45 s and 72
C for 45 s, then final extension at 72
C for 7 min. Samples were loaded on 2% agarose gel, and electrophoresis was performed. The target bands were visualized with an ultraviolet illuminator (Bio-Rad Laboratories Inc Hercules, CA, USA). The amount of amplified product was quantified for each sample with the use of a computing densitometer. Gel images were digitized by means of the Viewpix 700 gel scanner with the use of a transparency unit; gel images were saved in TIFF format. Images were analyzed by means of Total Lab Quant software to obtain band intensity represented as area under peak. The final amount of PCR product was expressed as the ratio of the respective gene amplified to that of the b-actin gene to account for any differences in beginning amounts of RNA.

Effect of MSCs on liver cancer

1201

Table II. Biochemical parameter levels in studied groups.

ALT (mg/dL) AST (mg/dL) Albumin (g/dL) a

Group 1 n ¼ 20

Group 2 (HCC) n ¼ 20

Group 3 (HCC þ MSCs) n ¼ 14

Group 4 (HCC on top of cirrhotic liver þ MSCs) n ¼ 14

30.27  10.1 67  16.17 2.81  0.43

53.2  3.34a 107.4  7.9a 2.54  0.23a

34.13  1.26 66.2  11.5 2.85  0.15

32.47  2.39 72.6  6.32 2.91  0.2

P < 0.001 when compared with groups 1, 3 or 4.

Histopathological analysis of liver tissue Mice were anesthetized with ether inhalation, and the liver of each mouse was dissected out carefully. Liver specimens were fixed in 10% formalin solution and processed to prepare 5-mm-thick paraffin sections for hematoxylin and eosin stains (26). The sections were taken from multiple samples at various locations. Statistical analysis All statistical analysis was performed with the use of the SPSS software (Statistical Package for the Social Sciences, version 15.0, SPSS Inc, Chicago, IL, USA). Quantitative variables were demonstrated as mean  standard deviation. Comparison between the studied groups was performed by means of analysis of variance and t-test. Values of P < 0.05 were considered statistically significant. Results Characterization of cultured MSCs Morphologically, these cells had a spindled, fibroblast appearance after expansion. Differentiation assays demonstrated that MSCs retained their ability to form osteoblasts, adipocytes and myofibroblasts at passages 15e25. Flow-cytometric analysis of cell surface markers in MSCs expressed CD105 and CD44 but did not express CD34. The surface marker expression pattern corresponds to bone marroweMSCs.

is higher than that of MSCs when co-cultured with the tumor cells. Results of the biochemical parameters Concerning ALT, AST and albumin levels, no significant difference was detected in group 3 (HCC on top of normal liver) and group 4 (HCC on top of cirrhotic liver) after MSC injection when compared with group 1 (P > 0.05), whereas serum ALT and AST levels were highly significantly lower and albumin level was highly significantly higher in groups 3 and 4 than in group 2 (P < 0.001 for each). There was no significant difference between group 3 and group 4 after MSC injection concerning ALT, AST and albumin levels (Table II). RT-PCR results AFP, survivin and Bcl-2 after MSC injection showed a significant decrease in their expression compared with liver cancer before MSC injection (P < 0.001). P53, P21 and caspase-3 showed a significant increase in their expression after MSC transplantation in liver cancer compared with before MSC transplantation (P < 0.001) (Figure 2A,C). No significant difference was found in AFP expression between liver cancer on top of normal and on top of cirrhotic livers (P ¼ 0.22). Analysis of the presence of MSCs in the liver after MSC transplantation is important for assessing the graft through the presence of donor cells. It is detected through the expression of the Sry gene from donor male cells by means of RT-PCR. The Sry gene was expressed in all groups except for group 2 (Figure 2B).

