Cardiovasc Toxicol DOI 10.1007/s12012-015-9314-2
Efavirenz Causes Oxidative Stress, Endoplasmic Reticulum Stress, and Autophagy in Endothelial Cells Marlene Weiß • Bernd Kost • Ingrid Renner-Mu¨ller Eckhard Wolf • Ioannis Mylonas • Ansgar Bru¨ning
•
Ó Springer Science+Business Media New York 2015
Abstract The non-nucleoside reverse transcriptase inhibitor efavirenz is a widely prescribed antiretroviral drug used in combined antiretroviral therapy. Despite being an essential and life-saving medication, the required lifelong use of HIV drugs has been associated with a variety of adverse effects, including disturbances in lipid metabolism and increased cardiovascular risk. Efavirenz belongs to those HIV drugs for which cardiovascular and endothelial dysfunctions have been reported. It is here shown that elevated concentrations of efavirenz can inhibit endothelial meshwork formation on extracellular matrix gels by normal and immortalized human umbilical vein cells. This inhibition was associated with an increase in oxidative stress markers, endoplasmic reticulum (ER) stress markers, and autophagy. Induction of ER stress occurred at pharmacologically relevant concentrations of efavirenz and resulted in reduced proliferation and cell viability of endothelial cells, which worsened in the presence of elevated efavirenz concentrations. In combination with the HIV protease inhibitor nelfinavir, both oxidative stress and ER stress became elevated in endothelial cells. These data indicate that pharmacologically relevant concentrations of efavirenz can impair cell viability of endothelial cells and that these effects may
M. Weiß B. Kost I. Mylonas A. Bru¨ning Molecular Biology Laboratory, Ludwig-Maximilians-University, Munich, Germany I. Renner-Mu¨ller E. Wolf Chair of Molecular Animal Breeding and Biotechnology, Gene Center, Ludwig-Maximilians-University, Munich, Germany A. Bru¨ning (&) Molecular Biology Laboratory, University Hospital Munich, Maistrasse 11, 80337 Munich, Germany e-mail: [email protected]
be aggravated by either elevated concentrations of efavirenz or by a combined use of efavirenz with other oxidative stress-inducing medications. Keywords Efavirenz Nelfinavir Endothelial cells Endoplasmic reticulum stress Oxidative stress
Introduction The advent of highly active antiretroviral drugs has saved the lives of millions of HIV-infected people. Concomitant targeting of different essential steps in the viral replication cycle by treatment with a combination of drugs, e.g., reverse transcriptase inhibitors and protease inhibitors, has proven to be an effective means to curb viral spread. However, the life-saving and life-prolonging benefits of these antiretroviral drugs have also led to more and more concerns about the possible risks and adverse effects of long-term HIV drug treatment, including liver and kidney damage and increased cardiovascular risk [1–4]. Since efficient HIV suppression has thus become a long-term social and medico-economic challenge of global importance, further development of antiretroviral drugs and identification of possible risk factors of the currently prescribed drugs is mandatory. Efavirenz (EFV) is a first-generation non-nucleoside reverse transcriptase inhibitor (NNRTI) and has been in use as a first-line regimen since its approval in 1998 [5–8]. Skin reactions (rash) and neuropsychiatric central nervous system disorders (dizziness, insomnia) are the most common side effects of efavirenz and other NNRTIs [5–8]. Efavirenz is not recommended as a medication for pregnant women since both clinical observations and animal
123
Cardiovasc Toxicol
experiments have indicated a teratogenic potential for efavirenz [5–8]. The cellular and molecular mechanisms leading to the observed side effects of efavirenz are poorly understood. In liver and hepatoma cells, efavirenz and its metabolites had been shown to induce oxidative stress, mitotoxicity, and autophagy when applied at elevated concentrations [9–11]. Pro-oxidative functions may also be responsible for the endothelial dysfunction and pro-atherosclerotic effects observed in efavirenz-treated individuals [12] and in isolated endothelial cells [13, 14]. Here, we show that efavirenz causes the induction of reactive oxygen species, associated with ER stress and autophagy in human umbilical vein cells, and reveal drug–drug interactions with nelfinavir that might aggravate the side effects of efavirenz on endothelial cells.
Materials and Methods Cells and Cell Culture Human umbilical vein endothelial cells (HUVEC) were purchased from Provitro (Berlin, Germany). Immortalized EA.hy926 endothelial cells [15] were kindly provided by G. Multhoff (University Hospital TU Munich, Radiation Oncology, Germany). HUVECs were maintained in a provided endothelial cell growth medium (Provitro, Berlin, Germany), and EA.hy926 cells were cultured in DMEM (Biochrom, Berlin, Germany), supplemented with 10 % bovine serum albumin (Biochrom, Berlin, Germany). For endothelial tube formation, cells were seeded in angiogenesis l-slides (Ibidi, Martinsried, Germany) at a density of 500 cells/well on GeltrexÒ basement membrane matrixcoated surfaces (10 ll GeltrexÒ/well; LifeTechnologies, Karlsruhe, Germany).
Reagents Efavirenz was bought from Bristol Myers Squibb, Munich, Germany, and recovered from 50-mg capsules by means of repeated ethanol extraction and speed-vac concentration (Eppendorf Concentrator 5301, Eppendorf, Hamburg, Germany). The efavirenz extract was finally dissolved in 1 ml of ethanol to obtain a stock solution of 50 mg/ml in ethanol. Nelfinavir mesylate was purchased from Sigma (Sigma, Munich, Germany) and kept as a stock solution of 50 mg/ml in ethanol. N-acetylcysteine and quercetin were also purchased from Sigma (Munich, Germany) and kept in 100 mM stock solution in PBS (N-acetylcysteine) or DMSO (quercetin), respectively. Chemo-Sensitivity Assay (MTT Assay) For cell viability analysis, 1 9 104 cells were seeded in 96-well cell culture plates and incubated for 72 h under cell culture conditions. Then, 20 ll of an MTT (3-(4,5-Dimethyl2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide, Sigma, Germany) stock solution (5 mg/ml PBS) in 200 ll of cell culture medium was added, and cells were further incubated for 1 h under cell culture conditions. The water-insoluble precipitate formed in adherent viable cells was dissolved in 100 ll of DMSO and analyzed by an ELISA reader at 595 nm. All MTT assays were performed in triplicate. Western Blot Analysis Cell lysates for immunoblot analysis were generated by solubilizing cells in RIPA buffer (Cellsignal, Hamburg, Germany); 20 lg of protein extracts (Bio-Rad Bradford Assay, Bio-Rad, Munich, Germany) were subjected to SDS–polyacrylamide gel electrophoresis (Bio-Rad Mini
Table 1 Primer pairs used in this study Genes
Forward primer (50 –30 )
Reverse primer (50 –30 )
HSPA1A
GTGACCTTCGACATCGATGCCAACG
CTGACCCAGACCCTCCCTTGGGAC
475
29/57
HSPA4
GAGGACCAGTATGATCATTTGG
GTCTGAATCCGAAGGCACAGCTG
336
32/57
HSPA5
GCTGTAGCGTATGGTGCTGC
ATCAGTGTCTACAAC TCATC
794
29/57
HSPA8
CAACCATGTCCAAGGGACCTG
CCAAGGTAGGCTTCTGCAATTTCC
412
25/57
HSP90AA1
AACTCAGCCTTTGTGGAACG
GTCTACTTCTTCCATGCGTG
687
29/57
HSP90B1
GGCTGTGGTGTCTCAGCGCC
CAGGATCCAAATGGTGAGAG
540
29/57
HSPD1
AGACAGAGTTACAGATGCCC
GAACATGCCACCTCCCATAC
466
29/57
HMOX1
GGCCGGATGGAGCGTCCGCAAC
CATGGCATAAAGCCCTGCAGC
870
29/57
DNAJB1
CAACGTGAACTTTGGCCGCTC
GTGGGGACGTTCACTGTGCAGC
399
29/57
TP53
TGGTAATCTACTGGGACGGA
GTCTGAGTCAGGCCCTTCTG
397
29/57
b-actin
GGAGAAGCTGTGCTACGTCG
CGCTCAGGAGGAGCAATGAT
366
29/57
Bp = calculated base pair length of PCR product; Tann = annealing temperature
123
PCR product (bp)
Cycles/Tann (°C)
Cardiovasc Toxicol
0
5
10
15
μg/ml EFV
15
μg/ml EFV
EA.hy926
HUVEC
A
0
5
10
HUVEC
EA.hy926
B
Fig. 1 Efavirenz inhibits pseudotube formation by endothelial cells. HUVEC and EA.hy926 cells were seeded in angiogenesis l-slides (Ibidi, Martinsried, Germany) at a density of 500 cells/well either on Geltrex basement membrane matrix-coated surfaces (LifeTechnologies, Karlsruhe, Germany) (10 ll Geltrex/well) (a) or on uncoated
