Cell, Vol. 70, 477-499,

August

7, 1992, Copyright

0 1992 by Cell Press

Drl , a TATA-Binding Protein-Associated Phosphoprotein and Inhibitor of Class II Gene Transcription Juan A. Inostroza, Fred H. Mermelstein, llho Ha, William S. Lane,* and Danny Reinberg Department of Biochemistry Robert Wood Johnson Medical School University of Medicine and Dentistry of New Jersey Piscataway, New Jersey 08854-5635

Summary We havediscovered a protein termed Drl that interacts with the TATA-binding protein, TBP. The association of Drl with TBP results in repression of both basal and activated levels of transcription. The interaction of Drl with TBP precludes the formation of a transcriptioncompetent complex by inhibiting the association of TFIIA and/or TFIIB with TBP. Drl activity is associated with a 19 kd protein. A cDNA clone encoding Drl was isolated. Drl is phosphorylated In vivo and phosphorylation of Drl affected its interaction with TBP. Our results suggest a regulatory role for Drl in repression of transcription mediated via phosphorylation. Introduction Two functionally distinct classes of DNA elements constitute class II promoters. Common promoter elements represent one class that are present in most RNA polymerase II-transcribed genes and include the TATA and initiator motifs. The other class of DNA elements includes short DNA sequences that provide recognition sites for specific DNA-binding proteins that can activate or repress transcription of specific genes by communicating, directly or indirectly (DNA-mediated), with factors operating through common promoter elements (Mitchell and Tjian, 1989; Johnson and McKnight, 1989; Lewin, 1990). The common promoter elements are recognized by the general transcription factors, a complex set of factors required for transcription of all class II genes (Zawel and Reinberg, 1992). The association of the general transcription factors with promoter sequences is an ordered process in which TFIID first associates with the TATA motif and provides a recognition site for association of the other factors (TFIIA, -86, -IIE, -IIF, -IIH, and -IIJ) and RNA polymerase II (Flores et al., 1992; for a review see Zawel and Reinberg, 1992). Initial studies with the TATA-binding protein, TBP, demonstrated that the activity eluted from gel filtration columns with a mass larger than 100 kd (Reinberg et al., 1987). Isolation of cDNA clones encoding this activity revealed the unexpected result that TBP was contained in a single polypeptide of 38 kd (Peterson et al., 1990; Kao et al.,

‘Present address: Harvard Microchemistry sity, Cambridge, Massachusetts 02138.

Facility,

Harvard

Univer-

1990; Hoffmann et al., 1990). More importantly, these studies demonstrated that the recombinant protein, while capable of participating in basal transcription, was unable to mediate the response to activators (Pugh and Tjian, 1990). These studies have shown that TBP exists in higher eukaryotes in a multiprotein complex (Pugh and Tjian, 1991; Gill and Tjian, 1992). A large number of polypeptides that interact with TBP have been described. More importantly, it has been demonstrated that some of the TBPassociated factors (TAFs) can mediate the response to specific activators (Pugh and Tjian, 1991; Tanese et al., 1991; Gill and Tjian, 1992). Also, recent studies have demonstrated that some of the TAFs regulate promoter specificity, as TBP was found, in association with three other TAFs, to participate in transcription of RNA polymerase l-transcribed genes that lack a TATA motif (Comai et al., 1992). TBP is a 38 kd polypeptide, yet we know of more intermolecular interactions involving TBP than are physically possible for a poiypeptide of that size. To accommodate all of these interactions, the assortment of proteins that exist in a complex with TBP in vivo must constantly be in flux. Consistent with this viewpoint, Timmers and Sharp (1991) have shown that TBP exists in HeLa cell extracts in at least two multiprotein complexes with distinct physical and biochemical characteristics. To distinguish between the endogenous, heterogeneous, high molecular weight protein complexes containing TBP from free TBP (recombinant), the former is referred to as TFIID and the latter as TBP. Regulation of gene expression is a complex process that can be achieved in multiple steps. Studies have demonstrated that initiation of transcription is a primary site for regulation (Lewin, 1990; Zawel and Reinberg, 1992). A great deal of effort has been directed toward the isolation of proteins that activate transcription (Mitchell and Tjian, 1989). However, an equally important mechanism for regulating gene expression is repression. Studies have described factors, Id (Benezra et al., 1990), IKB (Baeuerle and Baltimore, 1988) and others, that repress transcription of specific genes by sequestering site-specific DNAbinding proteins. Other repressors affect transcription by directly recognizing specific DNA sequences present in some genes. Also, factors interacting with TBP and repressing basal transcription have been described such as NC1 and NC2 (Meisterernst and Roeder, 1991; Meisterernst et al., 1991). We have isolated a 19 kd protein from HeLa cells, Drl , that interacts with TBP. This interaction did not affect the association of TBP with its target DNA site, but prevented the association of TBP with the other general transcription factors. The association of Drl with TBP was shown to result in a functional repression of both activated and basal transcription. Using reverse genetics a human cDNA clone encoding Drl was isolated. We found Drl to be a phosphoprotein and, more importantly, that phosphorylation of Drl regulated its interaction with TBP.

Cell

478

Results Drl, a TBP-Associating Protein We have detected a protein, Drl, present in HeLa cell extracts that can associate with TBP. The addition of Drl to DNA binding assays containing the adenovirus major late promoter (Ad-MLP) and recombinant yeast TBP (yTBP) resulted in the formation of different DNA-protein complexes (Figure lA, lane 3, and Figure lC, lane 3). Neither TBP nor Drl could independently produce complexes with DNA under the conditions used in the assay (Figure 1 A, lanes 1 and 2, respectively). The addition of antibodies against yTBP resulted in a decrease in the amount of complex and in the formation of slower migrating complexes on a native gel (supershift), demonstrating both the presence of TBP in the complex and a requirement for TBP in D-Drl complex formation (Figure 1A, lanes 5 and 6). The preimmune serum was without effect (Figure 1A, lane 4). Consistently, the formation of TBPDrl complexes was competed by the addition of a molar excess of an oligonucleotide containing a wild-type TATA motif, but not by an oligonucleotide containing a mutated TATA motif (Figure 1B). TBP-Drl DNA-protein complexes could be formed on different TATA motifs (Figure 1 C). At least four different DNA-protein complexes could be observed and each migrated differently than the complex formed by association of TBP and TFIIA on the TATA motif (Figure 1C). Drl could form complexes with yTBP and human TBP (hTBP) and with TFIID isolated from HeLa cells (hTFIID) (Figure 1D). The recombinant TBPs, in the absence of Drl , failed to produce stable complexes. However, TFIID was capable of producing a DNA-protein complex (Figure lD, lane 6). This result is consistent with previous studies demonstrating that TFIID, which is partially purified, is a large protein complex containing TFIIA (Maldonado et al., 1990) and other TAFs (Pugh and Tjian, 1991; Tanese et al., 1991; Gill and Tjian, 1992). Interestingly, Drl with TFIID produced two complexes, one migrating faster and one slower than the complex observed with TFIID alone (compare lanes 6 and 10); neither of these complexes migrated with complexes formed with hTBP (compare lanes 9 and 10). Thus, Drl is a cellular factor capable of interacting with hTBP and yTBP. This interaction takes place in solution (in the absence of DNA; data not shown; see Figure 88) and promotes the stable association of TBP to the TATA motif. Drl Activity Is Contained in a 19 kd Polypeptide Using the gel mobility shift assay, Drl was purified to apparent homogeneity as described in Experimental Procedures. The most purified fraction was composed of polypeptides of 19 and 34 kd (Figure 2A, lane 1). These two polypeptides were separated by reverse-phase chromatography (RPC) (lanes 2 and 3), and the proteins were renatured and assayed for Drl activity. We found Drl activity to be contained in the 19 kd polypeptide (Figure 26, lane 4). The 34 kd polypeptide was unable to produce any DNA-protein complex and did not affect the association of Drl with TBP (Figure 28, lanes 5 and 6, respectively). The native molecular mass of Drl was estimated to be

A

B

TATA TATA ; oliqo j mutant I i/5 ION/5 102 /

r. -DDr,

. .

