Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 1
ARTICLE
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
The roles of peroxide protective regulons in protecting Xanthomonas campestris pv. campestris from sodium hypochlorite stress Nisanart Charoenlap, Phornphan Sornchuer, Anong Piwkam, Kriangsuk Srijaruskul, Skorn Mongkolsuk, and Paiboon Vattanaviboon
Abstract: The exposure of Xanthomonas campestris pv. campestris to sublethal concentrations of a sodium hypochlorite (NaOCl) solution induced the expression of genes that encode peroxide scavenging enzymes within the OxyR and OhrR regulons. Sensitivity testing in various X. campestris mutants indicated that oxyR, katA, katG, ahpC, and ohr contributed to protection against NaOCl killing. The pretreatment of X. campestris cultures with oxidants, such as hydrogen peroxide (H2O2), t-butyl hydroperoxide, and the superoxide generator menadione, protected the bacteria from lethal concentrations of NaOCl in an OxyR-dependent manner. Treating the bacteria with a low concentration of NaOCl resulted in the adaptive protection from NaOCl killing and also provided cross-protection from H2O2 killing. Taken together, the results suggest that the toxicity of NaOCl is partially mediated by the generation of peroxides and other reactive oxygen species that are removed by primary peroxide scavenging enzymes, such as catalases and AhpC, as a part of an overall strategy that protects the bacteria from the lethal effects of NaOCl. Key words: AhpC, catalase–peroxidase, katA, katG, hypochlorite, OxyR, Xanthomonas. Résumé : L’exposition de Xanthomonas campestris pv. campestris a` des concentrations sous-létales d’une solution d’hypochlorite de sodium (NaOCl) a induit l’expression de gènes codant des enzymes de piégeage de peroxydes situées dans les régulons OxyR et OhrR. Une analyse de la sensibilité de divers mutants de X. campestris a indiqué que oxyR, katA, katG, ahpC et ohr contribuaient a` la protection contre le pouvoir bactéricide du NaOCl. Un prétraitement de cultures de X. campestris avec des oxydants tels le peroxyde d’hydrogène (H2O2), le t-butyl hydroperoxyde et la ménadione (un générateur de superoxyde) a protégé les bactéries contre des concentrations létales de NaOCl et cette activité dépendait de la présence d’OxyR. Lorsqu’on a traité les bactéries avec une faible concentration de NaOCl, on a remarqué une protection adaptative contre la toxicité du NaOCl qui s’est aussi traduite en une meilleure défense contre le H2O2. Dans l’ensemble, les résultats tendent a` démontrer que la toxicité du NaOCl découle en partie de la génération de peroxydes et d’autres réactifs oxygénés qui sont éliminés par les principales enzymes de piégeage de peroxydes comme les catalases et AhpC, et ce, dans le cadre d’une stratégie globale de protection de la bactérie contre les effets létaux du NaOCl. [Traduit par la Rédaction] Mots-clés : AhpC, catalase–peroxydase, katA, katG, hypochlorite, OxyR, Xanthomonas.