Results of cell proliferation in culture by use of MTT A significant reduction of Hepa 1e6 proliferation was noticed in those incubated with MSC-conditioned media and those treated with the use of MSCs with different concentrations (mean inhibitory rate  standard deviation of three independent experiments for samples of Hepa 1e6 þ MSCs in a ratio of 1:1 ¼ 8.9  1.2, samples of Hepa 1e6 þ MSCs in a ratio 1:2 ¼ 11.3  2.4 and samples of Hepa 1e6 þ MSCconditioned media ¼ 31.3  1.5). Surprisingly, the growth-inhibitory effect of MSC-conditioned media

Histopathology results Histopathological examination was performed for liver specimens of mice from group 1, which received MSCs only (Figure 3A,B); group 2, after induction of liver cancer (Figure 3C); group 3, which received MSCs after induction of liver cancer (Figure 3D); and group 4, liver cancer on top of cirrhosis (Figure 3E,F) and at the end of the trial after MSC transplantation (Figure 3G,H).

1202

S. H. Abd-Allah et al.

Figure 2. Gene expression of liver proteins. (A) Total RNA was isolated and after quality verification, RT-PCR was carried out and the products were run on 2% agarose gel to analyze the expression of genes of AFP, Bcl-2, caspase-3, P21, P53 and survivin. Lanes 1and 2: HCC on top of cirrhosis; lanes 3 and 4: HCC on top of healthy liver; lanes 5 and 6: HCC on top of cirrhosisþ MSCs; lanes7 and 8: HCC on top of healthy liverþ MSCs. Caspase-3, P21 and P53 were highly expressed in MSC-treated groups, whereas survivin, Bcl-2 and AFP were downregulated. (B) RT-PCR expression of Sry gene (male Y chromosomeespecific gene). Lanes 1 and 2 show products of Sry gene in represented male mice. Lanes 3 and 4 show products of Sry gene in represented female mice not treated with MSCs. Lanes 5, 6, 7 and 8 show products of Sry gene in represented female mice treated with MSCs. (C) Semi-quantification of liver proteins, messenger RNAs of control and treated groups: Caspase-3, P21 and P53 were significantly highly expressed in MSC treatment, whereas survivin, Bcl-2 and AFP expression was significantly downregulated.

Data obtained from group 1, which received MSCs only, were similar before and after MSC transplantation. Sheets of normal hepatocytes with preserved hepatic architecture were seen radiating from central veins and separated by sinusoids (Figure 3A). Normal portal tract appeared, consisting of a portal vein, a bile duct and a hepatic arteriole (Figure 3B). Liver specimens of mice from the liver cancer group confirmed the presence of dysplasia. Hepatocytes showed pleomorphism with variably sized nuclei that showed hyperchromasia and irregular chromatin pattern. Binucleated hepatocytes and inflammatory cells were also present (Figure 3C). Improvement of the histopathological picture after administration of MSCs was detected, with reversible liver cell damage in the form of hydropic degeneration. Hepatocytes showed vacuolated cytoplasm with some hyperchromatic nuclei. Some congested sinusoids were also seen (Figure 3D). In liver specimens of mice from group 4, the presence of cirrhosis was confirmed as regards hepatic nodules, fibrosis and proliferated bile ducts and ductules; the numerous blood vessels indicated neoangiogenesis (Figure 3E). In Figure 3F, livers showed a pattern of dysplasia with fibrosis and cellular infiltrate. After MSC transplantation, partial improvement was demonstrated with hydropic degeneration, fatty changes and cellular infiltration (Figure 3G,H).

Discussion Recent data regarding signaling pathways that regulate tumor cell proliferation, differentiation, invasion and metastasis has led to the identification of several possible therapeutic targets (27). MSCs are multipotent cells that are capable of self-renewal and differentiation into several cell types under the influence of micro-environmental factors, and these properties make them attractive therapeutic candidates (18). This study aimed to evaluate the impact of MSCs on liver tumor growth in two experimental systems and the mechanisms by which MSCs exerted their actions. First, we investigated the effect of bone marrowederived MSCs on tumor cell proliferation by co-culture of the Hepa 1e6 cell line with different concentrations of MSCs or by treatment of tumor cells with MSC-conditioned media. A significant reduction of Hepa 1e6 cell proliferation was observed in both those incubated with MSCconditioned media and others treated by MSCs with different concentrations. Second, we studied the ability of MSCs to inhibit cancer cell phenotypes in a murine model of hepatoma. The study performed in four groups: group 1 included healthy mice that received MSCs only, group 2 included mice with liver cancer induced by murine Hepa 1e6 cell line without MSCs transplantation, group 3 included mice with liver cancer