plastic surfaces (b). Cells were allowed to adhere for 24 h before the medium was replaced by efavirenz-containing medium, and the cultures were then photographed after an additional 24-h incubation (a: 109 lens; b: 409 lens)
Protean II Cell; Bio-Rad, Munich, Germany). Proteins were transferred to PVDF membranes in a Bio-Rad Mini Protean II blotting chamber at 1 mA/cm2 membrane in 10 % methanol, 192 mM glycine, 25 mM Tris, pH 8.2. After blocking of membranes with 4 % nonfat milk powder in PBS-0.05 % Tween for 4 h, primary antibodies were applied in blocking buffer and incubated at 4 °C overnight. Antibodies against PARP, phospho-p53 (Ser-15), and eNOS were purchased from Cell Signaling Technology (NEB, Frankfurt, Germany). Antibodies against HSP70 (W27), HSP90a/b (F8), p53 (DO1), BiP (H-129), and GAPDH (0411) were purchased from Santa Cruz Biotech (Heidelberg, Germany). HO-1/HMOX1/hsp32 antibodies
(MAB3776) were purchased from RnD Systems (Darmstadt, Germany). Secondary, alkaline phosphatase (AP)coupled antibodies against the corresponding primary antibodies were purchased from Cell Signaling, Frankfurt, Germany. AP detection was performed by the chromogenic BCIP/NBT assay (Promega, Mannheim, Germany). PCR Analysis For RT-PCR analysis of heat-shock protein expression and XBP1 splicing, 5 9 105 EA.hy926 cells were seeded in 6-well cell culture plates and allowed to adhere for 24 h before drug application. Drug application was then
123
Cardiovasc Toxicol
B
EA.hy926 15 μg/ml EFV
untreated
10 μg/ml EFV
untreated
10μg/ml EFV
MDC
HUVEC
hase
A
EA.hy926 untreated
phase MDC
EA.hy926
C
untreated
D
phase
10 μg/ml EFV
autophagy
phase
autophagy
Fig. 2 Efavirenz induces autophagy. a High-magnification phasecontrast microscopy of EA.hy926 cells grown as monolayers on glass cover slips and treated with or without 15 lg/ml efavirenz for 24 h. b, c HUVEC and EA.hy926 cells were seeded in 8-well cell culture chambers (Millicell EZ slides; Millipore, Darmstadt, Germany) at a density of 5,000 cells/well and were allowed to adhere for 24 h. Cells were then incubated with 1 lg/ml MDC (Sigma, Munich, Germany) in cell culture medium for 15 min and examined under a fluorescence
microscope (409 lens, Zeiss Axiophot, Zeiss, Germany). Fluorescence and matching phase-contrast images are shown. d EA.hy926 cells were treated with efavirenz as in (c) and incubated with Cyto-ID Autophagy staining reagent (Enzo Life Sciences, Lo¨rrach, Germany) in cell culture medium for 30 min and examined under a fluorescence microscope. Arrows depict large intracellular vacuoles, assumed to represent late-stage autophagosomes formed under conditions of excessive autophagy
performed for additional 7 h to induce changes in mRNA expression. RNA preparation was performed with the RNA extraction kit (Macherey–Nagel, Du¨ren, Germany), and cDNA was generated with the MMLV reverse transcriptase system (Promega, Mannheim, Germany), according to the manufacturer’s recommendations. Primer pairs and PCR conditions are listed in Table 1. Real-time PCR analysis was performed by using GACAAGTGTCAAGAGGTCAT/CTG ACCCAGACCCTCCCTTGGGAC primers for HSPA1 and CAGCAACAAAGTGCAAGATTC/CATGGCATAAAGCC CTGCAGC primers for HMOX1 and iTaqTM Universal SYBRÒ Green Supermix (Bio-Rad, Munich, Germany) and the Applied Biosystems 7500 Fast Real-Time PCR System. XBP1 splicing analysis by real-time PCR using specific primers and probe was performed as previously described [16].
Cell Staining Assays
123
For the detection of autophagy, HUVEC or EA.hy926 cells were seeded on glass cover slips and allowed to grow and adhere under cell culture conditions for 24 h. Cells were then incubated with efavirenz for 24 h and incubated as viable cells for 15 min under cell culture conditions with 1 lg/ml of monodansylcadaverine (Sigma, Munich, Germany) in standard cell culture medium. Cells were then washed twice with cell culture medium and subjected as viable cells to fluorescence microscopy (Zeiss Axiophot, Zeiss, Germany). Staining for autophagy was also performed with the Cyto-ID Autophagy staining kit (Enzo Life Sciences, Lo¨rrach, Germany), as recommended by the supplier. Calcein-AM solution for viable cell staining (Sigma, Munich, Germany) was diluted 1:1,000 in cell
Cardiovasc Toxicol
Statistical Analysis
A 0.6
p ≤ 0.05
MTT analyses were performed in triplicate, and mean values ±SD were calculated. Statistical analysis (Mann– Whitney U test) was performed with the SPSS 21 program (IBM).
OD 595 nm
0.5 0.4 0.3 0.2 0.1
Results
0 0
2
4
6
8
10
Efavirenz Inhibits Tube Formation by Endothelial Cells
μg/ml efavirenz (72 h)
B
0
2
6
4
8
10
μg/ml efavirenz (144 h) Fig. 3 Efavirenz inhibits cell proliferation of endothelial cells. a EA.hy926 cells were seeded in triplicate in 96-well cell culture plates (1 9 104 cells/well) and analyzed after a 72-h incubation using the MTT assay. OD595: optical density at 595 nm. The assay was repeated twice. b EA.hy926 cells seeded at a low cell density in 6-well cell culture plates (5 9 103 cells/well) were treated with the indicated concentrations of 0–10 lg/ml efavirenz and incubated for 6 days under cell culture conditions. Cells grown on the plates were fixed with 80 % ethanol for 5 min and then stained with an aqueous solution of 0.5 % Coomassie Brilliant Blue (Sigma, Munich Germany). The assay was repeated twice
culture medium immediately before use und applied on cells for 20 min before microscopical analysis. FACScan Analysis Detection of reactive oxygen species (ROS) by FACScan analysis was by using the 20 ,70 -dichlorodihydrofluorescein diacetate substrate (DCFH-DA; Sigma, Munich, Germany). EA.hy926 cells were grown in 6-well cell culture chambers (250,000 cells/well) for 24 h under cell culture conditions and then treated with efavirenz or nelfinavir for 4 or 24 h. Cells were then incubated for 45 min with 1 lg/ml of DCFH-DA in cell culture medium under cell culture conditions, collected by trypsinization, and subjected to FACScan analysis (Beckman Coulter Epics XL-MCL flow cytometer; Beckman Coulter, Munich, Germany) by using a 575 nm filter for detection of green fluorescence.
Endothelial cells grown on extracellular matrix proteins are able to form pseudocapillary structures (‘‘pseudotubes’’ or ‘‘honeycombs’’) that can be used to study drug effects on endothelial cells in vitro [17–19]. Figure 1a shows that such mesh-like structures, formed by isolated human umbilical vein endothelial cells (HUVEC), were partly disrupted by efavirenz when applied at 10 lg/ml and were completely destroyed by efavirenz at concentrations of 15 lg/ml. Similar results were obtained using the immortalized HUVEC cell line EA.hy926 (Fig. 1a). When grown under standard cell culture conditions on glass cover slips, which led to a more adhesive phenotype, marked intracellular vacuolation was visible in EA.hy926 and HUVEC cells treated with concentrations of 10 and 15 lg/ml of efavirenz (Figs. 1b, 2). Partial detachment of cells also indicated the cytotoxic effects of efavirenz at these concentrations (Fig. 1b). Efavirenz Induces Endoplasmic Reticulum Stress and Autophagy in Endothelial Cells Extensive intracellular vacuolation is a morphological characteristic of excessive macroautophagy, and we used the fluorescent autophagy marker monodansylcadaverine (MDC [20]) to test for the induction of autophagy in efavirenz-treated HUVEC and EA.hy926 cells. Although the lipophilic MDC dye primarily stained early autophagosomes and did not stain the microscopically visible large late-stage autophagosomes, a conspicuous increase in overall MDC staining intensity was observed in both efavirenz-treated HUVEC and EA.hy926 cells (Fig. 2b, c), confirming the induction of autophagy by efavirenz. Autophagy could additionally be visualized by a commercially available autophagy marker, which, in contrast to monodansylcadaverine, also stained the conspicuously large vacuolar structures formed after treatment with elevated concentrations of efavirenz (Fig. 2d; arrows). Because cell stress can impair cell survival and cell proliferation even at low concentrations, we further tested the effect of a prolonged treatment of EA.hy926 cells with efavirenz. A standard MTT cell viability assay performed
123