-DDr,

. WY

-DDr,

-DOr,

I23456

C

D

,23456769!01112

Figure 1. Drl Binds in a TBP-Dependent of Different Class II Promoters

Fashion

to the TATA

Motif

DNA binding reactions were performed as previously described (Maldonado et al., 1990) and DNA-protein complexes analyzed using the gel mobility shift assay. (A) Binding reactions were performed using a 3’end-labeled DNA fragment containing Ad-MLP (- 40 to +15), yTBP (40 ng, S-Sepharose fraction), and/or Drl (micro Mono S. 30 ng), and antibodies against yTBP (Maldonado et al., 1990) as indicated in the panel. The D-Drl complexes are indicated on the side of the panel. The dots denote DDrl complexes formed in the presence of anti-yTBP antibodies (supershifted D-Drl complexes). (E) D-Drl DNA-protein complexes were formed on Ad-MLP in the presence of different amounts of an oligonucleotide containing either the wild-type Ad-MLP TATA motif (5’-TATAAAA-3’) or a mutated TATA motif (S’GAGACCC-3’) as indicated. Proteins were as in (A). Different complexes are indicated on the side of the panel. (C) D-Drl or DA complexes (TFIIA was derived from the DEAE-SPW protein fraction, 1.5 Kg; Maldonado et al., 1990) were formed on DNA fragments containing either the Ad-MLP (- 40 to +15, TATAAAA), the adenovirus polypeptide IX (- 55 to +65, TATATAA), or the adenovirus E4 (- 40 to +60, TATATAC) promoters, as indicated. The Drl protein fraction (40 ng) was derived from the Mono S micro column (see Figure 2A). The numbers on the side of the panel indicate the different complexes (l-4 denote complexes formed on Ad-MLP; l’-4’ denote complexes formed on a DNA fragment containing the TATA motif of the adenovirus polypeptide IX promoter. The numbers with broken lines denote complexes formed on the adenovirus E4 promoter). (D) D-Drl complexes were formed on Ad-MLP using yTBP (20 ng), hTBP (20 ng), or partially purified TFIID from HeLa cells (1.6 pg, TSK phenyl fraction; Maldonado et al., 1990) as indicated. Approximately 30% of the hTBP protein was proteolyzed; thus the faster migrating complexobserved with hTBP may reflect complexes of Drl with proteolyzed hTBP.

Drl, 479

Inhibitor

of Class

II Gene Transcription

A

?TBP,, or I -1-jr--1 5 I1012014020 yTBP(np)I -~20/40~80~~0+/++40 *(D I23

4

5 6

7

8

9

IA ,, 16 ,&ElF/W~‘cj~ 2x 4x 2x.x

80 M

1011

6 hIID

2462-4622

hlBP(nd rTBPlnpl

20 -

or Ing) I

5

5 1020405-20405

- - - 5 IO 20- - - - - 5 IO 202 3 4 5 6 7 8 9 IO II 12 I3 I4 I5 I6 I7 18 1920212223 +ACF +Go14 AH or-2 b-1

I24 124

I

Figure in a 19 kd Polypeptide

and Exists in Solu-

(A) Silver staining of an SDS-polyacrylamide gel containing Drl derived from the last step of purification (Mono S, lane 1) and fractions from the RPC step (lanes 2 and 3). (B) Fractions derived from the RPC step and containing the 19 or 34 kd polypeptides were renatured as described (lnostroza et al., 1991) and assayed using yTBP and a DNA fragment containing Ad-MLP in a DNA binding assay. Input is the Drl Mono S micro column protein fraction prior to fractionation by RPC. Lanes labeled 19 (10 WI), 34 (10 ~1). and 19+34 (5 WI each) received the renatured polypeptide as indicated. (C) Drl derived from the RPC step was fractionated on a Superose S-200 micro column using the SMART System. Different fractions were assayed for Drl activity as described in (B). The numbers at the top of the panel denote the elution position of different molecular weight markers. (D) Time course of Drl (RPC step, 30 ng)-yTBP complex formation on Ad-MLP. Mixtures were incubated for different periods of time, as indicated at the bottom of the panel. Four complexes, labeled l-4, were formed containing both yTBP and Drl. The last lane (60 min) represents a binding reaction in the absence of yTBP.

approximately 90 kd by gel filtration chromatography (Figure 2C). Interestingly, the association of Drl with TBP could produce four different DNA-protein complexes (Figure 2C and above). The formation of the slower migrating complexes was dependent on both the concentration of (Figure 2C and data not shown) as well as the time of incubation (Figure 2D). It is possible that Drl exists in solution as a homotetramer that dissociates during interaction with TBP and then, after complexing with TBP, reassociates at a slow rate, to reconstitute the tetramer. Drl Is a Repressor of Transcription Different proteins affecting transcription have been shown to interact with TBP such as TFIIA (Cartes et al., 1992), the acidic activator VP16 (Stringer et al., 1990), TAFs (Pugh and Tjian, 1991; Tanese et al., 1991; Gill and Tjian, 1992), and Ela (Horikoshi et al., 1991; Lee et al., 1991), among other partially purified fractions (Meiesterenst et al., 1991; Meisterenst and Roeder, 1991). Thus, we ana-

3. Drl

IO 20

IO 20

C

Figure 2. Drl Is Contained tion as a Homotetramer

12131415161718

Inhibits

2

3456789

Transcription

from Ad-MLP

(A) Transcription reaction mixtures containing Ad-MLP were reconstituted using purified general transcription factors, RNA polymerase II, and different amounts of yTBP and/or Drl, as indicated. 2 x and 4 x indicate reactions receiving 2- or 4-fold excesses of the amounts of the general transcription factor required to reach saturation. Factors added were as follow: TBPs, as indicated on the panel, rTFllB (15 ng, phosphocellulose fraction; Haet al., 1991), RNA polymerase II (22 ng, DEAEdPW; Lu et al., 1991). TFIIE (30 ng, Sephacryl 200; lnostroza et al., 1991), TFIIF (35 ng, TSK phenyl-Superose; Flores et al.. 1992), TFIIH (42 ng, hydroxylapatite; Flores et al., 1992), TFIIA (120 ng, hy droxylapatite; Flores et al., 1992), TFIIJ (0.27 ug, phenyl-Superose; Flores et al., 1992). (B) Transcription reaction mixtures were as described above, but contained hTBP or HeLa TFIID in addition to Drl, as indicated. (C) Transcription reaction mixtures as described above containing HeLa purified TFIID and Ad-MLP with (plus signs) and without (minus signs) five Gal4 DNA-binding sites. Lanes 2-9 represent transcription reactions containing Gal4-AH (1.6 pmol) and/or ACF (0.6 pg), as indicated. Reaction mixtures also contained different amounts of Drl or Dr2 (in ng x lo), as indicated.

lyzed the effect of Drl on transcription and have found that the addition of increasing amounts of Drl to an assay reconstituted with Ad-MLP and purified general transcription

factors

resulted

in inhibition

(Figure

3A, compare

lane

2 with lanes 5-8). The extent of inhibition was proportional to the ratio of TBP and Drl added to the assay. An approximately 1:l ratio (20 ng each of Drl and yTBP) resulted in approximately 90% inhibition (compare lane 2 with 7). However, when the ratio of TBP to Drl was 2:1, either by decreasing the concentration of Drl (lane 6,20 ng of TBP and 10 ng of Drl) or increasing the concentration of TBP (lane 9, 40 ng of TBP and 20 ng of Drl), approximately 50% inhibition was observed (compare lane 2 with lane 6, and lane 3 with lane 9, respectively). When the ratio of TBP to Drl was increased to 4:l (lane 10, 80 ng of TBP and 20 ng of Drl), inhibition was overcome. Under these conditions, transcription approached levels similar to those observed in the absence of Drl (compare lane 4 with lane 10). This result is in agreement with the observation that, under our assay conditions, 40 ng of yTBP was sufficient to reach maximal levels of transcription (see lanes

Cell 480

2-4). Thus, reactions containing 80 ng of TBP (lanes 4 and 10) were sufficient to neutralize Drl (20 ng in the assay, lane 10) as well as to direct transcription from Ad-MLP. Inhibition by Drl could not be overcome by increasing the concentration of TFIIA, the other general transcription factors, or RNA polymerase II (lanes 11-17). Thus, these results demonstrate that Drl inhibited transcription by sequestering TBP. Similar results were observed when hTBP (Figure 38, lanes 2-13) or TFIID (Figure 38, lanes 14-23) was used instead of yTBP. Interestingly, inhibition of transcription by Drl in reactions reconstituted with TFIID was not complete and some residual activity remained, even when the concentration of Drl was increased (Figure 3B; data not shown). A possible explanation is that the TFIID protein fraction, which is partially purified and in a complex with different polypeptides (Pugh and Tjian, 1991; Tanese et al., 1991) contains a factor(s) that regulates Drl activity. Next, we analyzed whether Drl-mediated repression of transcription could be overcome by the strong acidic activator Gal4-AH (Lin et al., 1988). Optimal activation of transcription using the reconstituted system requires, in addition to the general transcription factors, human native TFIID and Gal4-AH, two other protein fractions. One of these activities, ACF (activating cofactor), appears to be a mediator and may be similar to the USA fraction described by Meisterernst et al. (1991), (A. Merino and D. Ft., unpublished data). The other activity, Dr2, is a 67 kd polypeptide and repressor of basal transcription (A. Merino and D. Ft., unpublished data). Addition of Gal4-AH to a transcription reconstituted system resulted in a modest stimulation of transcription of a DNA template containing GalCbinding sites, but was without effect on a DNA template lacking the Gal4 recognition site (Figure 3C, compare lanes 1 and 2). Addition of ACF resulted in stimulation of transcription of the template containing the Gal4binding sites (lane 3). This effect by ACF was dependent on the presence of Gal4-AH (data not shown; A. Merino and D. Ft., unpublished data) and on the Gal4 DNA-binding sites (lane 3, compare plus and minus signs). Addition of increasing amounts of Drl to a transcription assay con-