Effect of MSCs on liver cancer

1203

Figure 3. Hematoxylin and eosinestained sections of liver specimens from group 1: control group (A, B); group 2 (liver cancer group) (C), group 3 (liver cancer receiving MSCs) (D) and group 4: liver cancer on top of cirrhosis (E, F) and after MSC transplantation in liver cancer on top of cirrhosis (G, H). Sheets of normal hepatocytes (arrow) are seen radiating from central veins (v) and separated by sinusoids (s) (A). Normal portal tract appears consisting of a portal vein (v), a bile duct (d) and a hepatic arteriole (A), surrounded by connective tissue (B). (C) Hepatocytes show pleomorphism with variably sized nuclei that show hyperchromasia and irregular chromatin pattern (arrowhead). Binucleated hepatocytes (arrow) and inflammatory cells (double-headed arrow) are also seen. After administration of MSCs, hepatocytes show markedly vacuolated cytoplasm (arrow) with some hyperchromatic nuclei (arrowhead). Congested sinusoids (s) are also present (D). (E) Hepatic nodules are seen with fibrosis (f), proliferated bile ducts and ductules (d) and numerous blood vessels (v). (F) The liver shows fibrosis (f) and cellular infiltrate (double-headed arrow). After MSC transplantation, partial improvement is demonstrated with vacuolated cells (arrow), fatty changes (arrowhead) and cellular infiltration (double-headed arrow) (G). (H) Higher magnification of G is shown. Microscopic magnification for A, B, C, D, F and H, 400; for E and G, 100.

that received MSC transplantation later and group 4 included mice with induced biliary cirrhosis followed by liver tumorigenesis by means of inoculation of Hepa 1e6 cells followed by MSC transplantation. An interesting setup consists of implantation of HCC cells in fibrotic livers. In the present study, in group 4, cirrhosis was established by means of

common bile duct ligation followed by intra-hepatic murine Hepa 1e6 cell line injection to induce liver cancer on top of cirrhosis. Tumors in fibrotic livers grow significantly larger and more rapidly than do those in normal livers (28). Experimental findings in animal models suggested that the induction of parenchymal damage is a prerequisite for successful

1204

S. H. Abd-Allah et al.

homing and repopulation with stem cells (29). However, the current study showed no significant difference between group 3 (HCC on top of normal liver) and group 4 (HCC on top of cirrhotic liver) after MSC injection concerning ALT, AST and albumin levels or AFP expression. In the current study, male MSCs were transplanted to female mice to allow detection of the incorporated MSCs into the recipient liver tissue. Homing of MSCs in liver was confirmed through detection of Sry gene expression (23). The current study was performed in mice as animal models because of the physiologic and genetic similarities between rodents and humans, the short lifespan and the breeding capacity. The mouse is a favorite model for cancer study because of the availability of gene-targeting methods and the possibility of cell line implantation. The advantage of this mouse model is the short time span needed for the development of tumors and the fact that it is an efficient method when enough cell lines are used (30). The Hepa 1e6 tumor model in mice was chosen because it shows reliable tumor growth in 100% of mice, characterized by AFP expression (25). In the present study, the significant decrease of serum ALT and AST, significant increase of albumin and decreased AFP expression in both HCC groups after MSC injection suggested improvement of liver function and amelioration of the malignant status. No significant difference was found in the liver enzyme levels of both HCC groups after MSC injection when compared with a healthy control group, which indicated normalization of liver functions. These data were confirmed by the histopathological picture that showed minimal reversible liver cell damage in the form of hydropic degeneration and absence of fibrous thickening of portal tracts, inflammation or dysplasia. The results of the current study are in agreement with those of Lu et al. (22) and Abdel Aziz et al. (31). Lu et al. (22) suggested that MSCs have potential inhibitory effects on hepatoma cell growth in vitro and in vivo and that they also reduced the average volume of ascites formation after intraperitoneal inoculation of ascitogenous hepatoma cells into BALB/c mice. In addition, Qiao et al. (32) demonstrated the ability of human MSCs to inhibit cancer cell phenotypes in three experimental systems, including an animal transplantation model for tumorigenesis, coculture experiments and with the use of conditioned media to determine the role of secreted molecules. Results showed that the latent time to tumor formation was prolonged and that the tumor size was smaller (33). Recently, Ma et al. (34) demonstrated that murine bone marrow stromal cells pulsed with homologous tumor-derived exosomes could enhance