Introduction Xanthomonas campestris pv. campestris (Xcc) is a soil bacterium and a phytopathogen that causes black rot on cruciferous crops worldwide. Most X. campestris infections originate from planting infected seeds (Sally et al. 1996). Treating the crucifer seeds with disinfectants, such as a sodium hypochlorite (NaOCl) solution, is an effective strategy to eradicate the bacterial contamination before the seeds are planted (Sally et al. 1996). In aqueous solutions, NaOCl ionizes to generate Na+ and hypochlorite (OCl–) that is then transformed into hypochlorous acid (HOCl). The lethal effect of HOCl is believed to be partially due to the disruption of oxidative phosphorylation and the oxidation of macromolecules (McDonnell and Russell 1999). A global transcriptome analysis revealed that the treatment of bacteria with NaOCl
results in the increased expression of genes that are involved in oxidative stress protection (Wang et al. 2009; Peeters et al. 2010), implying that the treatment generates intracellular reactive oxygen species (ROS) that are responsible for the changes in gene expression. Moreover, several genes that mediate resistance to oxidative stress, for example, genes in the OxyR and IscR regulons, have been shown to be involved in protecting bacterial cells from HOCl killing (Dukan and Touati 1996; Romsang et al. 2013; Gundlach and Winter 2014). Accordingly, there is a strong link between oxidative stress and HOCl toxicity. There are 2 major peroxide protective regulons in X. campestris that are regulated by the peroxide-sensing transcription regulators OxyR and OhrR. These transcriptional regulators sense increased levels of peroxides and coordinate the expression of their
Received 28 November 2014. Revision received 17 February 2015. Accepted 3 March 2015. N. Charoenlap, P. Sornchuer, and K. Srijaruskul. Laboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok 10210, Thailand. A. Piwkam. Program in Applied Biological Science: Environmental Health, Chulabhorn Graduate Institute, Bangkok, Thailand. S. Mongkolsuk. Laboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok 10210, Thailand; Department of Biotechnology and Center for Emerging Bacterial Infections, Faculty of Science, Mahidol University, Bangkok, Thailand; Center of Excellence on Environmental Health and Toxicology, Commission on Higher Education, Ministry of Education, Bangkok, Thailand. P. Vattanaviboon. Laboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok 10210, Thailand; Program in Applied Biological Science: Environmental Health, Chulabhorn Graduate Institute, Bangkok, Thailand; Center of Excellence on Environmental Health and Toxicology, Commission on Higher Education, Ministry of Education, Bangkok, Thailand. Corresponding author: Paiboon Vattanaviboon (e-mail: [email protected]). Can. J. Microbiol. 61: 1–8 (2015) dx.doi.org/10.1139/cjm-2014-0792
Published at www.nrcresearchpress.com/cjm on 6 March 2015.
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 2
Can. J. Microbiol. Vol. 61, 2015
Table 1. Bacterial strains and plasmids used in this study.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Strain and plasmid Strains Xanthomonas campestris Wild-type Strain containing mutation in: ahpC katA katG ohr ohrR oxyR Plasmids pKNOCK pBBR1MCS-4 pAhpC pKatA pKatG pOxyR
Description
Source
X. campestris pv. campestris ATCC 33913
da Silva et al. 2002
ahpC::pKNOCK-Km katA::pKNOCK-Gm katG::pKNOCK-Km ohr::tet ohrR::pKNOCK-Km oxyR::pKNOCK-Km
Patikarnmonthon et al. 2010 Jittawuttipoka et al. 2009 Jittawuttipoka et al. 2009 This study This study Jittawuttipoka et al. 2009
Suicide vector; RP4 oriT, R6 K ␥-ori, Broad-host-range cloning vector; rep, mob, lacZ␣, Apr pBBR1MCS-4 containing ATCC 22913 ahpC pBBR1MCS-4 containing ATCC 22913 katA pBBR1MCS-4 containing ATCC 22913 katG pBBR1MCS-4 containing ATCC 22913 oxyR
Alexeyev 1999 Kovach et al. 1995 Patikarnmonthon et al. 2010 Jittawuttipoka et al. 2009 Jittawuttipoka et al. 2009 Jittawuttipoka et al. 2009
target genes to minimize the damage caused by the hostile conditions. Xanthomonas OxyR is a H2O2 sensor and a transcriptional regulator of the katA, katG, and ahpC genes, which encode a monofunctional catalase, catalase-peroxidase, and alkyl hydroperoxide reductase, respectively (Charoenlap et al. 2005; Chauvatcharin et al. 2005; Jittawuttipoka et al. 2009). OhrR senses organic hydroperoxides (OHP) and regulates the gene ohr, which encodes a thiol peroxidase-like enzyme (Panmanee et al. 2006). In this communication, we evaluated the role of these peroxide protective regulons in the protection of Xcc from NaOCl toxicity. Our findings provide an insight into the mechanisms that are responsible for NaOCl toxicity and for the induced adaptive resistance to NaOCl in Xcc. Moreover, the presence of NaOCl-induced crossprotection against H2O2 suggests that exposure of Xcc to a nonlethal dose of NaOCl may affect plant–microbe interaction given that H2O2 is among the first line of plant defense responses.