Cardiovasc Toxicol Fig. 4 Efavirenz causes induction of unfolded protein response genes in endothelial cells. EA.hy926 cells were seeded in 6-well cell culture dishes (5 9 104 cells/well) and grown for 24 h before the administration of 0–10 lg/ml efavirenz. Cells were then either analyzed by Western blot analysis (a 24-h incubation with efavirenz) or by RT-PCR analysis (b 7-h incubation with efavirenz). Due to a variety of synonymous names used for heat-shock proteins, the official gene nomenclature for heatshock protein genes was used (http://genatlas.medecine.univparis5.fr/) and specific PCR primers against these sequences were designed. Representative immunoblots and PCR products are shown
A 0
B
EA.hy926 2
4
6
8
10 μg/ml EFV
hsp32 (HO-1) hsp70 hsp90α,β
EA.hy926 0
5
10
μg/ml EFV
HMOX1 (HO-1/hsp32) p53 HSPA1 (hsp72) HSPA4 (hsp70)
Bip/GRP78 p-p53 (Ser-15)
HSPA8 (hsc70) DNAJB1 (hsp40)
p53 HSPD1 (hsp60) PARP HSP90AA1 (hsp90α) eNOS HSP90B1 (GRP94) GAPDH β-actin
over 72 h revealed a gradual, concentration-dependent decrease in cell viability of EA.hy926 cells (Fig. 3a). The growth-inhibiting effects of efavirenz became more pronounced when a long-term treatment of EA.hy926 cells at low cell densities was performed with a clonogenic survival assay (Fig. 3b; 6-day incubation period). The cellular vacuolation observed in efavirenz-treated endothelial cells also resembled the ER stress-associated vacuolation induced by the HIV protease inhibitor nelfinavir in a variety of cell types [16, 21]. We therefore tested for the expression of markers of ER stress, oxidative stress, and the unfolded protein response in EA.hy926 cells treated with efavirenz by immunoblot and semiquantitative RT-PCR (Fig. 4). Because the standard peak serum concentrations of efavirenz are estimated to be approximately 4 lg/ml [6, 8], a concentration range of 0–10 lg/ml of efavirenz was used in these assays to span the large interindividual variations in serum efavirenz concentration caused by differences in CYP2B6 metabolism [22]. Figure 4a shows that expression of the oxidative stress marker heme oxygenase-1 (hsp32/HO-1/HMOX1), heat-shock protein hsp70, and the ER stress marker bip (GRP78) were increased at pharmacologically relevant efavirenz concentrations. The levels of constitutively expressed hsp90 and of endothelial nitric oxide synthase-1 (eNOS-1) remained unchanged. At concentrations of 4 lg/ml or greater, efavirenz also caused p53 upregulation and activation by phosphorylation at serine-15. However, the induction of apoptosis, as revealed by a slight, albeit not pronounced, PARP (poly-(ADP-ribose) polymerase) cleavage, was only observed at high concentrations of 10 lg/ml efavirenz and
123
appeared to be a minor event caused by efavirenz treatment. RT-PCR analysis of efavirenz-treated EA.hy926 cells confirmed the transcriptional upregulation of the inducible heat-shock protein hsp72 (HSPA1) and oxidative stress marker hsp32 (HO-1/HMOX1). Constitutively expressed heat-shock proteins, including hsc70 (HSPA8) and hsp90a (HSP90AA1), remained essentially unchanged (Fig. 4b), similar to the expression of housekeeping genes: GAPDH (glycerin aldehyde dehydrogenase) and b-actin. Efavirenz Generates Reactive Oxygen Species in EA.hy926 Cells To further confirm induction of oxidative stress by efavirenz, EA.hy926 cells were incubated with the oxidative stress probe dichlorofluorescein diacetate (DCFH-DA), which, after cellular deacetylation, is converted by reactive oxygen species (ROS) into green fluorescent dichlorofluorescein. Incubation of EA.hy926 cells with efavirenz revealed an increase in green fluorescence emission when tested with DCFH-DA and visualized either by fluorescence microscopy (Fig. 5a) or analyzed by FACScan analysis (Fig. 5b). To further test whether antioxidants could alleviate the effect of efavirenz on endothelial cells, EA.hy926 cells were treated with efavirenz in the presence of the antioxidant N-acetylcysteine and the flavonoid quercetin, a natural polyphenol with antioxidative properties. Analysis of cell survival revealed that N-acetylcysteine caused a slight, although statistically not significant protection against the cytotoxic effects of efavirenz (Fig. 5c). Treatment with quercetin, however, revealed no
Cardiovasc Toxicol
A
untreated
B
efavirenz 10 μg/ml
efavirenz 10 μg/ml
untreated
median = 2.0
cell counts
cell counts
median = 0.57
fluorescence
fluorescence
C
OD595 nm
+ NAC + Querc.
CON
EFV
EFV
EFV
Fig. 5 Induction of oxidative stress by efavirenz in EA.hy926 cells. EA.hy926 cells were treated for 24 h with 10 lg/ml efavirenz and incubated with the reactive oxygen species detection probe DCFHDA (dichlorofluorescein diacetate; Sigma, Munich, Germany) before analysis by a fluorescence microscopy (Zeiss Axiophot, Zeiss, Germany) or b FACScan analysis. The shift in the number of green fluorescence cells from untreated cells to efavirenz-treated cells indicates the generation of reactive oxygen species by efavirenz. FACScan analyses were repeated twice. c EA.hy926 cells were treated with 10 lg/ml efavirenz for 72 h in the presence or absence of 5 mM N-acetylcysteine (NAC) or 10 lM quercetin (Querc.), and analyzed by the MTT assay. No statistically relevant effect of Nacetylcysteine or quercetin on the viability of efavirenz-treated cells could be calculated
noticeable protective effects of this flavonoid against the cytotoxic effects of efavirenz (Fig. 5c). Efavirenz-Induced Oxidative Stress and Endoplasmic Reticulum Stress is Aggravated by Nelfinavir Since the HIV protease inhibitor nelfinavir has previously been shown to cause both oxidative stress and ER stress [16,
21, 23], we tested whether a combination of low concentrations of efavirenz and nelfinavir might result in the enhanced appearance of oxidative stress markers and ER stress markers. Western blot analysis revealed elevated expression of hsp32/HO-1 and the ER stress marker BiP in EA.hy926 cells treated with a combination of 4 lg/ml efavirenz and 4 lg/ml nelfinavir (Fig. 6a). Real-time RTPCR analysis confirmed enhanced expression of hsp32/HO1, HSPA1 at the transcriptional level, and the ER stressspecific splicing of XBP1 in EA.hy926 cells treated with the combination of efavirenz and nelfinavir (Fig. 6b–d). Elevated Concentrations of Efavirenz Plus Nelfinavir Induce Endothelial Cell Death and Pseudotube Disruption The combination of efavirenz with nelfinavir is not a standard combination prescribed for HIV-infected individuals, but enhanced oxidative stress and endoplasmic reticulum stress by efavirenz in combination with nelfinavir indicates that pro-oxidative drug combinations may aggravate endothelial dysfunction caused by efavirenz. Nelfinavir has recently been repurposed for cancer treatment due to its cytotoxic effect on breast cancer cells and xenografts when applied at elevated concentrations. Since neoangiogenesis is an important factor in cancer development, we further questioned whether nelfinavir, efavirenz, or a combination of both might have cytotoxic effects on endothelial cells. Indeed, whereas incubation of pseudotube-forming EA.hy926 cells with stress-inducing concentrations of either 10 lg/ml of efavirenz or 10 lg/ml of nelfinavir alone were apparently manageable by endothelial cells and did not result in observable immediate cytotoxic effects (Fig. 7), the combination of 10 lg/ml efavirenz with 10 lg/ml nelfinavir caused a strong cytotoxic effect, leading to the destruction of the endothelial meshwork formed by EA.hy926 cells (Fig. 7). Because EA.hy926 cells treated with both efavirenz and nelfinavir still exhibited a remaining fluorescence signal in the presence of the vital marker Calcein-AM (Fig. 7), it can be concluded that these cells retained viable functions and did not undergo unspecific cell death, but apparently lost their capacity of assembling and interaction with other endothelial cells.
Discussion Efavirenz has been associated with endothelial and cardiovascular dysfunction, as observed in vitro and experienced by clinical practice [12–14]. In monolayers of coronary artery cells, efavirenz was shown to induce oxidative stress and to increase vascular permeability [14].