anti-tumor activities by inhibiting the proliferation of the liver cancer cells. The return of liver function can be explained by the incorporation of MSCs within the liver tissue, which, in turn, differentiated into hepatocyte-like cells (35). In the current study, the expression of Sry gene in liver tissue supported that MSCs reached the damaged liver tissue and exerted regeneration activity. Previous studies have demonstrated that systemically injected MSCs readily home to sites of primary and metastatic tumor development (33,36). MSCs would be useful for liver regeneration (37). Moreover, the liver itself can release powerful signals attracting bone marrowederived cells and probably contributing to remodeling of their morphology and function. These cells in turn can produce molecular signals, improving regeneration and function of injured parenchyma (38). The results of the present study demonstrated that MSCs downregulated oncogene expression, whereas survivin and Bcl-2 gene expression was downregulated in liver tissues of MSC-treated HCC mice. Survivin and Bcl-2 are involved in the Wnt/bcatenin pathway, one of the main oncogenic pathways involved in HCC (1). Survivin acts as a positive cell regulator because it stimulates cell replication. In the same instance, it forms the spindle midzone and midbody microtubules during late mitosis. Indeed, survivin blocks death receptoremediated and mitochondria-mediated pathways of apoptosis (39). Similar suggestions were provided by Qiao et al. (32), who found that when human hepatoma cell lines H7402 were co-cultured with human MSCs, H7402 cell proliferation decreased, apoptosis increased and the expression of Bcl-2, c-Myc, proliferating cell nuclear antigen and survivin was downregulated. Previous studies identified dickkopf-1, secreted by MSCs and acting as a negative regulator of the Wnt signaling pathway, to be one of the molecules responsible for the inhibitory effect (40,41). On the other hand, MSCs upregulated the messenger RNA expression of p53, cell-cycle negative regulator (p21) and apoptosis-associated protease (caspase-3) in liver tissues of HCC groups after MSC injection. It is widely believed that activation of caspase-3 leads to DNA fragmentation, a hallmark of apoptosis, and that the activation of caspase-3 can be regulated by the Bcl-2 protein family. P53 regulates survivin expression by direct binding to the survivin promoter; p53 also affects survivin expression by activating p21 in normal cell (39). Gene expression profiling studies of rat MSCs showed that 104 transcripts were upregulated after in vitro exposure to conditioned media from human colorectal cancer cells. It was found that conditioned media from human MSCs were able to inhibit the

Effect of MSCs on liver cancer proliferation of human breast cancer cells in vitro (42). Our results were in agreement with Djouad et al. (43) and Lu et al. (22), who found that apoptotic cell death of tumor cells increased dramatically after co-culture with MSCs, and the cell cycle analysis showed an accumulation of tumor cells predominantly in the G0/G1 phase and a decrease in the S phase. They suggested that the growth inhibition effect of MSCs on tumor cells might be associated with FasL-induced apoptosis and cell cycle arrest (22). Sun et al. (44) proved that native MSCs exhibit intrinsic inhibition of HepG2, which is potentiated by MSC-conditioned and co-cultured media transfected with tumor necrosis factorerelated apoptotic ligand (apo2L), because Hep G2 carries death receptor 5, which binds to apo2L. Although previous studies have supported that MSCs may suppress tumor growth (22,45e47), others believe that MSCs may contribute to tumor protection (48e50). Interestingly, Li et al. (51) reported that human MSCs played a dual role in tumor cell growth in vitro and in vivo. It was found that human MSCs inhibited the proliferation of cancer cell lines and caused G1 phase cell cycle arrest and apoptosis in vitro. However, human MSCs were also found to enhance tumor formation and growth in vivo (51). Investigations thus far have been performed with different tumor types, models and implantation accompanied by varying MSC routes of administration, cell doses and time courses. All of these conditions are likely to influence the experimental outcome (48). In conclusion, MSCs and their conditioned media had anti-proliferative effect activity on tumor cells in vitro. Moreover, MSC injection in mice that developed HCC by Hepa 1e6—either on top of normal or cirrhotic liver—showed tumor regression through stimulation of apoptotic pathway and inhibition of anti-apoptotic gene expression. A new finding reports that no significant differences in the results between the effects of MSCs on HCC on top of normal or on top of cirrhotic liver were found. Acknowledgments This work was funded by support of academic research of Zagazig University Projects, Zagazig University Postgraduate and Research Affairs. Disclosure of interests: The authors have no commercial, proprietary, or financial interest in the products or companies described in this article.