A

taining saturating amounts of Gal4-AH and ACF resulted in repression of transcription (Figure 3C, lanes 4-6). On the other hand, addition of Dr2 resulted in stimulation of activated transcription (lanes 7-9, template denoted by plus signs) and suppression of basal transcription (Figure 38, compare lanes 1 and 9). The presence of Dr2 was without effect on the repressing ability of Drl (data not shown). Thus, the repressing effect of Drl cannot be overcome by an acidic activator. Drl Precludes the Interaction of TBP with the General Transcription Factors The molecular mechanism(s) by which Drl inhibits transcription is currently unknown. However, one possibility is that Drl , by interacting with the TBP, prevents the assembly of the other general transcription factors into a transcription-competent complex. Previous studies have demonstrated that an early intermediate in the formation of a transcription complex is the association of TBP and TFIIA (DA complex) with the promoter (Reinberg et al., 1987; Buratowski et al., 1989; Maldonado et al., 1990). Therefore, we next analyzed the effect of Drl on the DA complex. The DA complex was formed on a DNA fragment containing Ad-MLP and separated from free TBP and TFIIA by molecular exclusion. The addition of increasing amounts of Drl to isolated DA complexes resulted in the dissociation of this complex with the concomitant appearance of D-Drl complexes migrating similar to complexes formed in the presence of yTBP and Drl, but in the absence of TFIIA (Figure 4A, compare lanes 6 and 7). The disappearance of the DA complex and appearance of D-Drl complexes were proportional to the amount of Drl added to the assay. The presence of 40 ng of Drl resulted in inhibition of approximately80% of the DAcomplex (lane 5), with 80 ng of Drl completely displacing TFIIA from the DA complex (lane 6) and concomitantly forming D-Drl complexes (compare lane 6 with lane 7). The effect of Drl on the DA complex was also analyzed by DNAase I footprinting. Previous studies have demonstrated that the association of TFIIA with the TBP-TATA motif complex results in protection from the DNAase I cleavage of nucleo-

Figure

B DA Drhq)

-

5

IO 20 40

yTBPtng1

I

,&A 1 YTBP -

SO40 40

1 +

--+--I++-+ +

+

+

-lO-

-3 -2 -0/l

iy I234567

..:j .,,;,#A* .’ :’

r

P 2 T 0 -3aa-

I

-5oG+A

I

2

3

4

5

6

4. Drl

Dissociates

the DA Complex

(A) The DA complex was formed on Ad-MLP and separated from unbound yTSP and TFIIA by chromatography on a Sephacryl S-l 000 column. Purified DA complex, which was recovered in the excluded volume, was incubated with different amounts of Drl, as described on the figure. Products of the reaction were separated by electrophoresis on a native polyacrylamide gel. Lane 1 contains isolated DA complex in the absence of Drl. Lane 7 contains products of reactions with Drl and yTBP. (B) The effect of Drl (40 ng) on the DA complex formed on the Ad-MLP was analyzed by DNAase I footprinting. Additions were as indicated on the top of the panel.

Drl, 481

Inhibitor

of Class

II Gene

Transcription

TCGMTTCCGGMGCCGCTCCCGACACCCTTTGCCTGGCTCTGTCCATATTAGTTCCCAG GCGGCCGTCGCGTTCCAGCAGCGGCACGCAGCGCAGGCGGAGCGGCAGCGGGGCCTCGGC TCTATAGAGCCGAGCCGCTGGTACCCGCCCGGTACCGCGC~GA~CAGT~CCCTGGATCT TGCCTCTGCTCCGACGCCGTTCCCCACCAGTTAGCGACAGAGA CACGMGGTGGTTCCCCAGCCGCTClUATTTTCCAC CTGGGCTGTGCTCTCTCTAGAATCCTCCTCG~CCCCACTTTCTTCCC~CTCATCCT~ TCTCTCACACACGCGAGTGTTCCCAGCCCTCAAGCCAGCCAGCT~TCCTCCTCCGTTCATTTT CTGCCCCTCTTCGCAAAGCACCCCCGGGATCATCCTCCGAGGGCGACTTTTTGAG~TC TCGGTGGAGTAGTGGACCAGAGCAGGGGAGTTTTTIUMGCCGGGGCGCGAGAAACAGGA AGGTACTATGGCTTCCTCGTCTGGCAACGATGATGATGATCTCACTATCCCCAGA~TGCTAT M A SSSGNDDDLTIPRAAI

60 120

180 240

300 360 420 480 540 600

Figure coding

5. Nucleotide hDr1

Sequenceof

a cDNA

En-

The sequence is listed using the single-letter amino acid code. For details see Experimental Procedures.

la

CAATAAAATGATCAAAGAGACTCTTCCTMTGTGT N K&IKETLPNVSVANDAREL

660 38

GGTGGTGMCTGCTGCACTGAATTCATTCATTCACCTTATATCTTCTG~~CMTGAGATTTG V V N C CTEFIHLIS SEANEIC

720 58

TMCAAATCGGAAAAGMGACCATCTCACCAGAGCATGTCTTT NKSEKKbTISPEHVIOALESL

780

GGGATTTGGCTCTTACATCAGTGMGTAMAGMGTCTTGCMGAG~GTAAMCAGTAGC &EGSYISEVKEVLQECKTVA

a40 98

ATTAAAAAGMGMAGGCCAGTTCTCGTTTGGAAAACCTTGGCATTCCTGMGMGAGTT LKRRc~ASSSLENLGIPEEE~

900 118

78

lATTGAGACAGCAACMGAATTATTTGCI#iAAGCTAGACAGCAACAAGCAGMTTGGCCCA LROOOELEAKAR~OOOAELAQ

960 138

2

ACAGGAATGGCTTCAAATGCAGCAAGCTGCCCAACAACXCCAGCTTGCTGCTGCCTCAGC 0 E W L 0 M 0 0 AA0 0 AD LAAA

1020

S

A

158

CAGTGCATCTMTCAGGCGATCTTCTCAGGATGAAGAA SASNQAGSSQDEEDDDDI'

lOa 176

TTCACCAGCTGAGTTTCTATTTCTTCTATAAATGTTTTTCCCT~ACMC~CAGTG AAAGMATGCTTATCTGTMTTTTGTATGCATCTTGGTGGACTTGTCATTGGTATTCTAG AGATGTCTGCTATMGTTTCATCTGTTGTGTGCTATATACATGT~CTGTCTCTTTGM CTATTGAAMTTTMGGTTCAGTATMTATCMTTTTGMTTTTTMT~TGTTTATGM ATTTTAGATAGCAGCAAGTCCTTCGTTTTGATCMTAMCAG

1200 1260 1320

tides immediately upstream of the TATA motif (Buratowski et al., 1989; Cortes et al., 1992; also see Figure 48, compare lanes 2 and 3). In the presence of Drl , the footprinting of the DA complex was smaller, protecting only those nucleotides composing the TATA motif (compare lanes 2 and 5 with lane 4). The DADrl footprint was similar to the DNAase I footprint observed by the D-Drl complex formed in the absence of TFIIA (compare lanes 4 and 8). These results are consistent with the gel mobility shift analysis and indicate that Drl removes TFIIA from the DA complex. These results suggest also that association of Drl with TBP induces a conformational change in TBP. This conformational change accounts for the differences in DNAase I cleavage observed of the TBP-TATA complex in the presence and absence of Drl (compare lanes 2 or 5 with lanes 4or 8). Thus, these results strongly suggest that Drl inhibits transcription by displacing TFIIA from the DA complex. Molecular Cloning of Drl Purified Drl protein was digested

with trypsin and the re-

1140

1400

sulting peptides were isolated by RPC. Four peptides were sequenced (Figure 5, a-d), and degenerative oligonucleotides based on the amino acid sequence from peptide d were synthesized (see Experimental Procedures). Sequence amplification using a HeLa cell cDNA library mediated by the polymerase chain reaction (PCR) and primers derived from peptide d gave a single product of 72 nt (data not shown; see Experimental Procedures). A HeLa cell cDNA library was screened with oligonucleotides derived from the PCR (Figure 5, oligonucleotides 1 and 2). The complete nucleotide sequence of the longest cDNA clone isolated is shown in Figure 5. The nucleotide sequence of hDr1 predicts a long open reading frame encoding a polypeptide of 178 aa with a calculated M, of 19.3. This value is in close agreement with the apparent M, of Drl estimated by SDS-polyacrylamide gel electrophoresis. The sequence of the Or1 cDNA clone contains all of the Drl-derived peptide sequences. Southern blot analyses indicated that Drl is encoded by a single gene (data not shown). Northern blot analyses of poly(A)-selected RNA,

