1467
of primers designed to amplify a much shorter fragment of the 5’NCR. The rationale comes from the work of Zhang et allwho demonstrated that the efficiency with which reverse transcriptase generates amplifiable cDNA is inversely related to the length of the PCR product. Our original set of 5’-NCR-derived primers’ gave a first-round product of 340 base-pairs (bp); the new set (PT1-4) generates a first round product of only 81 bp. The sequences are: PT1=5’CGTTAGTATGAGTGTCGTGC (sense, outer, nucleotides 90-109); PT2=5’CGGTGTACTCACCGGTTCC (anti-sense, outer, 171-153); PT3=5’AGTGTCGTGCAGCCTCCAGG (sense, inner, 100-119); PT4=5’CGGTTCCGCAGACCACTATG (anti-sense, inner 159-140). With the original set, 24 of 26 anti-HCV-positive sera from
new set
with community-acquired chronic hepatitis C were viraemic. The new set demonstrated viraemia in all 26. In 14 anti-HCV-positive patients with type 2 autoimmune hepatitis6 the number in whom viraemia could be detected rose from 9 to 13. Similar increases in HCV-RNA detection were observed in other groups of anti-HCV-positive patients, including those with haemophilia and hepatocellular carcinoma, and in total the number of serum samples in which HCV-RNA was detected increased from 91/117 (78%) to 104/117 (89%). No PCR signals were generated from 30 routine blood donor serum samples with either the original or the PTl-4 set of primers. A further advantage of PT 1-4 is that rapid two-step temperature cycling can be done in both rounds (94°C denaturation 1 min, 55 °C annealing 1 min), reducing the total cycling time from 6 to 4 h.
enhanced gastrointestinal absorption. Elsewhere we have reported that ascorbic acid significantly increased the concentration of Al in liver, brain, and bone of rats given Al(OH)3 with ascorbic acid .5 Ascorbic acid administration to patients with renal failure who are taking Al-containing compounds may be harmful.
JOSE L. DOMINGO
1. Slanina P, Frech W, Ekstrom LG, Loof
L, Slorach S, Cedergren A. Dietary citric acid enhances absorption of aluminium in antacids. Clin Chem 1986; 32: 539-41. 2 Nolan CR, Califano JR, Butzin CA. Influence of calcium acetate or calcium citrate on intestinal aluminium absorption. Kidney Int 1990; 38: 937-41. 3. Walker JA, Sherman RA, Cody RP. The effect of oral bases on enteral aluminium absorption. Arch Intern Med 1990; 150: 2037-39. 4 Partridge NA, Regnier FE, White JL, Hem SL. Influence of dietary constituents on intestinal absorption of aluminium. Kidney Int 1989; 35: 1413-17. 5. Domingo JL, Gomez M, Llobet JM, Corbella J. Influence of some dietary constituents on aluminium absorption and retention in rats. Kidney Int 1991; 39: 598-601.
patients
Division of Virology, Department of Medical
Microbiology,
University College and Middlesex School of Medicine, London W1P 7PN, UK
JEREMY A. GARSON CHRISTOPHER J. A. RING PHILIP W. TUKE
1. Garson JA, Ring C, Tuke P, Tedder RS Enhanced detection by PCR of hepatitis C virus RNA. Lancet 1990; 336: 878-79. 2. Okamoto H, Okada S, Sugiyama Y, et al. Detection of hepatitis C virus RNA by a two-stage polymerase chain reaction with two pairs of primers deduced from the 5’ 3.
noncoding region. Jap J Exp Med 1990; 60: 215-22 Zhang LQ, Simmonds P, Ludlam CA, Leigh Brown AJ. Detection, quantification, and sequencing of HIV-1 from the plasma of seropositive individuals and from
factor VIII concentrates. AIDS 1991; 5: 675-81. 4. Han JH, Shyamala V, Richman KH, et al. Characterization of the terminal regions of hepatitis C viral RNA: identification of conserved sequences in the 5’untranslated region and poly(A) tails at the 3’ end. Proc Natl Acad Sci USA 1991; 88: 1711-15. 5. Brillanti S, Garson JA, Tuke PW, et al. Effect of alpha-interferon therapy on hepatitis C viraemia in community acquired chronic non-A, non-B hepatitis a quantitative polymerase chain reaction study. J Med Virol 1991; 34: 136-41. 6. Garson JA, Lenzi M, Ring C, et al. Hepatitis C viraemia in adults with type 2 autoimmune hepatitis. J Med Virol 1991; 34: 223-26.