123
Cardiovasc Toxicol Fig. 6 Efavirenz-induced endoplasmic reticulum stress is enhanced by nelfinavir. EA.hy926 cells were treated with either 4 lg/ml efavirenz (EFV), 4 lg/ml nelfinavir (NFV), or a combination of both (E ? N) and analyzed by Western blot analysis (a 24-h incubation) or quantitative realtime PCR analysis (b, c, d 7-h incubation) for the expression of oxidative stress and ER stress markers. Induction of gene expression was calculated by the 2-DDCt method, using bactin expression as a reference value. * = p \ 0.05. MTT assays were reproduced twice; Western blots show representative immunostainings
Induction of oxidative stress was also described for efavirenz-treated hepatocytes [11]. We showed here that pharmacologically relevant concentrations of efavirenz led to the generation of reactive oxygen species in human endothelial cells, associated with the induction of heat-shock proteins, ER stress, and autophagy. Moreover, these stressinducing effects of efavirenz on endothelial cells were demonstrated to be aggravated by a drug combination with nelfinavir. The ER is a highly redox-sensitive organelle, and ER stress often occurs as a consequence of oxidative stress generated by endogenous metabolism or by xenobiotics [24]. Excessive ER stress can further lead to autophagy, which helps to remove misfolded and aggregated proteins or superfluous or impaired regions of the ER [25]. Both ER stress and autophagy are cell-protective mechanisms, but they are also indicators of cellular stress or cell damage [25]. In our study, pronounced and immediate cell damage was observed in endothelial cells treated with high concentrations of efavirenz (C10 lg/ml). Similar observations have previously been made for the HIV protease inhibitor nelfinavir, whose tendency to cause subtoxic ER stress and autophagy was associated with side effects observed in chronically exposed HIV patients [16] and with cytotoxic effects when applied at the elevated concentrations required for its repurposed use in cancer treatment [16]. It is therefore notable that both efavirenz and nelfinavir may cause ER stress and that the combination of these two drugs resulted in elevated ER stress in endothelial cells even at the relatively low concentrations equivalent to those found in HIV-infected individuals. At further elevated concentrations, however,
123
the combination of efavirenz with nelfinavir caused pronounced cell damage in endothelial cells, as observed in our study. These high concentrations, which directly mediated cytotoxic effects in endothelial cells, are clearly above the virologically necessary concentrations for HIV suppression, but since nelfinavir is currently applied in dose-escalating phase I/II cancer studies based on its recently observed antitumoral effects, the combination of nelfinavir with efavirenz might be of interest for specific targeting of highly vascularized cancer subtypes. However, dose-finding xenograft models in which such effects on both cancer cell survival and tumor vascularization can be studied in vivo by histological means are needed to confirm whether the here demonstrated in vitro observations can be transferred to an in vivo situation. HIV drugs have long been known to have anticancer effects in AIDS patients, based on the observed reduction in the incidence of AIDS-related Kaposi’s sarcoma after the initiation of HIV medication in treatment-naı¨ve patients. Although this has primarily been ascribed to the reconstitution of immunological functions in HIV-infected individuals, a preferential cytotoxic effect of efavirenz against Kaposi’s sarcoma cells, which primarily originate from herpesvirus-bearing endothelia cells, may be assumed and might be worth to be analyzed in animal experiments or in humans by either retrospective or prospective clinical studies. Also, the proven ROS-generating effects of specific HIV drugs, including efavirenz, on various human tissue cell types, ranging from first-pass liver cells to cardiovascular endothelia, should be an incentive for animal and clinical
Cardiovasc Toxicol
fluorescence
NFV
EFV
untreated
light
be of clinical importance and could be prescreened in an in vitro system, similar to the one presented in this study. There is no doubt that the life-saving antiviral benefits of a HIV medication prevail over their undesired side effects, although the lifelong use of these drugs poses new health risks. Notably, HIV treatment first improves cardiovascular parameters in HIV-infected patients beginning with HIV medication, but long-term exposure with these drugs again appears to worsen endothelial function [4]. Considering that chronic exposure of endothelial cells to pharmacologically relevant efavirenz concentrations interferes with endothelial cell viability and, thus, with physiological epithelial function, a closer clinical monitoring of vascular and cardiovascular parameters might be necessary for HIV-infected individuals prone to vascular diseases, including persons with diabetes or age-related atherosclerosis. Acknowledgments The technical assistance of Martina Rahmeh (FACScan analysis) and Petra Burger (MTT assay) is gratefully acknowledged. We also thank Gabriele Multhoff (TU Munich, Germany) for kindly providing the EA.hy926 cell line.
EFV + NFV
Conflict of interests The authors declare that there is no conflict of interests regarding the publication of this paper.
Fig. 7 Combination of efavirenz with nelfinavir at elevated concentrations destroys pseudotubes formed by EA.hy926 cells. EA.hy926 cells were seeded in angiogenesis l-slides on Geltrex basement membrane matrix and, after 24-h incubation to allow tube formation, were treated for further 24 h with either 10 lg/ml of efavirenz, 10 lg/ ml of nelfinavir, or a combination of 10 lg/ml efavirenz with 10 lg/ ml nelfinavir. For better visualization of viable cells, cells were stained with fluorescent Calcein-AM vital stain before microscopical analysis. Experiments were repeated twice, and representative photomicrographs are shown
studies analyzing a possible health benefit of cytoprotective antioxidants for HIV-infected persons receiving antiviral medication. Endothelial cells are known to be highly sensitive to ROS, and it is believed that the interaction of ROS with endothelial cell-generated nitric oxide (NO) may be one of the reasons for the specific sensitivity and increased cardiovascular dysfunction observed in patients receiving HIV treatment-related drugs [4]. The exact mechanism by which efavirenz induces reactive oxygen species is still unknown, and the effect of the here tested antioxidants Nacetylcysteine and quercetin was found to be limited. The identification of antioxidants with specific activity against efavirenz-generated reactive oxygen species may therefore
References 1. de Gaetano Donati, K., Rabagliati, R., Iacoviello, L., & Cauda, R. (2004). HIV infection, HAART, and endothelial adhesion molecules: Current perspectives. Lancet Infectious Diseases, 4, 213–222. 2. Kovari, H., & Weber, R. (2011). Influence of antiretroviral therapy on liver disease. Current Opinion in HIV and AIDS, 6, 272–277. 3. Calza, L. (2012). Renal toxicity associated with antiretroviral therapy. HIV Clinical Trials, 13, 189–211. 4. Gresele, P., Falcinelli, E., Sebastiano, M., & Baldelli, F. (2012). Endothelial and platelet function alterations in HIV-infected patients. Thrombosis Research, 129, 301–308. 5. Fortin, C., & Joly, V. (2004). Efavirenz for HIV-1 infection in adults: An overview. Expert Review on Anti-Infectective Therapy, 25, 671–684. 6. Best, B. M., & Goicoechea, M. (2008). Efavirenz–still first-line king? Expert Opinion on Drug Metabolism and Toxicology, 4, 965–972. 7. Maggiolo, F. (2009). Efavirenz: A decade of clinical experience in the treatment of HIV. Journal of Antimicrobial Agents and Chemotherapy, 64, 910–928. 8. Rakhmanina, N. Y., & van den Anker, J. N. (2010). Efavirenz in the therapy of HIV infection. Expert Opinion on Drug Metabolism and Toxicology, 6, 95–103. 9. Bumpus, N. N. (2011). Efavirenz and 8-hydroxyefavirenz induce cell death via a JNK- and BimEL-dependent mechanism in primary human hepatocytes. Toxicology and Applied Pharmacology, 257, 227–234. 10. Gomez-Sucerquia, L. J., Blas-Garcia, A., Marti-Cabrera, M., Esplugues, J. V., & Apostolova, N. (2012). Profile of stress and toxicity gene expression in human hepatic cells treated with Efavirenz. Antiviral Research, 94, 232–241. 11. Apostolova, N., Gomez-Sucerquia, L. J., Alegre, F., Funes, H. A., Victor, V. M., Barrachina, M. D., et al. (2013). ER stress in
123
Cardiovasc Toxicol
12.
13.
14.
15.
16. 17.
18.
human hepatic cells treated with Efavirenz: Mitochondria again. Journal of Hepatology, 59, 780–789. Gupta, S. K., Shen, C., Moe, S. M., Kamendulis, L. M., Goldman, M., & Dube´, M. P. (2012). Worsening endothelial function with efavirenz compared to protease inhibitors: A 12-month prospective study. PLoS One, 7, e45716. Mondal, D., Pradhan, L., Ali, M., & Agrawal, K. C. (2004). HAART drugs induce oxidative stress in human endothelial cells and increase endothelial recruitment of mononuclear cells: Exacerbation by inflammatory cytokines and amelioration by antioxidants. Cardiovascular Toxicology, 43, 287–302. Jamaluddin, M. S., Lin, P. H., Yao, Q., & Chen, C. (2010). Nonnucleoside reverse transcriptase inhibitor efavirenz increases monolayer permeability of human coronary artery endothelial cells. Atherosclerosis, 208, 104–111. Edgell, C. J., McDonald, C. C., & Graham, J. B. (1983). Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proceedings of the National Academy of Sciences, USA, 80, 3734–3737. Bru¨ning, A. (2011). Analysis of nelfinavir-induced endoplasmic reticulum stress. Methods in Enzymology, 491, 127–142. Arnaoutova, I., George, J., Kleinman, H. K., & Benton, G. (2009). The endothelial cell tube formation assay on basement membrane turns 20: State of the science and the art. Angiogenesis, 12, 267–274. Aranda, E., & Owen, G. I. (2009). A semi-quantitative assay to screen for angiogenic compounds and compounds with angiogenic potential using the EAhy926 endothelial cell line. Biological Research, 42, 377–389.
123
19. Unger, R. E., Krump-Konvalinkova, V., Peters, K., & Kirkpatrick, C. J. (2002). In vitro expression of the endothelial phenotype: Comparative study of primary isolated cells and cell lines, including the novel cell line HPMEC-ST16R. Microvascular Research, 64, 384–397. 20. Niemann, A., Takatsuki, A., & Elsa¨sser, H. P. (2000). The lysosomotropic agent monodansylcadaverine also acts as a solvent polarity probe. Journal of Histochemistry and Cytochemistry, 48, 251–258. 21. Gills, J. J., Lopiccolo, J., Tsurutani, J., Shoemaker, R. H., Best, C. J., Abu-Asab, M. S., et al. (2007). Nelfinavir, a lead HIV protease inhibitor, is a broad-spectrum, anticancer agent that induces endoplasmic reticulum stress, autophagy, and apoptosis in vitro and in vivo. Clinical Cancer Research, 13, 5183–5194. 22. Sta˚hle, L., Mober, L., Svensson, J. O., & So¨nnerborg, A. (2004). Efavirenz plasma concentrations in HIV-infected patients: Interand intraindividual variability and clinical effects. Therapeutic Drug Monitoring, 26, 267–270. 23. Bru¨ning, A., Gingelmaier, A., Friese, K., & Mylonas, I. (2010). New prospects for nelfinavir in non-HIV-related diseases. Current Molecular Pharmacology, 3, 91–97. 24. Alfadda, A. A., & Sallam, R. M. (2012). Reactive oxygen species in health and disease. Journal of Biomedicine and Biotechnology, 2012, 936486. 25. Ryter, S. W., & Choi, A. M. (2013). Regulation of autophagy in oxygen-dependent cellular stress. Current Pharmaceutical Design, 19, 2747–2756.