Cell 482

A

Figure

B

C )-HAP3

homology (31%) -1

+++

PKA PKC CK2

Kr, Ev. En 1homology1

6. Structural

Characteristics

of hDr1

(A) A linear hydrophilicity plot of regions of Drl using the algorithm of Kyte and Doolittle (1982). The numbers at the bottom represent positions in the hDr1 protein. Y axis: positive values represent relative hydrophilicity. while negative values represent relative hydrophobicity. (6) Plot of acidic (A) and basic (6) residues in Drl Short and long bars represent amino acids aspartic acid or lysine, and glutamic acid or arginine, respectively. Numbers indicate positions in the Drl protein. (C)Structural features of hDr1. Numbers at the bottom represent positions in the hDr1 protein. a-Helical regions are shown in gray stippling. Regions containing homology to HAP3 (Hahn et al., 1988) and Drosophila transcriptional regulatory proteins Kr (Licht et al., 1990) ev (Han et al., 1989; Biggin and Tjian, 1989) and en (Jaynes and O’Farrell, 1988; Han et al., 1989) are also indicated. Recognition motifs for protein kinase C (PKC), casein kinase 2 (CK2), and protein kinaseA(PKA)areshown. Aglutamineand alanine-rich region (CIA-rich) is shown between amino acids 130 and 150. A putative nuclear localization signal (NLS) and positively charged region (three plus signs) are shown between amino acids 100 and 130. A highly acidic domain (three dashes) is shown in dark gray stippling. (D) Helical wheel depiction of Drl residues.

D R C I V

using the Or7 cDNA clone, revealed two discrete RNA species enriched in the poly(A)-selected RNA of approximately 1.5 and 3.4 kb, suggesting that these RNA species were originated by differential processing of a single precursor RNA molecule (data not shown). Analysis of the amino acid sequence of Drl failed to detect any DNA-binding motifs, but revealed some other interesting motifs (see Figure 6). Three potential amphipathic a helices can be observed with charge and hydrophobic amino acids on different sides of the helix (Figures 6C and 6D). Interestingly, the amphipathic a helix located at the C-terminus of Drl is rich in glutamine and alanine residues (see Figure 5). This sequence shares some homology with DNA-binding proteins present in Drosophila (data not shown), such as Kriippel (Kr), (Rosenberg et al., 1986), even-skipped (ev) (Macdonald et al., 1986) and engrailed (en) (Poole et al., 1965) which affect development by repressing expression of defined genes. Drl protein also contains sites that appear to be recognized by different protein kinases (Figure 6C), contains a putative nuclear localization signal (NLS), and is a relatively charged protein (Figures 6A and 6B). The aminoterminus of Drl also possesses homology to the yeast HAP3 protein (Figure 6C) (Hahn et al., 1988).

Recombinant Drl Protein To analyze whether recombinant Drl protein (rDr1) contained the activities associated with native human Drl (hDrl), the cDNA clone was placed under the control of the phage T7 promoter and the protein was expressed in Escherichia coli as described in Experimental Procedures. Transformation of the resulting construct (pT7Drl) into an E. coli strain resulted, after induction, in the production of an abundant polypeptide of approximately 19 kd (Figure 7A, compare lanes 3 and 4). The synthesis of the 19 kd polypeptide was specific for the Drl cDNA sequences, as a plasmid lacking the cDNA failed to produce the 19 kd polypeptide (Figure 7A, lanes 1 and 2). We have found that rDr1, like the purified human protein, elutes from gel filtration columns with a native mass of approximately 90 kd (data not shown). The bacterially produced protein (rDr1) was purified as described in Experimental Procedures and used to generate anti-Drl antibodies. These antibodies were used to analyze whether Drl cofractionated with any of the general transcription factors. Western blot analysis indicated that TFIIA and TFIIB protein fractions were devoid of any apparent Drl-reacting material (Figure 78, lanes 2 and 3, respectively). As expected, the TFllElFlH protein fraction

Drl, 483

Inhibitor

of Class

II Gene

Transcription

tography on hydrophobic TFIID and Drl. ‘-I’l-rDr -200

-200

-97 -68 -97

-43

-66

B rDr-I

IIA

IIB

hDr-I

I[D

12345 Figure

of

pDr -lt

pNull+

A

columns led to the separation

7. Expression

of Recombinant

Drl

in E. coli

pNull (lanes 1 and 2) and pDr1 (lanes 3 and 4) plasmids were transformed into E. coli BL21 (DE). (A) Cells were grown to an optical density of 0.6 and then treated with IPTG (lanes labeled I). Six hours later cells were recovered and lysed by sonication, and 100 ul aliquots were taken and boiled in Laemmli’s sample buffer, separated by 12% SDS-polyacrylamidegel electrophoresis, and stained with Coomassie blue. Lane 5 represents rDr1 protein purified as described in Experimental Procedures. (B) Protein fractions containing different general transcription factors (DEAE-cellulose step; Reinberg et al., 1987) as indicated on the panel, were analyzed by Western blot, as described above, for the presence of Drl. (C) lmmunoprecipitation of phosphorylated Drl from HeLa cells labeled with [J2P]orthophosphate in vivo. lmmunoprecipitation of proteins with protein G-agarose (see Experimental Procedures for details) in the absence of anti-Drl antibodies (lane I), in the presence of antiDrl antibodies(lane 2) in the presenceof anti-Drl antibodies and rDr1 protein (10 pg. lane 3) and in the presence of anti-Drl antibodies and rTFllB protein (15 ug, lane 4). Arrows to the left of the figure indicate phosphorylated proteins specifically immunoprecipitated with monospecific anti-Drl antibodies.

(lane 4, hDrl), which is the source of Drl (see Experimental Procedures), contained Drl-reacting material, but migrated more slowly than the rDr1 protein (Figure 76, compare lanes 4 and 1, respectively). Interestingly, the TFIID protein fraction contained substantial amounts of Drl that migrated with rDr1 (compare lanes 5 and 1, respectively). These results suggest that Drl is likely to be modified posttranslationally and that the unmodified form (comigrating with the bacterially expressed protein on SDS-polyacrylamide gels) is present in the TFIID protein fraction. Using Western blot analysis, we have found that Drl cofractionated with TFIID activity during different chromatographic steps (data not shown). However, chroma-

Drl Is a Phosphoprotein To analyze whether Drl was phosphorylated in vivo, HeLa cells were grown in a medium containing [32P]orthophosphate, extracts were prepared, and proteins were immunoprecipitated using anti-rDr1 antibodies. A polypeptide the size of Drl as well as four other phosphorylated polypeptides (~33, ~40, ~41, and p49) were precipitated by the antibodies (see Figure 4C, compare lanes 1 and 2). All of these polypeptides were specific for the Drl antibodies, as the addition of an excess of rDr1 protein (lane 3), but not of recombinant TFIIB (lane 4) or protein G agarose alone (lane l), specifically competed these polypeptides. that Drl occurs as a phosThus, these results dWnOn8trate phoprotein in vivo. Western blot analysis of the immunoprecipitates revealed Drl as the only immunoreactive polypeptide (data not shown), suggesting that the other four polypeptides(p33, ~40, ~41, and p49) most likely were precipitated by anti-Drl antibodies because they exist in association with Drl. Activities Associated with rDr1 In agreement with the results observed with hDr1 (see Figure 3) the addition of rDr1 protein to a reconstituted transcription system resulted in inhibition (Figure 8A, compare lane 1 with lanes 2-4). However, contrary to the results obtained with hDr1, rDrl-mediated inhibition could not be overcome by the addition of an excess of TBP (yTBP, Figure 8A, lane 5; hTBP or TFIID, data not shown). However, the addition of excess yTBP (or hTBP or TFIID, data not shown) and TFIIA to the inhibited reaction resulted in transcription (lane 8). TFIIA, in the absence of an excess of yTBP, was unable to overcome rDr1 inhibition of transcription (lane 7). These results suggest that rDr1 can inhibit transcription, but thedetailed mechanism of inhibition appears to be distinct from the mechanism employed by the hDr1 protein. A likely possibility is that phosphorylation, which is absent in the recombinant protein, plays a role in the interactions of Drl with TBP and/or the other general transcription factors. In light of the above results, we next analyzed whether rDr1 could interact with TBP. In agreement with the results obtained with hDr1 (data not shown), we found that rDr1 could interact with hTBP in the absence of DNA, asdemonstrated using biotinylated TBP by Far-Western analysis (Figure 8B). This interaction was specific because biotinylated TFIIB and streptavidin-horse radish peroxidase failed to interact with rDr1 (data not shown). A different result was observed when the interaction of rDr1 and TBP was analyzed in the presence of DNA using the gel mobility shift assay. Under this condition, rDr1 failed to stably interact with yTBP (or rhTFIID, data not shown) such that a complex on the Ad-MLP TATA motif could be isolated by electrophoresis (Figure 8C, lane 9). Interestingly, rDr1 could, however, in the presence of TFIIA, form a stable complex with TBP (lane 4or lane 11, DADr). In the absence of TBP, rDr1 and TFIIA were not able to produce any com-