1205

References 1. Parkin DM. The global health burden of infection-associated cancers in the year 2002. Int J Cancer. 2006;118:3030e44. 2. Kanwal F, Hoang T, Kramer JR. Increasing prevalence of HCC and cirrhosis in patients with chronic hepatitis C virus infection. Gastroenterology. 2011;140:1182e8. 3. Petta S, Craxi A. Hepatocellular carcinoma and nonalcoholic fatty liver disease: from a clinical to a molecular association. Curr Pharm Des. 2010;16:741e52. 4. Page JM, Harrison SA. NASH and HCC. Clin Liver Dis. 2009;13:631e47. 5. Amarapurkar DN, Patel ND, Kamani PM. Impact of diabetes mellitus on outcome of HCC. Ann Hepatol. 2008;7:148e51. 6. Morita K, Taketomi A, Soejima Y. De novo hepatocellular carcinoma in a liver graft with sustained hepatitis C virus clearance after living donor liver transplantation. Liver Transpl. 2009;15:1412e6. 7. Liovet JM, Burroughs A, Bruix J. Hepatocellular carcinoma. Lancet. 2003;362:1907e17. 8. Bluteau O, Jeannot E, Bioulac-Sage P. Bi-allelic inactivation of TCF1 in hepatic adenomas. Nat Genet. 2002;32:312e5. 9. Camma C, Giunta M, Andreone P, Craxi A. Interferon and prevention of hepatocellular carcinoma in viral cirrhosis: an evidence based approach. J Hepatol. 2001;34:593e602. 10. Guo JT, Zhou H, Liu C, Aldrich C, Saputelli J, Whitaker T. Apoptosis and regeneration of hepatocytes during recovery from transient hepadnavirus infections. J Virol. 2000;74:1495e505. 11. Liang TJ, Heller T. Pathogenesis of hepatitis C-associated hepatocellular carcinoma. Gastroenterology. 2004;127:S62e71. 12. Fabregat I. Dysregulation of apoptosis in hepatocellular carcinoma cells. World J Gastroenterol. 2009;15:513e20. 13. Wulf GG, Chapuy B, Trumper L. Mesenchymal stem cells from bone marrow: phenotype, aspects of biology, and clinical perspectives. Med Klin. 2006;101:408e13. 14. Menon LG, Picinich S, Koneru R. Differential gene expression associated with migration of mesenchymal stem cells to conditioned medium from tumor cells or bone marrow cells. Stem Cells. 2007;25:520e8. 15. Willert K, Jones KA. Wnt signalling: is the party in the nucleus? Genes Dev. 2006;20:1394e404. 16. Yang YA, Zhang GM, Feigenbaum L, Zhang YE. Smad3 reduces susceptibility to hepatocarcinoma by sensitizing hepatocytes to apoptosis through downregulation of Bcl-2. Cancer Cell. 2006;9:445e57. 17. Joubert A, Bianchi P, Maritz C. Influence of prostaglandinA2 on Bax, Bcl-2 and PCNA expression in MCF-7 cells. Biomed Res. 2006;27:157e62. 18. Khakoo AY, Pati S, Anderson SA, Reid W, Elshal MF, Rovira II, et al. Human mesenchymal stem cells exert potent antitumorigenic effects in a model of Kaposi’s sarcoma. J Exp Med. 2006;203:1235e47. 19. Ramasamy R, Lam EW, Soeiro I, Tisato V, Bonnet D, Dazzi F. Mesenchymal stem cells inhibit proliferation and apoptosis of tumor cells: impact on in vivo tumor growth. Leukemia. 2007;21:304e10. 20. Pulavendran S, Vignesh J, Rose C. Differential anti-inflammatory and antifibrotic activity of transplanted mesenchymal vs hematopoietic stem cells in carbon tetrachloride-induced liver injury in mice. Int Immunopharmacol. 2010;10:513e9. 21. Calabro L, Fonsatti E, Bellomo G, Alonci A, Colizzi F, Sigalotti L, et al. Differential levels of soluble endoglin (CD105) in myeloid malignancies. J Cell Physiol. 2003;194: 171e5.