Materials and methods Bacterial strains and growth conditions The Xcc wild-type strain ATCC 33913 and mutants (Table 1) were cultured aerobically in Silva–Buddenhagen (SB) medium (Patikarnmonthon et al. 2010) at 28 °C. Molecular genetics techniques Molecular genetics techniques were performed using standard protocols (Sambrook and Russell 2001). Xcc was transformed by electroporation as previously described (Patikarnmonthon et al. 2010). The plasmids and primer sequences used in this study are shown in Tables 1 and 2, respectively. Construction of ohr and ohrR mutants The ohrR mutant was constructed using the pKNOCK suicide plasmid system (Alexeyev 1999). An ohrR gene fragment was PCR amplified from Xcc genomic DNA with the primers BT1602 and BT1603 that were designed according to xcc0263 sequence (da Silva et al. 2002). A 200 bp PCR product was cloned into the vector pGemT-Easy (Promega, USA), and the SalI–SacII fragment was subcloned into pKNOCK-Km to generate the plasmid pKNOCK-ohrR. The recombinant plasmid was transformed into the wild-type cells and the putative ohrR mutants were selected by kanamycin resistance phenotype. The ohrR mutant was confirmed by Southern blot analysis (data not shown). The ohr mutant was constructed using the gene replacement method. The DNA sequences flanking the putative ohr gene (xcc0264) were PCR amplified from Xcc genomic DNA with the
Table 2. Primers used in this study. Primer
Sequence (5= ¡ 3=)
BT1413 BT1414 BT1602 BT1603 BT1834 BT1835 BT1836 BT1837 BT2237 BT2238 BT2239 BT2240 BT2684 BT2685 BT2781 BT2782 BT2808 BT2809
GTCGTGCCGCGACAGCGG GCATCCGCGAGCGTTTTC CCTGACCTATCCGCAGTA CGGCATCGGCAAGCCCGA GCGGCATTTTGTGGGACT CCATGGTGGTTCTCCTGAGT ACTCAGGAGAACCACCATGGCCTGAAGCTTTCCCGGAT TCGGTGGTGTAGCTGTCC GGCCAGGTCGTCCGGCTT GAATCCACCCGCACGCTG TCTGCTTGCCACCGGACT TGTGGGAGGACCCGATCC CGCAGCGTCTCGGTGACG AGTGGAAGACGCCGCTGA GCCCGCACAAGCGGTGGAG ACGTCATCCCCACCTTCCT GCACCAACCCGGAGCAGC TACGGGCACACCTGGTGG
primer pair BT1834 and BT1835 and primer pair BT1836 and BT1837 to yield the fragments OhrUP (1.1 kb) and OhrDOWN (0.7 kb), respectively. The BT1836 primer sequence contains a HindIII site and a sequence that is complementary to that of BT1835. The OhrUP and OhrDOWN fragments were mixed together, denatured, annealed, and extended, and the mixture was used as the template in a PCR reaction with the primers BT1834 and BT1837 and Pfu DNA polymerase to generate a PCR product with blunt ends. This PCR product was cloned into the HincII and EcoRV sites of the vector pBluescript II KS (Stratagene, USA) to produce pOhrUP-DOWN. Next, the tetracycline resistance gene released by the HindIII digestion of pUFR027tet, a derivative of pUFR027 (DeFeyter et al. 1990), was inserted at the HindIII site between the OhrUP and OhrDOWN sequences in pOhrUP-DOWN to yield the plasmid pOhr::tet. This plasmid was then electroporated into the Xcc wild type. A double cross-over between the plasmid-borne OhrUP–OhrDOWN sequences and their counterparts on the Xcc chromosome led to the replacement of the ohr gene with the tet gene. Transformants were selected based on their Tcr and Aps phenotypes, and the ohr mutation was confirmed by Southern blot analysis. Real-time reverse transcription – polymerase chain reaction (qRT–PCR) The exponential growth cultures were challenged with 0.0625 and 0.0313% (m/v) NaOCl for 15 min. Bacterial cells from the uninPublished by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Charoenlap et al.