Cell 404

- DDr4

ODrP

-DDr3

- DDrZ iy'

I23

TDDrl

DABDA-

1234567

-DADr

Figure 9. Effect mation

I23456

Figure

6. Effects

of rDr1 in Transcription

and Complex

Formation

(A) Basal level transcription of Ad-MLP in the absence of rDrl (lane 1) and the presence of different amounts of rDr1, as indicated on the lanes (lanes 2-7). Factors were as described in Figure 3A. Twenty nanograms of rDrl was added to yTBP. Lanes containing excess TBP received 60 ng (lanes 5 and 6). (B) Far-Western blot analysis demonstrating that Drl is associated with TBP independent of DNA. Proteins were separated by 13% SDSpolyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane. Proteins were then renatured with guanidine-HCI, washed, and incubated with biotinylated yTBP followed by streptavidin-alkaline phosphatase as described in Experimental Procedures. Blots were developed with BCIP and NBT. Lane 1, yTBP (10 ug); lane 2, rTFllB(lOug); lanes3-5, rDrl(O.1 ug. 1 ug,and lOpg, respectively). (C) Effect of rDr1 on DA and DAB complex formation. A “P-labeled DNA fragment containing the TATA and initiator motif of Ad-MLP was incubated with different factors, as indicated on each lane. (D) Effect of rDr1 on DAB complex formation. Binding assays were performed as described above. yTBP was incubated with TFIIA alone (lane 1) or TFIIA and TFllB (lanes 2-6) for 30 min. Then, reactions forming the DAB complex were supplemented with increasing amounts of rDr1 as indicated on the panel. Mixtures were incubated for 30 min and products separated as described above

plexes (lane 10). The DADr complex migrated more slowly than the DA complex (compare lanes 3 and 4) but faster than the DAB complex (compare lane 4 with lane 5). Furthermore, the addition of rDr1 to DNA binding reactions capable of producing the DA and DAB complexes resulted in the formation of a complex migrating between the DA and DAB complexes (DArDrl complex, lane 6). Moreover, addition of increasing amounts of rDr1 to a DNA binding assay containing TFIIA, yTBP, and rTFllB resulted in the disappearance of the DAB complex in a rDr1 dosedependent fashion and a concomitant supershifting of the DA complex to one migrating between the DA and DAB complexes on the native polyacrylamide gel (Figure ED). These results demonstrate that rDr1 associates with the DA complex to form the DArDrl complex, preventing the association of TFIIB with the DA complex and, therefore, precluding the formation of a transcription-competent complex.

of Treatment

of Native

Drl with CIP on Complex

For-

(A) Effect of CIP on binding of native Drl with yTBP. Binding assays were performed as described above. Incubation of yTBP and Drl in the absence of CIP (lane l), in the presence of 1 and 2 U of CIP, respectively (lanes 2 and 3) in the presence of 10 and 20 rrg of BSA, respectively (lanes 4 and 5). DA complex alone is shown in lane 6, DA complex treated with 2 U of CIP (lane 7) and DA complex treated with 20 trg of BSA (lane 6). (B) Effect of CIP treatment of both native and rDrl protein in complex formation with yTBP and TFIIA. Incubations of specific proteins with the DA complex are indicated at the top of the gel. Specific complexes are shown to the right and left of both (A) and (B).

The studies described above demonstrate that the native and rDr1 proteins inhibit transcription; however, the interaction of TBP with hDr1, which is phosphorylated, and rDr1, which is not phosphorylated, is different. First, hDr1 interacts stably with TBP and produces four different complexes. Second, the stable association of rDr1 with TBP requires TFIIA and generates a single complex. Third, hDr1 precludes the association of TFIIA with TBP, and rDr1 precludes the association of TFIIB with the DA complex. Since the molecular mechanism by which the native Drl and rDr1 proteins affect transcription thus far appears disparate, it was important to ascertain what difference(s) may exist between the protein encoded by the cDNA clone and the native hDr1. In light of the results indicating that the hDr1 protein is phosphorylated, we analyzed whether the differences observed between the human and recombinant proteins were due to phosphorylation. Treatment of hDr1 with calf intestine phosphatase (CIP) resulted in a protein unable to interact with yTBP (Figure 9A, compare lane 1 with lanes 2 and 3). Similar treatment of Drl with bovine serum albumin (lanes 4 and 5), or of TFIIA with the phosphatase (lanes 6-8) was without effect on the ability of the proteins (Drl or TFIIA) to interact with yTBP and promote binding to the TATA motif. Consistent with the results presented above (Figures 8 and 9A), the addition of phosphatase-treated hDr1 to DNA binding assays containing Ad-MLP, TFIIA, and TBP resulted in the production of a complex migrating more slowly than the DA complex (Figure 9B, lane 7) which comigrated with the complex formed when rDr1 associated with the DA complex (Figure 9B, compare lane 7 with lanes 2-4). The in vitro dephos-

Drl, 485

Inhibitor

of Class

II Gene Transcription

phorylated Drl protein was unable to produce the highlyordered complexes characteristic of the phosphorylated hDr1 protein (compare lane 7 with lanes 5 and 6). Consistent with the fact that the bacterially produced Drl protein is nonphosphorylated, phosphatase treatment of the recombinant protein was without effect (compare lanes 2 and 4). Thus, these results demonstrate that differences observed between the native Drl and rDr1 proteins are likely due to phosphorylation and that phosphorylation of Drl regulates its interaction with TBP. Discussion The studies presented here describe the identification, purification, and isolation of a human cDNA clone encoding Drl. Drl was detected in HeLa cell extracts as an activity that represses transcription during the purification of TFIIE. Analysis of the fractions containing this transcriptional repressing activity resulted in the discovery of a factor that interacted with the TBP and promoted binding to the TATA motif. Using the gel mobility shift assay and the ability of Drl to stimulate binding (stability) of TBP to the TATA motif, Drl was purified from HeLa cells to a single polypeptide with a mass of approximately 19 kd. The renatured 19 kd polypeptide was capable of interacting with TBP and repressing transcription in vitro. Consistent with the observation that Drl interacted with TBP, inhibition of transcription could be overcome by the addition of excess TBP. With the use of “reverse genetics” and peptides derived from the pure protein, a human cDNA clone encoding Drl was isolated. We determined by four independent observations that the cDNA clone isolated encoded Drl . First, we found that the sequence of the cDNA clone contained the sequence of all four Drl-derived peptide sequences. Second, the cDNA clone encoded a polypeptideof approximately 19 kd, which is in closeagreement with the molecular mass estimated for hDr1 by SDS-polyacrylamide gel electrophoresis. Furthermore, the native molecular sizes of the human and recombinant proteins were estimated to be approximately 90 kd by gel filtration chromatography, suggesting that each protein exists as a homotetramer in solution. Third, antibodies produced with the bacterially expressed proteins reacted with hDrl and affected the mobility of DNA-protein complexes containing hDr1 on native polyacrylamide gels (J. A. I. and D. Ft., unpublished data). Fourth, both the bacterially expressed and human proteins inhibited transcription. Although the mechanism(s) by which the human and recombinant protein affect transcription appears to be similar, our studies indicate that phosphorylation regulates the interaction (site and/or affinity) between Drl and TBP. Our studies demonstrate that Drl exists as a phosphoprotein in vivo and that phosphorylation affected the interaction between TBP and Drl . Both the native Drl and rDr1 proteins were capable of interacting with TBP. However, this interaction was different, as we found that the recombinant protein, or that in vitro dephosphorylation of hDr1, resulted in a protein unable to form a stable complex with TBP, as measured by analyzing binding of TBP to the