1206

S. H. Abd-Allah et al.

22. Lu YR, Yuan Y, Wang XJ. The growth inhibitory effect of mesenchymal stem cells on tumor cells in vitro and in vivo. Cancer Biol Ther. 2008;7:245e51. 23. Pulavendran S, Rose C, Mandal AB. Hepatocyte growth factor incorporated chitosan nanoparticles augment the differentiation of stem cell into hepatocytes for the recovery of liver cirrhosis in mice. J Nanobiotechnol. 2011;9:15. 24. Blomme B, Steenkiste CV, Grassi P, Haslam SM, Dell A, Callewaert N, et al. Alterations of serum protein N-glycosylation in two mouse models of chronic liver disease are hepatocyte and not B cell driven. Am J Physiol Gastrointest Liver Physiol. 2011;300:G833e42. 25. Kroger A, Ortmann D, Krohne TU, Mohr L, Blum HE, Hauser H, et al. Growth suppression of the hepatocellular carcinoma cell line Hepa1-6 by an activatable interferon regulatory factor-1 in Mice. Cancer Res. 2001;61:2609e17. 26. Bancroft JD, Gamble M. Theory and Practice of Histological Techniques. 5th edition. New York/London/Philadelphia: Churchill Livingstone; 2002:125e38. 27. Whittaker S, Marais R, Zhu AX. The role of signaling pathways in the development and treatment of hepatocellular carcinoma. Oncogene. 2010;29:4989e5005. 28. Kornek M, Raskopf E, Tolba R, Becker U, Klöckner M, Sauerbruch T, et al. Accelerated orthotopic hepatocellular carcinomas growth is linked to increased expression of proangiogenic and prometastatic factors in murine liver fibrosis. Liver Int. 2008;28:509e18. 29. Schwartz RE, Reyes M, Koodie L. Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte-like cells. J Clin Invest. 2002;109:1291e302. 30. Vucur M, Roderburg C, Bettermann K, Tacke F, Heikenwalder M, Trautwein C, et al. Mouse models of hepatocarcinogenesis: What can we learn for the prevention of human hepatocellular carcinoma? Oncotarget. 2010;1:373e8. 31. Abdel Aziz MT, El Asmar MF, Atta HM, Mahfouz S, Fouad HH, Roshdy NK, et al. Efficacy of mesenchymal stem cells in suppression of hepatocarcinorigenesis in rats: possible role of Wnt signaling. J Exp Clin Cancer Res. 2011;5(30):49. 32. Qiao L, Xu Z, Zhao Z. Suppression of tumorigenesis by human mesenchymal stem cells in a hepatoma model. Cell Res. 2008;18:500e7. 33. Kidd S, Spaeth E, Klopp A, Andreeff M, Hall B, Marini FC. The (in) auspicious role of mesenchymal stromal cells in cancer: be it friend or foe. Cytotherapy. 2008;10:657e67. 34. Ma B, Jiang H, Jia J, Di L, Song G, Yu J, Zhu Y, Lu Z, et al. Murine bone marrow stromal cells pulsed with homologous tumor-derived exosomes inhibit proliferation of liver cancer cells. Clin Transl Oncol. 2012;14:764e73. 35. Hall B, Dembinski J, Sasser AK, Studeny M, Andreeff M, Marini F. Mesenchymal stem cells in cancer: tumorassociated fibroblasts and cell-based delivery vehicles. Int J Hematol. 2007;86:8e16. 36. Nakamizo A, Marini F, Amano T, Khan A, Studeny M, Gumin J, et al. Human bone marrow-derived mesenchymal stem cells in the treatment of gliomas. Cancer Res. 2005;65: 3307e18.