3
duced and NaOCl-induced cultures were collected. The total RNA was prepared and qRT–PCR was performed as described (Jittawuttipoka et al. 2010). The reverse transcription reaction was conducted with a RevertAidTM M-MuLV Reverse Transcriptase kit (Fermentas) using random hexamers according to the manufacturer’s recommendation. The specific primer pairs for ahpC (BT2684 and BT2685), katG (BT2239 and BT2240), katA (BT2237 and BT2238), ohr (BT1602 and BT1603), and the 16S rRNA (BT2781 and BT2782) are listed in Table 2. The qRT–PCR was performed with a specific primer pair using SYBR green PCR Master Mix (Applied Biosystems), and Xcc 16S rRNA gene was used as the normalizing gene. The relative expression analysis was executed using StepOne software version 2.1, and the gene expression levels were presented as the fold change in expression relative to the uninduced Xcc wild-type culture.
®
Determination of minimal inhibitory concentration (MIC) of NaOCl The MIC of NaOCl for Xcc was determined using the broth dilution method as previously described (Heling et al. 2001). Bacterial suspensions in SB broth containing a NaOCl solution (12.5% (m/v), Ajax Finechem) at final concentrations of 0.25%, 0.125%, 0.0625%, 0.0313%, 0.0156%, and 0.008% were incubated overnight at 28 °C with shaking at 150 r·min–1. The MIC was defined as the lowest concentration of NaOCl at which no bacterial growth was measured. Determination of resistance to NaOCl Exponential-phase cultures of Xcc strains were treated with 0.1% (m/v) concentrations of NaOCl for 30 min. After treatment, the cultures were 10-fold serially diluted and 10 L of each dilution was spotted onto SB medium. The plates were incubated at 28 °C for 2 days before the colonies were counted. The survival percentage was determined by dividing the colony-forming units (CFUs) of the NaOCl-treated culture with the CFUs of the untreated control and multiplying by 100. Induced adaptive and cross-protection responses NaOCl-induced adaptation was achieved by pretreating exponential cultures with 0.0625% NaOCl for 30 min, and oxidantinduced cross-protection against NaOCl was carried out by pretreating cells with 100 mol·L–1 H2O2, t-butyl hydroperoxide (tBOOH), and menadione for 30 min (Chauvatcharin et al. 2005). The pretreated cultures were washed once with fresh SB medium before being subjected to killing concentrations of 0.05%, 0.1%, 0.15%, and 0.2% NaOCl for 30 min. The NaOCl-induced crossprotection from oxidants was determined by treating the NaOClinduced cultures with killing concentrations of H2O2 (20, 30, and 40 mmol·L–1), tBOOH (50, 100, and 150 mmol·L–1), and menadione (100, 200, and 300 mmol·L–1) for 30 min. The cells that survived the treatment were scored using viable cell counting on SB medium. H2O2 degradation assay The ability of the bacteria to metabolize H2O2 was measured using a modified ferrous oxidation – xylenol orange (FOX) assay (Vattanaviboon et al. 2002). Exponential-phase cultures were adjusted to an OD600 of 0.5 prior to adding H2O2 at a final concentration of 200 mol·L–1. The residual peroxide was monitored at 1 min intervals for 5 min. The concentration of residual H2O2 was calculated from a standard curve generated from medium containing known peroxide concentrations. GSH and GSSG assay The ratios of reduced glutathione (GSH) per oxidized glutathione (GSSG) in cells were monitored using the GSH/GSSG-Glo™ assay (Promega) according to the manufacturer's protocol.
Catalase activity assay Catalase activity was measured via the decomposition of H2O2 by monitoring the absorbance at a wavelength of 240 nm (Chauvatcharin et al. 2005). One unit of catalase was defined as the amount of enzyme capable of catalyzing the turnover of 1 mol of H2O2 per minute under the assay conditions.