TATA motif using the gel mobility shift assay. Interestingly, we found that rDr1, while unable to form a stable complex with TBP on the TATA motif, was capable of stably associating with the DA complex to produce a DADrl complex. The association of rDr1 with the DA complex precluded the association of TFIIB and thus inhibited the formation of a transcription-competent complex. The in vitro dephosphorylated form of hDr1 behaves as the recombinant protein. However, our studies also demonstrated that the phosphorylated Drl protein (isolated from HeLa cells) was not only capable of dissociating TFIIB from the DA complex (J. A. I. and D. R., unpublished data), but was also capable of dissociating TFIIA from the DA complex to generate the D-Drl complexes. Taken together, these observations suggest that the state of phosphorylation of Drl affects its binding specificity (site or affinity) for TBP. When Drl is phosphorylated (as isolated from HeLa cells) the protein interacts with TBP forming a stable complex in the absence of DNA (isolated by columns containing immobilized yTBP (J. A. I. and D. Ft., unpublished data) or when TBP is bound to the TATA motif. Also, hDr1 (phosphorylated) can displace TFIIA from the DA complex, as if both proteins (Drl and TFIIA) competed for the same recognition site on TBP. On the other hand, unphosphorylated Drl (isolated from E. coli or phosphatarse treated) interacted with TBP, but in the presence of the TATA motif interacted stably only with the DA complex. These results may indicate that the interaction of TFIIA with TBP results in a conformational change of TBP that enables unphosphorylated Drl to associate stably. It is also possible that there are two Drl -binding sites within TBP: a motif overlapping the TFIIA recognition site where the stable association of Drl to this site requires Drl to be phosphorylated, and a second site that is only accessible to Drl after occupancy of the first site. Recognition of this second site is independent of phosphorylation. It is also important to stress that while binding of hDr1 (phosphorylated) to TBP resulted in four different D-Drl complexes, binding of dephosphorylated Drl resulted only in the production of a single complex. The formation of the different D-Drl complexes follows binding kinetics suggestive of a cooperative association between the different Drl protomers. If this is the case, then the cooperative binding is only observed with phosphorylated Drl protein. Analysis of the amino acid sequence of Drl indicated the presence of recognition sites for phosphorylation by protein kinase A (PKA), protein kinase C (PKC), and casein kinase II. These kinases were capable of phosphorylating Drl in vitro; however, this failed to affect Drl activity such that the recombinant protein could stably interact, in the absence of TFIIA, with TBP using the gel mobility shift assay (J. A. I. and D. R., unpublished data). It is interesting to note that Western blot analysis revealed, in the TFIID protein fraction, a form of Drl that comigrated with the recombinant protein on an SDS-polyacrylamide gel. Previous studies have demonstrated that hTBP exists in vivo in different protein complexes (Timmer and Sharp, 1991; Pugh and Tjian, 1991; Tanese et al., 1991; Comai et al., 1992). Furthermore, it is clear that TAFs can regulate the activity of TBP (Tanese et al., 1991;

Cdl 466

Gill and Tjian, 1992). Recent studies have demonstrated that TBP in association with three TAFs participates in transcription of RNA polymerase I genes (Comai et al., 1992). The TAFs are tightly associated with TBP and can only be removed from the TFIID complex by guanidine treatment(PughandTjian, 1991;Taneseet al., 1991; Dynlacht et al., 1991). While Drl is present in some TBP complexes and copurifies with the TFIID activity, Drl appears not to be any of the previously reported TAFs, as chromatography on hydrophobic columns results in the separation of TFIID and Drl (J. A. I. and D. R., unpublished data). The presence of Drl in the TFIID protein complex is, however, surprising, as our analysis indicates that Drl is a repressor of basal transcription. It is possible that some of the TAFs neutralize Drl activity or that a subpopulation of the TFIID complexes contain Drl and the TFIID-Drl -containing complexes are transcriptionally inactive. On the other hand, it is also possible that Drl, when in association with other factors, may participate in activation of defined genes. Our results indicate that the strong acidic activator Gal4-AH cannot overcome the repressing effect of Drl (Figure 3C). On the other hand, we have found that the acidic activators can overcome the repressing effect of Dr2, a 67 kd protein and repressor of basal transcription (A. Merino and D. Ft., unpublished data). It is thus possible that Drl activity may be modulated by some other activators. Recent studies by Meisterernst and Roeder (1991) detected factors NC1 and NC2 both interacting with TBP and repressing basal transcription. In agreement with our studies of Dr2, the observations of Meisterernst and Roeder indicated that NC1 was necessary for optimal activation by an acidic activator. It is thus possible that Dr2 and NC1 are the same activities. Whether Drl and NC2 are the same remains to be analyzed. While many factors repress transcription nonspecifically, the effect of Drl appears to be specific, as Drl interacts with TBP, an essential component of the transcription machinery. Furthermore, amino acid sequence analysis of Drl reveals the presence of a motif rich in glutamine and alanine residues that is also present in factors necessary for normal development in Drosophila(Kr, ev, and en) (Poole et al., 1985; Macdonald et al., 1986, Rosenberg et al., 1986; Licht et al, 1990). These factors are site-specific DNA-binding proteins and repress the expression of defined genes in vivo (Han et al., 1989; Biggin and Tjian, 1989; Jaynes and O’Farrell, 1988; Licht et al., 1990). More importantly, in the case of Kr, the repressing activity is independent of the DNA-binding motif and appears to map to the alanine/glutamine-rich motif (Licht et al., 1990). The fly factors repress expression of specific genes and specificity is conferred by the DNA-binding motif. Drl appears not to possess any DNA-binding motif, and thus its repressing function appears to be more general and due to protein-protein interaction. Other factors known to repress transcription of specific genes by sequestering sitespecific DNA-binding proteins have been described, such as Id (Benezra et al., 1990) and IKB (Baeuerle and Baltimore, 1988). Another factor that represses transcription is histone

Hl Its repressive activity appears to result from its nonspecific DNA binding activity (Croston et al., 1991). Hl repression can be overcome by sequence-specific DNAbinding proteins such as Spl, the GAGA factor, and Gal4VP16 (Croston et al., 1991; Laybourn and Kadonaga, 1991). The mechanism(s) by which Drl mediates repression appears to be more general than that of Id and IKB and to differ from Hl, since Drl repression occurs by sequestering both bound and free TBP. A protein such as Drl should be highly regulated and a search for activities capable of inhibiting Drl activity has resulted in the observation that the adenovirus Ela and SV40 large T antigen are capable of preventing and/or displacing the TBP-Drl interaction (V. Kraus, J. A. I., J. Nevins, and D. R., unpublished data). This observation resembles the mechanism of regulation of E2F, a cellular factor that activates transcription of the adenovirus Ela and E2 genes (Nevins, 1989). These studies demonstrate that E2F exists in complex with a factor that prevents its association with the E4-19 kd viral protein (Bagchi et al., 1990). The adenovirus Ela gene is capable of displacing this interaction, freeing E2F for interaction with the viral protein and activating transcription (Bagchi et al., 1990). Thus, it appears that a general mechanism for regulating gene expression by repression includes protein-protein-mediated interactions, which result in the sequestration of factors involved in global processes. The need for an activity inhibiting a general transcription factor such as TBP and thereby repressing transcription of many genes may be important for regulating transcription Experimental

Procedures

Purification of Drl Drl was purified from HeLa cell nuclear extracts on the basis of its ability to interact with TBP, resulting in TBP-Drl complexes capable of stably binding to the TATA motif. Drl activity copurified with the general transcription factor IIE; therefore, the initial steps of purification (up to the gel filtration step, Superdex 200) were performed as described for TFIIE (Inostroza et al., 1991). Further purification of Drl was accomplished by chromatography of the Superdex 200 protein fraction (2.4 mg) on a phenyl-Superose column (Hi%/5 Pharmacia). The column was equilibrated with buffer C (20 mM Tris-HCI buffer [pH 7.91,O.l mM EDTA, 20% glycerol, 10 mM p-mercaptoethanol, 0.2 mM phenylmethylsulfonyl fluoride) containing 1.4 M ammonium sulfate. The bound material was eluted with a linear gradient (25 ml) of 1.4-O M ammonium sulfate in buffer C. Drl activity was assayed as indicated above. The fractions containing Drl activity (eluting between 0.4 and 0.2 M, 100 wg) were pooled, dialyzed against buffer C, 0.1 M KCI, and loaded onto a micro Mono S column equilibrated with buffer C, 0.1 M KCI using the SMART system (Pharmacia, LKB Biotechnology, Inc.). The bound material was eluted with a 2.5 ml linear gradient of 0.1-0.5 M KCI in buffer C. Drl activity eluted between 0.25 and 0.3 M KCI. Active fractions were pooled (0.2 ml, 10 pg) and further fractionated by RPC on an RPC CZC16 micro column (PC 3.2/3, Pharmacia) using the SMART system. Proteins were eluted with a linear gradient (12 ml) of 0%-60% acetonitrile in 0.1% trifluoroacetic acid. Fractions were analyzed by SDS-polyacrylamide gel electrophoresis followed by silver staining. Amino Acid Sequencing of Drl Drl was carboxyamidomethylated and subjected to digestion with trypsin (Boehringer Mannheim, sequence grade). The resulting peptide mixture was separated by narrow-bore high performance liquid chromatography using a Vydac Cl6 2.1 mm by a 150 mm reverse-phase

Drl,

Inhibitor

of Class

II Gene

Transcription

407

column on a Hewlett-Packard 1090 HPLC with 1040 diode array detector. Optimum fractions were chosen based on symmetry, resolution, and ultraviolet absorbance and spectra and submitted to automated Edman degradation on an Applied Biosystems 477A protein sequencer. Reverse-phase separation and protein microsequencing were performed as described by Lane et al. (1991).