37. Sakaida I, Terai S, Yamamoto N. Transplantation of bone marrow cells reduces CCl4-induced liver fibrosis in mice. Hepatology. 2004;40:1304e11. 38. Abdel Aziz MT, Atta H, Roshdy NK. Role of SDF-1/CXCR4 axis in stem cell homing in the mouse model of induced lung fibrosis. Int J Biotech Biochem. 2010;6:625e44. 39. Altieri DC. Survivin, versatile modulation of cell division and apoptosis in cancer. Oncogene. 2003;22:8581e9. 40. Gregory CA, Singh H, Perry AS, Prockop DJ. The Wnt signalling inhibitor Dickkopf-1 is required for reentry into the cell cycle of human adult stem cells from bone marrow. J Biol Chem. 2003;278:28067e78. 41. Zhu Y, Sun Z, Han Q, Liao L, Wang J, Bian C, et al. Human mesenchymal stem cells inhibit cancer cell proliferation by secreting DKK-1. Leukemia. 2009;23:925e33. 42. Qiao L, Xu ZL, Tan X. Investigation of inhibition of Wnt/bcatenin pathway in breast cancer cells mediated by Dkk-1 released from human mesenchymal stem cells. Prog Biochem Biophys. 2007;34:702e8. 43. Djouad F, Bony C, Apparailly F, Pascale LP, Christian J, Noel D. Earlier onset of syngeneic tumors in the presence of mesenchymal stem cells. Transplantation. 2006;82: 1060e6. 44. Sun XY, Nong J, Qin K, Lu H, Moniri MR, Dai LJ, et al. MSC (TRAIL)-mediated HepG2 cell death in direct and indirect co-cultures. Cancer Res. 2011;31:3705e12. 45. Ohlsson LB, Varas L, Kjellman C, Edvardsen K, Lindvall M. Mesenchymal progenitor cell-mediated inhibition of tumor growth in vivo and in vitro in gelatin matrix. Exp Mol Pathol. 2003;75:248e55. 46. Ganta C, Chiyo D, Ayuzawa R, Rachakatla R, Pyle M, Andrews G, et al. Rat umbilical cord stem cells completely abolish rat mammary carcinomas with no evidence of metastasis or recurrence 100 days post-tumor cell inoculation. Cancer Res. 2009;69:1815e20. 47. Tian K, Yang S, Ren Q, Han Z, Lu S, Ma F, et al. p38 MAPK contributes to the growth inhibition of leukaemic tumor cells mediated by human umbilical cord mesenchymal stem cells. Cell Physiol Biochem. 2010;26:799e808. 48. Kucerova L, Matuskova M, Hlubinova K, Altanerova V, Altaner C. Tumor cell behaviour modulation by mesenchymal stromal cells. Mol Cancer. 2010;9:129. 49. Kurtova AV, Balakrishnan K, Chen R, Ding W, Schnabl S, Quiroga MP, et al. Diverse marrow stromal cells protect CLL cells from spontaneous and drug-induced apoptosis: development of a reliable and reproducible system to assess stromal cell adhesion-mediated drug resistance. Blood. 2009;114: 4441e50. 50. Vianello F, Villanova F, Tisato V, Lymperi S, Ho KK, Gomes AR, et al. Bone marrow mesenchymal stromal cells non-selectively protect chronic myeloid leukemia cells from imatinib-induced apoptosis via the CXCR4/CXCL12 axis. Haematologica. 2010;95:1081e9. 51. Li L, Tian H, Yue WM, Zhu F, Li SH, Li WJ. Human mesenchymal stem cells play a dual role on tumor cell growth in vitro and in vivo. J Cell Physiol. 2011;226:1860e7.