Efavirenz Causes Oxidative Stress, Endoplasmic Reticulum Stress, and Autophagy in Endothelial Cells Marlene Weiß • Bernd Kost • Ingrid Renner-Mu¨ller Eckhard Wolf • Ioannis Mylonas • Ansgar Bru¨ning
•
Ó Springer Science+Business Media New York 2015
Abstract The non-nucleoside reverse transcriptase inhibitor efavirenz is a widely prescribed antiretroviral drug used in combined antiretroviral therapy. Despite being an essential and life-saving medication, the required lifelong use of HIV drugs has been associated with a variety of adverse effects, including disturbances in lipid metabolism and increased cardiovascular risk. Efavirenz belongs to those HIV drugs for which cardiovascular and endothelial dysfunctions have been reported. It is here shown that elevated concentrations of efavirenz can inhibit endothelial meshwork formation on extracellular matrix gels by normal and immortalized human umbilical vein cells. This inhibition was associated with an increase in oxidative stress markers, endoplasmic reticulum (ER) stress markers, and autophagy. Induction of ER stress occurred at pharmacologically relevant concentrations of efavirenz and resulted in reduced proliferation and cell viability of endothelial cells, which worsened in the presence of elevated efavirenz concentrations. In combination with the HIV protease inhibitor nelfinavir, both oxidative stress and ER stress became elevated in endothelial cells. These data indicate that pharmacologically relevant concentrations of efavirenz can impair cell viability of endothelial cells and that these effects may
M. Weiß B. Kost I. Mylonas A. Bru¨ning Molecular Biology Laboratory, Ludwig-Maximilians-University, Munich, Germany I. Renner-Mu¨ller E. Wolf Chair of Molecular Animal Breeding and Biotechnology, Gene Center, Ludwig-Maximilians-University, Munich, Germany A. Bru¨ning (&) Molecular Biology Laboratory, University Hospital Munich, Maistrasse 11, 80337 Munich, Germany e-mail: [email protected]
be aggravated by either elevated concentrations of efavirenz or by a combined use of efavirenz with other oxidative stress-inducing medications. Keywords Efavirenz Nelfinavir Endothelial cells Endoplasmic reticulum stress Oxidative stress
Introduction The advent of highly active antiretroviral drugs has saved the lives of millions of HIV-infected people. Concomitant targeting of different essential steps in the viral replication cycle by treatment with a combination of drugs, e.g., reverse transcriptase inhibitors and protease inhibitors, has proven to be an effective means to curb viral spread. However, the life-saving and life-prolonging benefits of these antiretroviral drugs have also led to more and more concerns about the possible risks and adverse effects of long-term HIV drug treatment, including liver and kidney damage and increased cardiovascular risk [1–4]. Since efficient HIV suppression has thus become a long-term social and medico-economic challenge of global importance, further development of antiretroviral drugs and identification of possible risk factors of the currently prescribed drugs is mandatory. Efavirenz (EFV) is a first-generation non-nucleoside reverse transcriptase inhibitor (NNRTI) and has been in use as a first-line regimen since its approval in 1998 [5–8]. Skin reactions (rash) and neuropsychiatric central nervous system disorders (dizziness, insomnia) are the most common side effects of efavirenz and other NNRTIs [5–8]. Efavirenz is not recommended as a medication for pregnant women since both clinical observations and animal
123
Cardiovasc Toxicol
experiments have indicated a teratogenic potential for efavirenz [5–8]. The cellular and molecular mechanisms leading to the observed side effects of efavirenz are poorly understood. In liver and hepatoma cells, efavirenz and its metabolites had been shown to induce oxidative stress, mitotoxicity, and autophagy when applied at elevated concentrations [9–11]. Pro-oxidative functions may also be responsible for the endothelial dysfunction and pro-atherosclerotic effects observed in efavirenz-treated individuals [12] and in isolated endothelial cells [13, 14]. Here, we show that efavirenz causes the induction of reactive oxygen species, associated with ER stress and autophagy in human umbilical vein cells, and reveal drug–drug interactions with nelfinavir that might aggravate the side effects of efavirenz on endothelial cells.
Materials and Methods Cells and Cell Culture Human umbilical vein endothelial cells (HUVEC) were purchased from Provitro (Berlin, Germany). Immortalized EA.hy926 endothelial cells [15] were kindly provided by G. Multhoff (University Hospital TU Munich, Radiation Oncology, Germany). HUVECs were maintained in a provided endothelial cell growth medium (Provitro, Berlin, Germany), and EA.hy926 cells were cultured in DMEM (Biochrom, Berlin, Germany), supplemented with 10 % bovine serum albumin (Biochrom, Berlin, Germany). For endothelial tube formation, cells were seeded in angiogenesis l-slides (Ibidi, Martinsried, Germany) at a density of 500 cells/well on GeltrexÒ basement membrane matrixcoated surfaces (10 ll GeltrexÒ/well; LifeTechnologies, Karlsruhe, Germany).
Reagents Efavirenz was bought from Bristol Myers Squibb, Munich, Germany, and recovered from 50-mg capsules by means of repeated ethanol extraction and speed-vac concentration (Eppendorf Concentrator 5301, Eppendorf, Hamburg, Germany). The efavirenz extract was finally dissolved in 1 ml of ethanol to obtain a stock solution of 50 mg/ml in ethanol. Nelfinavir mesylate was purchased from Sigma (Sigma, Munich, Germany) and kept as a stock solution of 50 mg/ml in ethanol. N-acetylcysteine and quercetin were also purchased from Sigma (Munich, Germany) and kept in 100 mM stock solution in PBS (N-acetylcysteine) or DMSO (quercetin), respectively. Chemo-Sensitivity Assay (MTT Assay) For cell viability analysis, 1 9 104 cells were seeded in 96-well cell culture plates and incubated for 72 h under cell culture conditions. Then, 20 ll of an MTT (3-(4,5-Dimethyl2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide, Sigma, Germany) stock solution (5 mg/ml PBS) in 200 ll of cell culture medium was added, and cells were further incubated for 1 h under cell culture conditions. The water-insoluble precipitate formed in adherent viable cells was dissolved in 100 ll of DMSO and analyzed by an ELISA reader at 595 nm. All MTT assays were performed in triplicate. Western Blot Analysis Cell lysates for immunoblot analysis were generated by solubilizing cells in RIPA buffer (Cellsignal, Hamburg, Germany); 20 lg of protein extracts (Bio-Rad Bradford Assay, Bio-Rad, Munich, Germany) were subjected to SDS–polyacrylamide gel electrophoresis (Bio-Rad Mini
Table 1 Primer pairs used in this study Genes
Forward primer (50 –30 )
Reverse primer (50 –30 )
HSPA1A
GTGACCTTCGACATCGATGCCAACG
CTGACCCAGACCCTCCCTTGGGAC
475
29/57
HSPA4
GAGGACCAGTATGATCATTTGG
GTCTGAATCCGAAGGCACAGCTG
336
32/57
HSPA5
GCTGTAGCGTATGGTGCTGC
ATCAGTGTCTACAAC TCATC
794
29/57
HSPA8
CAACCATGTCCAAGGGACCTG
CCAAGGTAGGCTTCTGCAATTTCC
412
25/57
HSP90AA1
AACTCAGCCTTTGTGGAACG
GTCTACTTCTTCCATGCGTG
687
29/57
HSP90B1
GGCTGTGGTGTCTCAGCGCC
CAGGATCCAAATGGTGAGAG
540
29/57
HSPD1
AGACAGAGTTACAGATGCCC
GAACATGCCACCTCCCATAC
466
29/57
HMOX1
GGCCGGATGGAGCGTCCGCAAC
CATGGCATAAAGCCCTGCAGC
870
29/57
DNAJB1
CAACGTGAACTTTGGCCGCTC
GTGGGGACGTTCACTGTGCAGC
399
29/57
TP53
TGGTAATCTACTGGGACGGA
GTCTGAGTCAGGCCCTTCTG
397
29/57
b-actin
GGAGAAGCTGTGCTACGTCG
CGCTCAGGAGGAGCAATGAT
366
29/57
Bp = calculated base pair length of PCR product; Tann = annealing temperature
123
PCR product (bp)
Cycles/Tann (°C)
Cardiovasc Toxicol
0
5
10
15
μg/ml EFV
15
μg/ml EFV
EA.hy926
HUVEC
A
0
5
10
HUVEC
EA.hy926
B
Fig. 1 Efavirenz inhibits pseudotube formation by endothelial cells. HUVEC and EA.hy926 cells were seeded in angiogenesis l-slides (Ibidi, Martinsried, Germany) at a density of 500 cells/well either on Geltrex basement membrane matrix-coated surfaces (LifeTechnologies, Karlsruhe, Germany) (10 ll Geltrex/well) (a) or on uncoated
plastic surfaces (b). Cells were allowed to adhere for 24 h before the medium was replaced by efavirenz-containing medium, and the cultures were then photographed after an additional 24-h incubation (a: 109 lens; b: 409 lens)