Results and discussion Exposure to NaOCl solution upregulates genes in peroxide protective regulons NaOCl solution is a versatile antiseptic that is used in hospitals as well as in agriculture to disinfect the surface of seeds. The MIC of NaOCl for Xcc was determined and found to be 0.125% (equivalent to 1250 mg·L−1). The effects of sub-MIC concentrations of NaOCl (0.0313% and 0.0625%) on the expression of the katA, katG, ahpC, and ohr genes, which encode a monofunctional catalase, a catalase-peroxidase, an alkyl hydroperoxide reductase, and a thiol peroxidase-like enzyme, respectively, were determined using qRT–PCR. The treatment of the bacterial cultures with 0.0625% NaOCl increased the expression of ahpC, katA, katG, and ohr by 5.5- ± 1.5-, 5.4- ± 1.4-, 3.3- ± 0.6-, and 25.7- ± 2.4-fold, respectively, over the expression levels of uninduced culture. Treating the cultures with 0.0313% NaOCl also induced the expression of all of the antioxidant genes tested, but the expression levels were much lower than after treatment with 0.0625% NaOCl (Fig. 1a). NaOCl at a concentration of 0.0313% might not reach sufficient levels for full induction of the NaOCl regulatory response. The expression of ohr showed the highest level of induction by NaOCl treatment, and ahpC, katA, and katG were induced to similar magnitudes by the treatment. Typically, the expression of katA, katG, and ahpC is controlled by OxyR, and these genes are induced in response to exposure to H2O2, OHP, and redox cycling drugs (Chauvatcharin et al. 2005; Jittawuttipoka et al. 2009). The expression of ohr is regulated by OhrR, an OHP sensor and transcriptional regulator that primarily responds to OHP (Panmanee et al. 2006). The gene expression profiles suggest that the treatment of bacterial cultures with NaOCl could lead to the generation and accumulation of intracellular peroxides to the levels sufficient to oxidize OxyR and OhrR. The precise mechanisms by which NaOCl generates ROS are unclear, but several reports have shown a strong linkage between exposure to NaOCl and the oxidative stress response (Dukan and Touati 1996; Wang et al. 2009; Gundlach and Winter 2014). HOCl, a highly reactive oxidant generated from dissolved NaOCl, is capable of reacting with intracellular compounds and affects metabolic processes, including oxidative phosphorylation (McDonnell and Russell 1999). Antioxidant enzymes and molecules such as superoxide dismutases, catalases and glucose-6-phosphate dehydrogenase are highly susceptible to inactivation by HOCl (Dukan et al. 1999). Inactivation of these enzymes gives rise to the accumulation of ROS. Disruption of cellular redox balance appears to be one of the toxic effects of HOCl exposure (Davies 2011). GSH is believed to play a direct role in detoxification of HOCl. GSH is directly oxidized by HOCl to form GSSG, the oxidized glutathione. Depletion of GSH renders the bacteria more vulnerable to oxidative stress (Chesney et al. 1996). The involvement of GSH redox status in NaOCl protection was investigated through determination of the GSH/GSSG ratio. The results showed that the GSH/GSSG ratio was considerably decreased in response to NaOCl exposure, from a level of 24.9 ± 1.8 in uninduced cells to 0.8 ± 0.1 in the NaOClpretreated cells (Fig. 1b). Thus, pretreatment with NaOCl drastically reduces intracellular GSH levels that would lead to accumulation of ROS. OxyR and OhrR are thiol-based transcriptional regulators (Dubbs and Mongkolsuk 2012). Xanthomonas OhrR repressor belongs to the 2-Cys subfamily in which oxidation of OhrR occurs Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 4
Can. J. Microbiol. Vol. 61, 2015
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Fig. 1. The effects of sodium hypochlorite (NaOCl) on expression of genes that encode peroxide scavenging enzymes and reduced glutathione/oxidized glutathione (GSH/GSSG) ratio. (a) The relative expression levels of ahpC, ohr, katA, and katG in Xanthomonas campestris pv. campestris (Xcc) in response to exposure to 0.0625% (shaded bars) and 0.0313% (open bars) NaOCl were determined using qRT–PCR. The relative expression values over the uninduced levels are shown. (b) The GSH/GSSG ratio in Xcc treated with 0.0625% NaOCl (shaded bar) and the untreated control (UN, open bar) were determined. Three independent experiments were performed and the means ± SD are shown.