MERCEDES GOMEZ JUAN M. LLOBET CRISTOBAL RICHART
School of Medicine, University of Barcelona, 43201 Reus, Spain
Hypophosphataemia, hallucinations, and delirium tremens SIR,-Knochel1 pointed out the similar neurological features of delirium tremens and severe hypophosphataemia, but said that in the case of hypophosphataemia "the rather distinctive hallucinations of delirium tremens have not been observed". Hence Dr Barbe and colleagues’ report (Oct 26, p 1083) of visual hallucinations in a patient with profound hypophosphataemia is relevant to the pathogenesis of delirium tremens. Hypophosphataemia is common in chronic alcoholics. Stein et al2 recorded this condition in 50% of alcoholics on admission and Knochel1 noted its development in some alcoholics 2-4 days after admission, coinciding with the time course of development of delirium tremens. 31P-magnetic resonance spectroscopy of the brain would be the most appropriate way to ascertain whether depletion of intracellular phosphate (with resultant impairment of energy-dependent cellular processes) correlated with neurological dysfunction in chronic alcoholics undergoing withdrawal. This technique has already produced evidence for a defect in cerebral phosphate metabolism in chronic stable hepatic encephalopathy.3 Phosphate supplementation might prove a simple and appropriate adjunctive treatment for alcohol withdrawal. Midland Centre for
Neurosurgery and Neurology,
Smethwick,
Effect of ascorbic acid on gastrointestinal aluminium absorption SIR,-Citrate taken with a Al(OH)3 (aluminium hydroxide) for a long time causes a significant increase in urinary Al excretion and in blood AI concentrations in both healthy people or patients with chronic renal failure.1-3 This finding indicates that citrate contributes to Al absorption, so that patients with severe renal insufficiency would be at risk of serious sequelae of Al intoxication. In-vitro studies by Partridge et al4 showed that the form of Al ultimately present in the intestinal lumen significantly affects absorption. Several dietary constituents prevent precipitation of Al at intestinal pH and such compounds would result in Al absorption. We wondered whether ascorbic acid, like citric acid, also augments Al absorption. Thirteen healthy volunteers were given 3-day oral courses of AI(OH3) (900 mg) three times a day alone or with ascorbic acid (2 g). A drug-free interval of 10 days separated the two periods. 24 h urine collections were done and urinary Al was measured:
*p
of primers designed to amplify a much shorter fragment of the 5’NCR. The rationale comes from the work of Zhang et allwho demonstrated that the efficiency with which reverse transcriptase generates amplifiable cDNA is inversely related to the length of the PCR product. Our original set of 5’-NCR-derived primers’ gave a first-round product of 340 base-pairs (bp); the new set (PT1-4) generates a first round product of only 81 bp. The sequences are: PT1=5’CGTTAGTATGAGTGTCGTGC (sense, outer, nucleotides 90-109); PT2=5’CGGTGTACTCACCGGTTCC (anti-sense, outer, 171-153); PT3=5’AGTGTCGTGCAGCCTCCAGG (sense, inner, 100-119); PT4=5’CGGTTCCGCAGACCACTATG (anti-sense, inner 159-140). With the original set, 24 of 26 anti-HCV-positive sera from
new set
with community-acquired chronic hepatitis C were viraemic. The new set demonstrated viraemia in all 26. In 14 anti-HCV-positive patients with type 2 autoimmune hepatitis6 the number in whom viraemia could be detected rose from 9 to 13. Similar increases in HCV-RNA detection were observed in other groups of anti-HCV-positive patients, including those with haemophilia and hepatocellular carcinoma, and in total the number of serum samples in which HCV-RNA was detected increased from 91/117 (78%) to 104/117 (89%). No PCR signals were generated from 30 routine blood donor serum samples with either the original or the PTl-4 set of primers. A further advantage of PT 1-4 is that rapid two-step temperature cycling can be done in both rounds (94°C denaturation 1 min, 55 °C annealing 1 min), reducing the total cycling time from 6 to 4 h.
enhanced gastrointestinal absorption. Elsewhere we have reported that ascorbic acid significantly increased the concentration of Al in liver, brain, and bone of rats given Al(OH)3 with ascorbic acid .5 Ascorbic acid administration to patients with renal failure who are taking Al-containing compounds may be harmful.