Protean II Cell; Bio-Rad, Munich, Germany). Proteins were transferred to PVDF membranes in a Bio-Rad Mini Protean II blotting chamber at 1 mA/cm2 membrane in 10 % methanol, 192 mM glycine, 25 mM Tris, pH 8.2. After blocking of membranes with 4 % nonfat milk powder in PBS-0.05 % Tween for 4 h, primary antibodies were applied in blocking buffer and incubated at 4 °C overnight. Antibodies against PARP, phospho-p53 (Ser-15), and eNOS were purchased from Cell Signaling Technology (NEB, Frankfurt, Germany). Antibodies against HSP70 (W27), HSP90a/b (F8), p53 (DO1), BiP (H-129), and GAPDH (0411) were purchased from Santa Cruz Biotech (Heidelberg, Germany). HO-1/HMOX1/hsp32 antibodies
(MAB3776) were purchased from RnD Systems (Darmstadt, Germany). Secondary, alkaline phosphatase (AP)coupled antibodies against the corresponding primary antibodies were purchased from Cell Signaling, Frankfurt, Germany. AP detection was performed by the chromogenic BCIP/NBT assay (Promega, Mannheim, Germany). PCR Analysis For RT-PCR analysis of heat-shock protein expression and XBP1 splicing, 5 9 105 EA.hy926 cells were seeded in 6-well cell culture plates and allowed to adhere for 24 h before drug application. Drug application was then
123
Cardiovasc Toxicol
B
EA.hy926 15 μg/ml EFV
untreated
10 μg/ml EFV
untreated
10μg/ml EFV
MDC
HUVEC
hase
A
EA.hy926 untreated
phase MDC
EA.hy926
C
untreated
D
phase
10 μg/ml EFV
autophagy
phase
autophagy
Fig. 2 Efavirenz induces autophagy. a High-magnification phasecontrast microscopy of EA.hy926 cells grown as monolayers on glass cover slips and treated with or without 15 lg/ml efavirenz for 24 h. b, c HUVEC and EA.hy926 cells were seeded in 8-well cell culture chambers (Millicell EZ slides; Millipore, Darmstadt, Germany) at a density of 5,000 cells/well and were allowed to adhere for 24 h. Cells were then incubated with 1 lg/ml MDC (Sigma, Munich, Germany) in cell culture medium for 15 min and examined under a fluorescence
microscope (409 lens, Zeiss Axiophot, Zeiss, Germany). Fluorescence and matching phase-contrast images are shown. d EA.hy926 cells were treated with efavirenz as in (c) and incubated with Cyto-ID Autophagy staining reagent (Enzo Life Sciences, Lo¨rrach, Germany) in cell culture medium for 30 min and examined under a fluorescence microscope. Arrows depict large intracellular vacuoles, assumed to represent late-stage autophagosomes formed under conditions of excessive autophagy
performed for additional 7 h to induce changes in mRNA expression. RNA preparation was performed with the RNA extraction kit (Macherey–Nagel, Du¨ren, Germany), and cDNA was generated with the MMLV reverse transcriptase system (Promega, Mannheim, Germany), according to the manufacturer’s recommendations. Primer pairs and PCR conditions are listed in Table 1. Real-time PCR analysis was performed by using GACAAGTGTCAAGAGGTCAT/CTG ACCCAGACCCTCCCTTGGGAC primers for HSPA1 and CAGCAACAAAGTGCAAGATTC/CATGGCATAAAGCC CTGCAGC primers for HMOX1 and iTaqTM Universal SYBRÒ Green Supermix (Bio-Rad, Munich, Germany) and the Applied Biosystems 7500 Fast Real-Time PCR System. XBP1 splicing analysis by real-time PCR using specific primers and probe was performed as previously described [16].
Cell Staining Assays
123
For the detection of autophagy, HUVEC or EA.hy926 cells were seeded on glass cover slips and allowed to grow and adhere under cell culture conditions for 24 h. Cells were then incubated with efavirenz for 24 h and incubated as viable cells for 15 min under cell culture conditions with 1 lg/ml of monodansylcadaverine (Sigma, Munich, Germany) in standard cell culture medium. Cells were then washed twice with cell culture medium and subjected as viable cells to fluorescence microscopy (Zeiss Axiophot, Zeiss, Germany). Staining for autophagy was also performed with the Cyto-ID Autophagy staining kit (Enzo Life Sciences, Lo¨rrach, Germany), as recommended by the supplier. Calcein-AM solution for viable cell staining (Sigma, Munich, Germany) was diluted 1:1,000 in cell
Cardiovasc Toxicol
Statistical Analysis
A 0.6
p ≤ 0.05
MTT analyses were performed in triplicate, and mean values ±SD were calculated. Statistical analysis (Mann– Whitney U test) was performed with the SPSS 21 program (IBM).
OD 595 nm
0.5 0.4 0.3 0.2 0.1
Results
0 0
2
4
6
8
10
Efavirenz Inhibits Tube Formation by Endothelial Cells
μg/ml efavirenz (72 h)
B
0
2
6
4
8
10
μg/ml efavirenz (144 h) Fig. 3 Efavirenz inhibits cell proliferation of endothelial cells. a EA.hy926 cells were seeded in triplicate in 96-well cell culture plates (1 9 104 cells/well) and analyzed after a 72-h incubation using the MTT assay. OD595: optical density at 595 nm. The assay was repeated twice. b EA.hy926 cells seeded at a low cell density in 6-well cell culture plates (5 9 103 cells/well) were treated with the indicated concentrations of 0–10 lg/ml efavirenz and incubated for 6 days under cell culture conditions. Cells grown on the plates were fixed with 80 % ethanol for 5 min and then stained with an aqueous solution of 0.5 % Coomassie Brilliant Blue (Sigma, Munich Germany). The assay was repeated twice
culture medium immediately before use und applied on cells for 20 min before microscopical analysis. FACScan Analysis Detection of reactive oxygen species (ROS) by FACScan analysis was by using the 20 ,70 -dichlorodihydrofluorescein diacetate substrate (DCFH-DA; Sigma, Munich, Germany). EA.hy926 cells were grown in 6-well cell culture chambers (250,000 cells/well) for 24 h under cell culture conditions and then treated with efavirenz or nelfinavir for 4 or 24 h. Cells were then incubated for 45 min with 1 lg/ml of DCFH-DA in cell culture medium under cell culture conditions, collected by trypsinization, and subjected to FACScan analysis (Beckman Coulter Epics XL-MCL flow cytometer; Beckman Coulter, Munich, Germany) by using a 575 nm filter for detection of green fluorescence.
Endothelial cells grown on extracellular matrix proteins are able to form pseudocapillary structures (‘‘pseudotubes’’ or ‘‘honeycombs’’) that can be used to study drug effects on endothelial cells in vitro [17–19]. Figure 1a shows that such mesh-like structures, formed by isolated human umbilical vein endothelial cells (HUVEC), were partly disrupted by efavirenz when applied at 10 lg/ml and were completely destroyed by efavirenz at concentrations of 15 lg/ml. Similar results were obtained using the immortalized HUVEC cell line EA.hy926 (Fig. 1a). When grown under standard cell culture conditions on glass cover slips, which led to a more adhesive phenotype, marked intracellular vacuolation was visible in EA.hy926 and HUVEC cells treated with concentrations of 10 and 15 lg/ml of efavirenz (Figs. 1b, 2). Partial detachment of cells also indicated the cytotoxic effects of efavirenz at these concentrations (Fig. 1b). Efavirenz Induces Endoplasmic Reticulum Stress and Autophagy in Endothelial Cells Extensive intracellular vacuolation is a morphological characteristic of excessive macroautophagy, and we used the fluorescent autophagy marker monodansylcadaverine (MDC [20]) to test for the induction of autophagy in efavirenz-treated HUVEC and EA.hy926 cells. Although the lipophilic MDC dye primarily stained early autophagosomes and did not stain the microscopically visible large late-stage autophagosomes, a conspicuous increase in overall MDC staining intensity was observed in both efavirenz-treated HUVEC and EA.hy926 cells (Fig. 2b, c), confirming the induction of autophagy by efavirenz. Autophagy could additionally be visualized by a commercially available autophagy marker, which, in contrast to monodansylcadaverine, also stained the conspicuously large vacuolar structures formed after treatment with elevated concentrations of efavirenz (Fig. 2d; arrows). Because cell stress can impair cell survival and cell proliferation even at low concentrations, we further tested the effect of a prolonged treatment of EA.hy926 cells with efavirenz. A standard MTT cell viability assay performed
123