Cloning

of Drl

A set of degenerative primers were synthesized on the basis of the amino acid sequence present in the peptide labeled d (see Figure 5) as follows: primer 1, derived from the N-terminus of the peptide (WQAEL), YdCA(AG)CA(AG)CA(AG)GC(ATGC)GA(AGXCT)T’; primer 2, derived from the C-terminus (QQAQIA), !YdGC(ATGC)A(GA) (TC)TG(ATGC)GC-(TC)TG(lC)TG-3’; and primer 3 made from the central region (LQMQQA), 5’-dGC(ATGC)GC(TC)TG(TC)TGCAT(TC)TG-3’. Primers 1 and 2 were used in a PCR using a human cDNA library (Stratagene) as the template. Products were separated by 6% polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane and hybridized with “P-labeled primer 3. A positive band of the expected size (72 nt) was isolated and subcloned in pUCl8. Colonies containing insert were selected by colony hybridization using primer 3. Based on the sequence of the insert that matched the amino acid sequence of peptide d, two oligonucleotides were synthesized, YdGCCCAACAGGAATGCCTT-3’ and 5’dCAAATGCAGCAAGCTGCC-S’,and used to screen a HeLa cell-derived cDNA library (Stratagene). Three positive clones were selected from 10’ plaques and sequenced using the dideoxy method (Sanger et al., 1977).

Expression of Drl in E. coli A set of primers were generated bearing the N-terminal and C-terminal ends of Drl-coding sequences that were flanked by Nhel and BamHl sites (N-terminus, 5’dGCGCTAGCTCGTCTGGCAACGATG-3’; C-terminus, 5’-dCGGGATCCGAAACTCAGCTGGTG-3’ [the boldface sequences represent both the Nhel and BamHl sites]). These primers were used in PCR reactions to generate a product containing coding sequences flanked by these two sites. The PCR product was digested with Nhel and BamHl and cloned into the plasmid pET1 la (Novagene). E. coli strain BL21 (DE3, Novagene) containing pDr1 or the parental plasmid pETI a was grown in LB medium supplemented with ampicillin (100 pg/ml) at 37OC. Cells were grown to 0.6 at an optical density of 600 and then induced with 0.5 mM isopropylthiogalactoside (IPTG). After 6 hr, cells were harvested and resuspended in buffer L (25 mM Tris-HCI [pH 7.9],1 mM EDTA, 1 mM EGTA, 0.5 mM phenylmethylsulfonyl fluoride, 10 vtM pepstatin A, 0.1% NP-40, and 0.1 M KCI), and lysed by sonication. Induction was analyzed by 12% SDS-polyacrylamide gel electrophoresis. Purlflcatlon

of rOr1

The bacterial cell lysate was diluted so that the protein concentration was approximately IO mglml, the pH was adjusted to 7.9, and the lysate was clarified by centrifugation at 10,000 rpm for 20 min. The lysate was loaded onto a phosphocellulose column and equilibrated with buffer C. The flowthrough that contained Drl was loaded onto a Q-Sepharose column equilibrated with buffer C. The bound material was eluted with a linear gradient of 0.1 to 1 .O M KCI in buffer C using 10 column volumes. rDr1 eluted in the 0.5 M KCI fraction. Drl was then further purified on a gel filtration column (Superdex S-200). In brief, fractions from the Cl-Sepharose column were concentrated on a 2 ml Cl-Sepharose column, eluted by step wash with buffer C containing 0.8 M KCI 0.01% NP-40, and loaded onto the gel filtration column at a flow rate of 0.6 mllmin. rDr1 eluted from the column with an apparent molecular mass of 90 kd, relative to molecular weight standards.

lmmunopreclpitstlon

of Drl

from

uP-Lsbeled

HeLs

N&V04, 3% NP-40, 0.1% SDS, 50 mM Tris-HCI buffer (pH 7.5), and 1 mM phenylmethylsulfonyl fluoride. Extracts were then incubated in the presence or absence of rDr1 (IO vg) or rTFllB (15 pg) for 2 hr at 4OC with rabbit polyclonal anti-Drl antibodies that were preincubated 1 hr with gamma bind G agarose (Genex Corp.). Bound material was then washed four times with lysis buffer, boiled 5 min at 100°C, resolved electrophoretically on a IO%-20% gradient SDSpolyacrylamide gel, and transferred to nitrocellulose membrane in 90 mM Trisborate, 2 mM EDTA, and 20% methanol. Radiolabeled proteins were visualized by autoradiography.

Antibody

Production

Polyclonal antiserum was raised against bacterially produced rDr1 protein in rabbits (New Zealand White, 2 months old). In brief, a Q-Sepharose fraction containing rDr1 was separated on a preparative 15% SDS-polyacrylamide gel. The gel was stained with Coomassie brilliant blue, and the band containing rDr1 was excised from the gel. Gel slices were homogenized in phosphate-buffered saline using a polytron and mixed with Freund’sadjuvant prior to injection. Polyclonal antibodieswereaffinitypurified usingacolumn containing immobilized purified rDr1 coupled to an agarose support (Affigel 15, Bio-Rad). Bound antibodies were eluted from the column with 0.2 M glycine (pH 2.6) directly into 100 pl of 1 M Tris-HCI (pH 7.9). The eluted antibodies were dialyzed against buffer C containing 0.1 M KCI.

Treatment

of Nstlve

Drl with CIP

Dephosphorylation reactions of human native Drl were performed in reaction mixtures containing 20 mM HEPES-NaOH (pH 7.9), 20 mM MgCI,, 40 mM KCI, 0.2 mM phenylmethylsulfonyl fluoride, and 2 U of CIP (Boehringer Mannheim) and incubated for 30 min at 37OC. Phosphatase was inactivated by the addition of 5 mM nitriloacetic acid and mixtures used directly in complex formation assays.

Blotlnylatlon Far-Western

of yTBP end TFIIB Blot Anslyals

and

One part of N-hydroxysuccimidebiotin (10 mg/ml) in dimethyl sulfate was mixed with 3 parts of yTBP (0.1 mglml) and TFIIB (0.2 mg!ml) that had been dialyzed into 0.1 M sodium borate (pH 8.8). The mixture was incubated at room temperature for 4 hr and dialyzed into BClOO to remove unreacted N-hydroxysuccimidobiotin. rDr1, TBP, and TFIIB fractions were boiled in Laemmli’s sample buffer and separated on 13% SDS-polyactylamide gels and transferred to nitrocellulose membranes. Nitrocellulose membranes were washed twice for 10 min each in buffer A (20 mM HEPES [pH 7.9],50 mM NaCI, 1 mM EDTA, 10 mM R-mercaptoethanol, and 10% glycerol) containing 6 M guanidine-HCI (US Biochemicals). three times for 5 min in buffer A containing 3 M guanidine-HCI , one time for 5 min in buffer A containing 1.5 M guanidine-HCI. Membranes were then incubated two times for 30 min in buffer A containing 5% powdered skim milk (Carnation), and one time for 5 min in buffer A alone. Membranes were then incubated with the biotinylated proteins (1 pg/ml) for 8 hr, and washed three times with buffer B (20 mM Tris [pH 7.51, 50 mM NaCI, and 0.01% Triton X-100). Blots were then incubated with streptavidin-alkaline phosphatase for 1 hr in buffer B, washed three times for 10 min each, and visualized after incubation with nitro blue tetrazolium (NBT) and 5-bromo-4chloro-3-indolyl phosphate (BCIP).

Other

Methods

Transcription factors were purified as described by Flores et al. (1992). RNA polymerase II was purified as described by Lu et al. (1991). DNA binding assays were performed as described by Maldonado et al. (1990). Northern and Southern blot analyses were performed as described by Ha et al. (1991)

Cells

HeLa cells (2.5 x 10’) were grown in Dulbecco’s modified Eagle’s medium supplemented with 5% calf serum. For labeling studies, the culture medium was removed and the cells washed two times with phosphate-buffered saline and then refed with 25 ml of phosphate-free Dulbecco’s modified Eagle’s medium supplemented with 1 mCi/ml [“Pjorthophosphate (NEN). The cells were then incubated at 37OC for 7 hr. Cells were then harvested and whole-cell extracts prepared in a modified lysis buffer containing 100 mM NaCI, 50 mM NaF, 100 PM

Acknowledgments We thank Drs. 0. Flores, A. Merino, R. Tjian. L. Vales, R. Weinmann, and L. Zawel for stimulating discussions. We also thank Drs. M. Green, G. Peterson, N. Stone, R. Tjian, L. Vales, and L. Zawel for reading the manuscript. Also, we would like to thank the technical expertise of R. A. Robinson and Nai-Sheng Lin. This work was supported by a grant from the American Cancer Society (NP-701) and in part from grants

Cell 488

from the National institutes of Health (GM37120) and the National Science Foundation (DMB8819342). F. H. M. is a recipient of an NIH postdoctoral fellowship award. D. R. is a recipient of an American Cancer Society Faculty Research Award. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received

March

9, 1992; revised

June

1, 1992.

transcription by homeodomain-containing mon site. Nature 336. 744-749. Johnson, regulatory

proteins

that bind a com-

P. F., and McKnight, S. L. (1989). Eukaryotic proteins. Annu. Rev. Biochem. 58, 799-839.

transcription

Kao, C. C., Lieberman, P. M., Schmidt, M. C., Zhou, Ct., Pei, R., and Berk. A. J. (1990). Cloning of a transcriptionally active human TATAbinding factor. Science 248, 1646-1649. Kyte, J., and Doolittle, hydrophobic character

R. F. (1982). A simple method for displaying of a protein. J. Mol. Biol. 757, 105-132.

the

Lane, W. S., Galat, A., Harding, M. W., and Schreiber, S. L. (1991). Complete amino acid sequence of the FK506 and rapamycin binding protein, FKBP, isolated from calf thymus. J. Prot. Chem. 70, 151-160.