JOSE L. DOMINGO
1. Slanina P, Frech W, Ekstrom LG, Loof
L, Slorach S, Cedergren A. Dietary citric acid enhances absorption of aluminium in antacids. Clin Chem 1986; 32: 539-41. 2 Nolan CR, Califano JR, Butzin CA. Influence of calcium acetate or calcium citrate on intestinal aluminium absorption. Kidney Int 1990; 38: 937-41. 3. Walker JA, Sherman RA, Cody RP. The effect of oral bases on enteral aluminium absorption. Arch Intern Med 1990; 150: 2037-39. 4 Partridge NA, Regnier FE, White JL, Hem SL. Influence of dietary constituents on intestinal absorption of aluminium. Kidney Int 1989; 35: 1413-17. 5. Domingo JL, Gomez M, Llobet JM, Corbella J. Influence of some dietary constituents on aluminium absorption and retention in rats. Kidney Int 1991; 39: 598-601.
patients
Division of Virology, Department of Medical
Microbiology,
University College and Middlesex School of Medicine, London W1P 7PN, UK
JEREMY A. GARSON CHRISTOPHER J. A. RING PHILIP W. TUKE
1. Garson JA, Ring C, Tuke P, Tedder RS Enhanced detection by PCR of hepatitis C virus RNA. Lancet 1990; 336: 878-79. 2. Okamoto H, Okada S, Sugiyama Y, et al. Detection of hepatitis C virus RNA by a two-stage polymerase chain reaction with two pairs of primers deduced from the 5’ 3.
noncoding region. Jap J Exp Med 1990; 60: 215-22 Zhang LQ, Simmonds P, Ludlam CA, Leigh Brown AJ. Detection, quantification, and sequencing of HIV-1 from the plasma of seropositive individuals and from
factor VIII concentrates. AIDS 1991; 5: 675-81. 4. Han JH, Shyamala V, Richman KH, et al. Characterization of the terminal regions of hepatitis C viral RNA: identification of conserved sequences in the 5’untranslated region and poly(A) tails at the 3’ end. Proc Natl Acad Sci USA 1991; 88: 1711-15. 5. Brillanti S, Garson JA, Tuke PW, et al. Effect of alpha-interferon therapy on hepatitis C viraemia in community acquired chronic non-A, non-B hepatitis a quantitative polymerase chain reaction study. J Med Virol 1991; 34: 136-41. 6. Garson JA, Lenzi M, Ring C, et al. Hepatitis C viraemia in adults with type 2 autoimmune hepatitis. J Med Virol 1991; 34: 223-26.
MERCEDES GOMEZ JUAN M. LLOBET CRISTOBAL RICHART
School of Medicine, University of Barcelona, 43201 Reus, Spain
Hypophosphataemia, hallucinations, and delirium tremens SIR,-Knochel1 pointed out the similar neurological features of delirium tremens and severe hypophosphataemia, but said that in the case of hypophosphataemia "the rather distinctive hallucinations of delirium tremens have not been observed". Hence Dr Barbe and colleagues’ report (Oct 26, p 1083) of visual hallucinations in a patient with profound hypophosphataemia is relevant to the pathogenesis of delirium tremens. Hypophosphataemia is common in chronic alcoholics. Stein et al2 recorded this condition in 50% of alcoholics on admission and Knochel1 noted its development in some alcoholics 2-4 days after admission, coinciding with the time course of development of delirium tremens. 31P-magnetic resonance spectroscopy of the brain would be the most appropriate way to ascertain whether depletion of intracellular phosphate (with resultant impairment of energy-dependent cellular processes) correlated with neurological dysfunction in chronic alcoholics undergoing withdrawal. This technique has already produced evidence for a defect in cerebral phosphate metabolism in chronic stable hepatic encephalopathy.3 Phosphate supplementation might prove a simple and appropriate adjunctive treatment for alcohol withdrawal. Midland Centre for
Neurosurgery and Neurology,
Smethwick,
Effect of ascorbic acid on gastrointestinal aluminium absorption SIR,-Citrate taken with a Al(OH)3 (aluminium hydroxide) for a long time causes a significant increase in urinary Al excretion and in blood AI concentrations in both healthy people or patients with chronic renal failure.1-3 This finding indicates that citrate contributes to Al absorption, so that patients with severe renal insufficiency would be at risk of serious sequelae of Al intoxication. In-vitro studies by Partridge et al4 showed that the form of Al ultimately present in the intestinal lumen significantly affects absorption. Several dietary constituents prevent precipitation of Al at intestinal pH and such compounds would result in Al absorption. We wondered whether ascorbic acid, like citric acid, also augments Al absorption. Thirteen healthy volunteers were given 3-day oral courses of AI(OH3) (900 mg) three times a day alone or with ascorbic acid (2 g). A drug-free interval of 10 days separated the two periods. 24 h urine collections were done and urinary Al was measured:
*p