Cardiovasc Toxicol Fig. 4 Efavirenz causes induction of unfolded protein response genes in endothelial cells. EA.hy926 cells were seeded in 6-well cell culture dishes (5 9 104 cells/well) and grown for 24 h before the administration of 0–10 lg/ml efavirenz. Cells were then either analyzed by Western blot analysis (a 24-h incubation with efavirenz) or by RT-PCR analysis (b 7-h incubation with efavirenz). Due to a variety of synonymous names used for heat-shock proteins, the official gene nomenclature for heatshock protein genes was used (http://genatlas.medecine.univparis5.fr/) and specific PCR primers against these sequences were designed. Representative immunoblots and PCR products are shown
A 0
B
EA.hy926 2
4
6
8
10 μg/ml EFV
hsp32 (HO-1) hsp70 hsp90α,β
EA.hy926 0
5
10
μg/ml EFV
HMOX1 (HO-1/hsp32) p53 HSPA1 (hsp72) HSPA4 (hsp70)
Bip/GRP78 p-p53 (Ser-15)
HSPA8 (hsc70) DNAJB1 (hsp40)
p53 HSPD1 (hsp60) PARP HSP90AA1 (hsp90α) eNOS HSP90B1 (GRP94) GAPDH β-actin
over 72 h revealed a gradual, concentration-dependent decrease in cell viability of EA.hy926 cells (Fig. 3a). The growth-inhibiting effects of efavirenz became more pronounced when a long-term treatment of EA.hy926 cells at low cell densities was performed with a clonogenic survival assay (Fig. 3b; 6-day incubation period). The cellular vacuolation observed in efavirenz-treated endothelial cells also resembled the ER stress-associated vacuolation induced by the HIV protease inhibitor nelfinavir in a variety of cell types [16, 21]. We therefore tested for the expression of markers of ER stress, oxidative stress, and the unfolded protein response in EA.hy926 cells treated with efavirenz by immunoblot and semiquantitative RT-PCR (Fig. 4). Because the standard peak serum concentrations of efavirenz are estimated to be approximately 4 lg/ml [6, 8], a concentration range of 0–10 lg/ml of efavirenz was used in these assays to span the large interindividual variations in serum efavirenz concentration caused by differences in CYP2B6 metabolism [22]. Figure 4a shows that expression of the oxidative stress marker heme oxygenase-1 (hsp32/HO-1/HMOX1), heat-shock protein hsp70, and the ER stress marker bip (GRP78) were increased at pharmacologically relevant efavirenz concentrations. The levels of constitutively expressed hsp90 and of endothelial nitric oxide synthase-1 (eNOS-1) remained unchanged. At concentrations of 4 lg/ml or greater, efavirenz also caused p53 upregulation and activation by phosphorylation at serine-15. However, the induction of apoptosis, as revealed by a slight, albeit not pronounced, PARP (poly-(ADP-ribose) polymerase) cleavage, was only observed at high concentrations of 10 lg/ml efavirenz and
123
appeared to be a minor event caused by efavirenz treatment. RT-PCR analysis of efavirenz-treated EA.hy926 cells confirmed the transcriptional upregulation of the inducible heat-shock protein hsp72 (HSPA1) and oxidative stress marker hsp32 (HO-1/HMOX1). Constitutively expressed heat-shock proteins, including hsc70 (HSPA8) and hsp90a (HSP90AA1), remained essentially unchanged (Fig. 4b), similar to the expression of housekeeping genes: GAPDH (glycerin aldehyde dehydrogenase) and b-actin. Efavirenz Generates Reactive Oxygen Species in EA.hy926 Cells To further confirm induction of oxidative stress by efavirenz, EA.hy926 cells were incubated with the oxidative stress probe dichlorofluorescein diacetate (DCFH-DA), which, after cellular deacetylation, is converted by reactive oxygen species (ROS) into green fluorescent dichlorofluorescein. Incubation of EA.hy926 cells with efavirenz revealed an increase in green fluorescence emission when tested with DCFH-DA and visualized either by fluorescence microscopy (Fig. 5a) or analyzed by FACScan analysis (Fig. 5b). To further test whether antioxidants could alleviate the effect of efavirenz on endothelial cells, EA.hy926 cells were treated with efavirenz in the presence of the antioxidant N-acetylcysteine and the flavonoid quercetin, a natural polyphenol with antioxidative properties. Analysis of cell survival revealed that N-acetylcysteine caused a slight, although statistically not significant protection against the cytotoxic effects of efavirenz (Fig. 5c). Treatment with quercetin, however, revealed no
Cardiovasc Toxicol
A
untreated
B
efavirenz 10 μg/ml
efavirenz 10 μg/ml
untreated
median = 2.0
cell counts
cell counts
median = 0.57
fluorescence
fluorescence
C
OD595 nm
+ NAC + Querc.
CON
EFV
EFV
EFV
Fig. 5 Induction of oxidative stress by efavirenz in EA.hy926 cells. EA.hy926 cells were treated for 24 h with 10 lg/ml efavirenz and incubated with the reactive oxygen species detection probe DCFHDA (dichlorofluorescein diacetate; Sigma, Munich, Germany) before analysis by a fluorescence microscopy (Zeiss Axiophot, Zeiss, Germany) or b FACScan analysis. The shift in the number of green fluorescence cells from untreated cells to efavirenz-treated cells indicates the generation of reactive oxygen species by efavirenz. FACScan analyses were repeated twice. c EA.hy926 cells were treated with 10 lg/ml efavirenz for 72 h in the presence or absence of 5 mM N-acetylcysteine (NAC) or 10 lM quercetin (Querc.), and analyzed by the MTT assay. No statistically relevant effect of Nacetylcysteine or quercetin on the viability of efavirenz-treated cells could be calculated
noticeable protective effects of this flavonoid against the cytotoxic effects of efavirenz (Fig. 5c). Efavirenz-Induced Oxidative Stress and Endoplasmic Reticulum Stress is Aggravated by Nelfinavir Since the HIV protease inhibitor nelfinavir has previously been shown to cause both oxidative stress and ER stress [16,
21, 23], we tested whether a combination of low concentrations of efavirenz and nelfinavir might result in the enhanced appearance of oxidative stress markers and ER stress markers. Western blot analysis revealed elevated expression of hsp32/HO-1 and the ER stress marker BiP in EA.hy926 cells treated with a combination of 4 lg/ml efavirenz and 4 lg/ml nelfinavir (Fig. 6a). Real-time RTPCR analysis confirmed enhanced expression of hsp32/HO1, HSPA1 at the transcriptional level, and the ER stressspecific splicing of XBP1 in EA.hy926 cells treated with the combination of efavirenz and nelfinavir (Fig. 6b–d). Elevated Concentrations of Efavirenz Plus Nelfinavir Induce Endothelial Cell Death and Pseudotube Disruption The combination of efavirenz with nelfinavir is not a standard combination prescribed for HIV-infected individuals, but enhanced oxidative stress and endoplasmic reticulum stress by efavirenz in combination with nelfinavir indicates that pro-oxidative drug combinations may aggravate endothelial dysfunction caused by efavirenz. Nelfinavir has recently been repurposed for cancer treatment due to its cytotoxic effect on breast cancer cells and xenografts when applied at elevated concentrations. Since neoangiogenesis is an important factor in cancer development, we further questioned whether nelfinavir, efavirenz, or a combination of both might have cytotoxic effects on endothelial cells. Indeed, whereas incubation of pseudotube-forming EA.hy926 cells with stress-inducing concentrations of either 10 lg/ml of efavirenz or 10 lg/ml of nelfinavir alone were apparently manageable by endothelial cells and did not result in observable immediate cytotoxic effects (Fig. 7), the combination of 10 lg/ml efavirenz with 10 lg/ml nelfinavir caused a strong cytotoxic effect, leading to the destruction of the endothelial meshwork formed by EA.hy926 cells (Fig. 7). Because EA.hy926 cells treated with both efavirenz and nelfinavir still exhibited a remaining fluorescence signal in the presence of the vital marker Calcein-AM (Fig. 7), it can be concluded that these cells retained viable functions and did not undergo unspecific cell death, but apparently lost their capacity of assembling and interaction with other endothelial cells.
Discussion Efavirenz has been associated with endothelial and cardiovascular dysfunction, as observed in vitro and experienced by clinical practice [12–14]. In monolayers of coronary artery cells, efavirenz was shown to induce oxidative stress and to increase vascular permeability [14].