References Baeuerle, P. A., and Baltimore, the NF-KB transcription factor.

D. (1988). IKE: a specific Science 242, 540-546.

inhibitor

of

Bagchi, S., Raychaudhuri, P., and Nevins, J. R. (1990). Adenovirus ElA proteins can dissociate heteromeric complexes involving the E2F transcription factor: a novel mechanism for EfA trans-activation. Cell 62, 659-669. Benezra, R., Davis, R. L., Lockshon, H. (1990). The protein Id: a negative binding proteins. Cell 67, 49-59.

D., Turner, D. L., and Weintraub, regulator of helix-loop-helix DNA-

Laybourn, P. J., and Kadonaga, cores and histone Hl in regulation II. Science 254, 238-245.

J. T. (1991). of transcription

Role of nucleosomal by RNA polymerase

Lee, W. S., Kao, C. C.. Bryant, G. O., Liu, X., and Berk, A. (1991). Adenovirus Ela activation domain binds the basic repeat in the TATA box transcription factor. Cell 67, 365-376. Lewin, 6. (1990). of protein-protein

Commitment interactions.

and activation at pol II promoters: Cell 67, 1161-l 164.

a tail

Biggin, M. D., andTjian, R. (1989). Apurified Drosophila homeodomain protein represses transcription in vitro. Cell 58, 433-440.

Licht, J. D., Grossel, M. J., Figge, J., and Hansen, U. M. (1990). Drosophila Kruppel protein is a transcriptional repressor. Nature 346, 7679.

Buratowski, S., Hahn, S., Guarente, L., and Sharp, P. A. (1989). Five intermediate complexes in transcription initiation by RNA potymerase II. Cell 56, 549-561.

Lin, Y. S., Carey, M. F., Ptashne. M., and Green, M. R. (1988). Gal4 derivatives function alone and synergistically with mammalian activators in vitro. Cell 54, 859-664.

Comai, L., Tanese, N., and Tjian, R. (1992). The TATA-binding protein and associated factors are integral components of the RNA polymerase I transcription factor, SLl. Cell 68, 965-976.

Lu, H.. Flores, O., Weinmann, R., and Reinberg, D. (1991). The nonphosphorylated form of RNA polymerase II preferentially associates with the preinitiation complex. Proc. Natl. Acad. Sci. USA 88, 1000410006.

Cortes, P., Flores, O., and Reinberg, D. (1992). Factors involved in specific transcription by mammalian RNA polymerase II: purification and analysis of transcription factor IIA and identification of transcription factor II. Mol. Cell. Biol. 72, 413-421.

Macdonald, P. M. , Ingham, P., and Struhl, G. (1986). Isolation, structure, and expression of even-skipped: a second pair-rule gene of Drosophila containing a homeo box. Cell 47, 721-734.

Croston, G. E., Kerrigan, L. A., Lira, L. M., Marshak. D. R., and Kadonaga, J. T. (1991). Sequence-specific antirepression of histone Hlmediated inhibition of basal RNA polymerase II transcription. Science 257, 643449.

Maldonado, E., Ha, I., Cortes, P., Weis, L.. and Reinberg, D. (1990). Factors involved in specific transcription by mammalian RNA polymerase II: role of transcription factors IIA, IID, and IIB during formation of a transcription-competent complex. Mol. Cell. Biol. 70, 6335-6347.

Dynlacht, B. D., Hoey, T., and Tjian, R. (1991). Isolation of coactivators associated with the TBP that mediate transcriptional activation. Cell 66, 563-576.

Meisterernst, M., and Roeder, R. G. (1991). Family of proteins that interact with TFIID and regulate promoter activity. Cell 67, 557-567.

Flores, O., Lu, H., and Reinberg, D. (1992). Factorsinvolved in specific transcription by mammalian RNA polymerase II: identification and characterization of factor IIH. J. Biol. Chem., 267, 2786-2793. Gill, G., and Tjian, R. (1992). Eukaryotic coactivators associated with the TATA box binding protein. Curr. Opin. Genet. Dev.. in press. Ha, I,, Lane, W. S., and Reinberg, D. (1991). Cloning encoding the general transcription initiation factor 689-695.

of a human gene IIB. Nature 352,

Han, K., Levine, M. S., and Manley, J. L. (1989). Synergistic activation and repression of transcription by Drosophila homeobox proteins. Cell 56, 573-583. Hoffmann, A., Sinn, E., Yamamoto, T., Wang, J., Roy, A., Horikoshi, M., and Roeder, R. G. (iSSO). Highly conserved core domain ahd unique N terminus with presumptive regulatory motifs in a human TATA factor (TFIID). Nature 346, 387-394. Horikoshi, N., Maguire, K., Kralli, A., Maldohado, E., Reinberg, D., and Weinmann. R. (1991). Direct interaction between adenovirus EIA protein and the TATA box binding transcription factor IID. Proc. Natl. Acad. Sci. USA. 88, 5124-5128. Inostroza, J.. Flores, O., and Reinberg, D. (1991). Factors involved in specific transcription by mammalian RNA polymerase II: purification and functional analysis of transcription factor IIE. J. Biol. Chem. 266, 9304-9308. J. B., and O’Farrell,

P. H. (1988).

Activation

and repression

Mitchell, P. J., and Tjian, R. (1989). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245, 371-378. Nevins, J. R. (1989). Mechanisms of viral-mediated transcription. Adv. Virus Res. 37, 35-83.

trans-activation

of

Peterson, M. G., Tanese, N., Pugh, B. F., and Tjian, R. (1990). Functional domains and upstream activation properties of cloned human TBP. Science 248, 1625-1630.

Hahn, S., Pinkham, J., Wei, R., Miller, R., and Guarente, L. (1988). The HAP-3 regulatory locus of Sacchafomyces cerevisiae encodes divergent overlapping transcripts. Mol. Cell. Biol. 8, 656-663.

Jaynes,

Meisterernst, M., Roy, A. L., Lieu, H. M., and Roeder, R. G. (1991). Activation of class II gene transcription by regulatory factors is potentiated by a novel activity. Cell 66, 981-993.

of

Poole, S. T., Kauvar, L. M., Drees, B., and Kornberg, T. (1985). The engrailed locus of Drosophila: structural analysis of an embryonic transcript. Cell 40, 37-43. Pugh, B. F., and Tjian, R. (1990). Mechanism of transcriptional tion of Spl : evidence for coactivators. Cell 67, 1187-I 197. Pugh, B. F., and Tjian, R. (1991). Transcription moter requires a multisubunit TFIID complex. 1945.

activa-

from aTATA-less proGenes Dev. 5, 1935-

Reinberg, D.. Horikoshi, M., and Roeder, R. G. (1987). Factorsinvolved in specific transcription by mammalian RNA polymerase II: functional analysis of initiation factors IIA and IID and identification of a new factor operating at sequences downstream of the initiation site. J. Biol. Chem. 262, 3322-3330. Rosenberg, U. B., Schroder, C., Preiss, A., Kienlin, A., Cote, S., Riede, I., and Jackie, H. (1988). Structural homology of the product of the Drosophila Kruppe/ gene with Xenopus transcription factor IIIA. Nature 379, 336-339.

Drl, 489

Inhibitor

of Class

Sanger, F., Nicklen. with chain-terminating 5470.

II Gene

Transcription

F. F., and Co&on, inhibitors. Proc.

A. R. (1977). DNAsequencing Natl. Acad. Sci. USA 74,5463-

Stringer, K. F., Ingles, C. J., and Greenblatt, J. (1990). Direct and selective binding of an acidic transcriptional activation domain to the TATA box factor TFIID. Nature 345, 763-766. Tanese, N., Pugh, B. F.. and Tjian, R. (1991). rich activator purified from the multisubunit Genes Dev. 5, 2212-2224. Timmers, is present 1956.

M. H. T., and Sharp, P. (1991). The mammalian in two functionally distinct complexes. Genes

Zawel, L., and Reinberg, D. (1992). polymerase II: a multi-step process. in press. GenBank

Coactivators for a prolinhuman TFIID complex.

Accession

The accession M97388.

number

TFIID protein Dev. 5, 1946-

Initiation of transcription by RNA Prog. Nucl. Acid Res. Mol. Biol.,

Number for the sequence

reported

in this

paper

is