123
Cardiovasc Toxicol Fig. 6 Efavirenz-induced endoplasmic reticulum stress is enhanced by nelfinavir. EA.hy926 cells were treated with either 4 lg/ml efavirenz (EFV), 4 lg/ml nelfinavir (NFV), or a combination of both (E ? N) and analyzed by Western blot analysis (a 24-h incubation) or quantitative realtime PCR analysis (b, c, d 7-h incubation) for the expression of oxidative stress and ER stress markers. Induction of gene expression was calculated by the 2-DDCt method, using bactin expression as a reference value. * = p \ 0.05. MTT assays were reproduced twice; Western blots show representative immunostainings
Induction of oxidative stress was also described for efavirenz-treated hepatocytes [11]. We showed here that pharmacologically relevant concentrations of efavirenz led to the generation of reactive oxygen species in human endothelial cells, associated with the induction of heat-shock proteins, ER stress, and autophagy. Moreover, these stressinducing effects of efavirenz on endothelial cells were demonstrated to be aggravated by a drug combination with nelfinavir. The ER is a highly redox-sensitive organelle, and ER stress often occurs as a consequence of oxidative stress generated by endogenous metabolism or by xenobiotics [24]. Excessive ER stress can further lead to autophagy, which helps to remove misfolded and aggregated proteins or superfluous or impaired regions of the ER [25]. Both ER stress and autophagy are cell-protective mechanisms, but they are also indicators of cellular stress or cell damage [25]. In our study, pronounced and immediate cell damage was observed in endothelial cells treated with high concentrations of efavirenz (C10 lg/ml). Similar observations have previously been made for the HIV protease inhibitor nelfinavir, whose tendency to cause subtoxic ER stress and autophagy was associated with side effects observed in chronically exposed HIV patients [16] and with cytotoxic effects when applied at the elevated concentrations required for its repurposed use in cancer treatment [16]. It is therefore notable that both efavirenz and nelfinavir may cause ER stress and that the combination of these two drugs resulted in elevated ER stress in endothelial cells even at the relatively low concentrations equivalent to those found in HIV-infected individuals. At further elevated concentrations, however,
123
the combination of efavirenz with nelfinavir caused pronounced cell damage in endothelial cells, as observed in our study. These high concentrations, which directly mediated cytotoxic effects in endothelial cells, are clearly above the virologically necessary concentrations for HIV suppression, but since nelfinavir is currently applied in dose-escalating phase I/II cancer studies based on its recently observed antitumoral effects, the combination of nelfinavir with efavirenz might be of interest for specific targeting of highly vascularized cancer subtypes. However, dose-finding xenograft models in which such effects on both cancer cell survival and tumor vascularization can be studied in vivo by histological means are needed to confirm whether the here demonstrated in vitro observations can be transferred to an in vivo situation. HIV drugs have long been known to have anticancer effects in AIDS patients, based on the observed reduction in the incidence of AIDS-related Kaposi’s sarcoma after the initiation of HIV medication in treatment-naı¨ve patients. Although this has primarily been ascribed to the reconstitution of immunological functions in HIV-infected individuals, a preferential cytotoxic effect of efavirenz against Kaposi’s sarcoma cells, which primarily originate from herpesvirus-bearing endothelia cells, may be assumed and might be worth to be analyzed in animal experiments or in humans by either retrospective or prospective clinical studies. Also, the proven ROS-generating effects of specific HIV drugs, including efavirenz, on various human tissue cell types, ranging from first-pass liver cells to cardiovascular endothelia, should be an incentive for animal and clinical
Cardiovasc Toxicol
fluorescence
NFV
EFV
untreated
light
be of clinical importance and could be prescreened in an in vitro system, similar to the one presented in this study. There is no doubt that the life-saving antiviral benefits of a HIV medication prevail over their undesired side effects, although the lifelong use of these drugs poses new health risks. Notably, HIV treatment first improves cardiovascular parameters in HIV-infected patients beginning with HIV medication, but long-term exposure with these drugs again appears to worsen endothelial function [4]. Considering that chronic exposure of endothelial cells to pharmacologically relevant efavirenz concentrations interferes with endothelial cell viability and, thus, with physiological epithelial function, a closer clinical monitoring of vascular and cardiovascular parameters might be necessary for HIV-infected individuals prone to vascular diseases, including persons with diabetes or age-related atherosclerosis. Acknowledgments The technical assistance of Martina Rahmeh (FACScan analysis) and Petra Burger (MTT assay) is gratefully acknowledged. We also thank Gabriele Multhoff (TU Munich, Germany) for kindly providing the EA.hy926 cell line.
EFV + NFV
Conflict of interests The authors declare that there is no conflict of interests regarding the publication of this paper.
Fig. 7 Combination of efavirenz with nelfinavir at elevated concentrations destroys pseudotubes formed by EA.hy926 cells. EA.hy926 cells were seeded in angiogenesis l-slides on Geltrex basement membrane matrix and, after 24-h incubation to allow tube formation, were treated for further 24 h with either 10 lg/ml of efavirenz, 10 lg/ ml of nelfinavir, or a combination of 10 lg/ml efavirenz with 10 lg/ ml nelfinavir. For better visualization of viable cells, cells were stained with fluorescent Calcein-AM vital stain before microscopical analysis. Experiments were repeated twice, and representative photomicrographs are shown
studies analyzing a possible health benefit of cytoprotective antioxidants for HIV-infected persons receiving antiviral medication. Endothelial cells are known to be highly sensitive to ROS, and it is believed that the interaction of ROS with endothelial cell-generated nitric oxide (NO) may be one of the reasons for the specific sensitivity and increased cardiovascular dysfunction observed in patients receiving HIV treatment-related drugs [4]. The exact mechanism by which efavirenz induces reactive oxygen species is still unknown, and the effect of the here tested antioxidants Nacetylcysteine and quercetin was found to be limited. The identification of antioxidants with specific activity against efavirenz-generated reactive oxygen species may therefore
References 1. de Gaetano Donati, K., Rabagliati, R., Iacoviello, L., & Cauda, R. (2004). HIV infection, HAART, and endothelial adhesion molecules: Current perspectives. Lancet Infectious Diseases, 4, 213–222. 2. Kovari, H., & Weber, R. (2011). Influence of antiretroviral therapy on liver disease. Current Opinion in HIV and AIDS, 6, 272–277. 3. Calza, L. (2012). Renal toxicity associated with antiretroviral therapy. HIV Clinical Trials, 13, 189–211. 4. Gresele, P., Falcinelli, E., Sebastiano, M., & Baldelli, F. (2012). Endothelial and platelet function alterations in HIV-infected patients. Thrombosis Research, 129, 301–308. 5. Fortin, C., & Joly, V. (2004). Efavirenz for HIV-1 infection in adults: An overview. Expert Review on Anti-Infectective Therapy, 25, 671–684. 6. Best, B. M., & Goicoechea, M. (2008). Efavirenz–still first-line king? Expert Opinion on Drug Metabolism and Toxicology, 4, 965–972. 7. Maggiolo, F. (2009). Efavirenz: A decade of clinical experience in the treatment of HIV. Journal of Antimicrobial Agents and Chemotherapy, 64, 910–928. 8. Rakhmanina, N. Y., & van den Anker, J. N. (2010). Efavirenz in the therapy of HIV infection. Expert Opinion on Drug Metabolism and Toxicology, 6, 95–103. 9. Bumpus, N. N. (2011). Efavirenz and 8-hydroxyefavirenz induce cell death via a JNK- and BimEL-dependent mechanism in primary human hepatocytes. Toxicology and Applied Pharmacology, 257, 227–234. 10. Gomez-Sucerquia, L. J., Blas-Garcia, A., Marti-Cabrera, M., Esplugues, J. V., & Apostolova, N. (2012). Profile of stress and toxicity gene expression in human hepatic cells treated with Efavirenz. Antiviral Research, 94, 232–241. 11. Apostolova, N., Gomez-Sucerquia, L. J., Alegre, F., Funes, H. A., Victor, V. M., Barrachina, M. D., et al. (2013). ER stress in
123
Cardiovasc Toxicol
12.
13.
14.
15.
16. 17.
18.
human hepatic cells treated with Efavirenz: Mitochondria again. Journal of Hepatology, 59, 780–789. Gupta, S. K., Shen, C., Moe, S. M., Kamendulis, L. M., Goldman, M., & Dube´, M. P. (2012). Worsening endothelial function with efavirenz compared to protease inhibitors: A 12-month prospective study. PLoS One, 7, e45716. Mondal, D., Pradhan, L., Ali, M., & Agrawal, K. C. (2004). HAART drugs induce oxidative stress in human endothelial cells and increase endothelial recruitment of mononuclear cells: Exacerbation by inflammatory cytokines and amelioration by antioxidants. Cardiovascular Toxicology, 43, 287–302. Jamaluddin, M. S., Lin, P. H., Yao, Q., & Chen, C. (2010). Nonnucleoside reverse transcriptase inhibitor efavirenz increases monolayer permeability of human coronary artery endothelial cells. Atherosclerosis, 208, 104–111. Edgell, C. J., McDonald, C. C., & Graham, J. B. (1983). Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proceedings of the National Academy of Sciences, USA, 80, 3734–3737. Bru¨ning, A. (2011). Analysis of nelfinavir-induced endoplasmic reticulum stress. Methods in Enzymology, 491, 127–142. Arnaoutova, I., George, J., Kleinman, H. K., & Benton, G. (2009). The endothelial cell tube formation assay on basement membrane turns 20: State of the science and the art. Angiogenesis, 12, 267–274. Aranda, E., & Owen, G. I. (2009). A semi-quantitative assay to screen for angiogenic compounds and compounds with angiogenic potential using the EAhy926 endothelial cell line. Biological Research, 42, 377–389.
123
19. Unger, R. E., Krump-Konvalinkova, V., Peters, K., & Kirkpatrick, C. J. (2002). In vitro expression of the endothelial phenotype: Comparative study of primary isolated cells and cell lines, including the novel cell line HPMEC-ST16R. Microvascular Research, 64, 384–397. 20. Niemann, A., Takatsuki, A., & Elsa¨sser, H. P. (2000). The lysosomotropic agent monodansylcadaverine also acts as a solvent polarity probe. Journal of Histochemistry and Cytochemistry, 48, 251–258. 21. Gills, J. J., Lopiccolo, J., Tsurutani, J., Shoemaker, R. H., Best, C. J., Abu-Asab, M. S., et al. (2007). Nelfinavir, a lead HIV protease inhibitor, is a broad-spectrum, anticancer agent that induces endoplasmic reticulum stress, autophagy, and apoptosis in vitro and in vivo. Clinical Cancer Research, 13, 5183–5194. 22. Sta˚hle, L., Mober, L., Svensson, J. O., & So¨nnerborg, A. (2004). Efavirenz plasma concentrations in HIV-infected patients: Interand intraindividual variability and clinical effects. Therapeutic Drug Monitoring, 26, 267–270. 23. Bru¨ning, A., Gingelmaier, A., Friese, K., & Mylonas, I. (2010). New prospects for nelfinavir in non-HIV-related diseases. Current Molecular Pharmacology, 3, 91–97. 24. Alfadda, A. A., & Sallam, R. M. (2012). Reactive oxygen species in health and disease. Journal of Biomedicine and Biotechnology, 2012, 936486. 25. Ryter, S. W., & Choi, A. M. (2013). Regulation of autophagy in oxygen-dependent cellular stress. Current Pharmaceutical Design, 19, 2747–2756.