through oxidizing of the sensing cysteine and a subsequent sulfide bond formation with a resolving cysteine (Panmanee et al. 2006). In addition to ROS-mediated disulfide bond formation between 2 conserved cysteine residues (Cys-199 and Cys-208) that activate OxyR, reactive nitrogen species generating agents S-nitrosoglutathione and S-nitrosocysteine, and GSSG are capable of oxidizing and activating OxyR (Dubbs and Mongkolsuk 2012). Thus, we cannot rule out the possibility that HOCl directly oxidizes the OxyR and OhrR regulators leading to upregulation of genes in the regulons. The thiol group of cysteine residues reacts with HOCl to yield an unstable sulfenyl chloride intermediate that would undergo reaction with another thiol to form a disulfide bond (Hawkins et al. 2003; Davies 2011). Direct HOCl-mediated oxidation of protein thiols has been experimentally demonstrated (Chi et al. 2011). Indeed, OhrR has been shown to be susceptible to direct oxidation and inactivated by HOCl (Chi et al. 2011; Dubbs and Mongkolsuk 2012). Catalases and AhpC protect X. campestris from NaOCl toxicity The protective role of the individual genes that encode peroxide scavenging enzymes was evaluated through the use of gene knockout mutants. The NaOCl resistance levels in various mutants were determined. Among the genes in the OxyR regulon, the inactivation of katA and ahpC substantially reduced NaOCl resistance by 100-fold relative to wild-type levels, while a katG mutant was 10-fold less resistant than the parental strain (Fig. 2). The increased susceptibility to NaOCl observed for the katA, katG, oxyR mutants could be complemented by ectopic expression of each individual gene from the vector pBBR1MCS plasmid (Fig. 2). The only exception was that the complementation of an ahpC mutant with pAhpC was unable to restore the NaOCl-sensitive phenotype of the mutant. The high expression level of AhpC from the pAhpC plasmid led to a compensatory decrease in KatA and KatG levels (Jittawuttipoka et al. 2009). The compensatory expression between ahpC and catalases is modulated by OxyR (Charoenlap et al. 2005; Jittawuttipoka et al. 2009). The decrease in total catalase
Table 3. Total catalase activity in Xanthomonas campestris pv. campestris strains. Strain Wild-type Strain containing mutation in: ahpC/pAhpC oxyR katA katG
Catalase (U·(mg protein)–1)
Reference
6.1±0.5
This study
2.1±0.4 3.6±0.4 1.2±0.3
This study This study Jittawuttipoka et al. 2009 Jittawuttipoka et al. 2009
4.7±0.5
activity from 6.1 ± 0.5 U·(mg protein)−1 in the wild-type cells to 2.1 ± 0.4 U·(mg protein)−1 in the ahpC mutant complemented with pAhpC is likely responsible for the inability of pAhpC to complement the NaOCl-sensitive phenotype of the ahpC mutant (Table 3). The results clearly show the contribution of katA, katG, and ahpC to the overall protection of the bacteria from NaOCl. Because these genes encode peroxide scavenging enzymes that belong to the OxyR regulon, we examined the NaOCl resistance level in an oxyR mutant and found that it had the lowest resistance levels to NaOCl killing compared with the katA, katG, and ahpC single mutants (Fig. 2). Nonetheless, the genes that encode the peroxide scavenging enzymes have unequal roles in the NaOCl protective process. Although the expression of katA, katG, and ahpC are all regulated by OxyR, they have differing patterns of expression in the oxyR mutant. The total catalase activity of the oxyR mutant (3.6 ± 0.4 U·(mg protein)−1) is lower than that of the wild-type strain (6.1 ± 0.5 U·(mg protein)−1) but it is still much higher than the levels attained for the katA single mutant (1.2 ± 0.3 U·(mg protein)−1) (Table 3). It is unlikely that decreased catalase activity of the oxyR mutant could account for the decreased resistance to NaOCl. Hence, in addition to ahpC, katA, and katG, other genes in the OxyR regulon as well as the ability of OxyR to sense oxidative stress and Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) Charoenlap et al.
5
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Fig. 2. The levels of sodium hypochlorite (NaOCl) resistance in various Xanthomonas campestris pv. campestris (Xcc) strains. Exponential-phase cultures of various mutant strains that were deficient in antioxidant enzymes were treated with 0.1% NaOCl for 30 min. Three independent experiments were performed, and the means ± SD are shown. The asterisk (*) indicates statistically significant differences (P < 0.05) compared with the wild-type level, as determined by Student's t test.
activate the transcription of genes in its regulon all contribute to the overall protection against NaOCl toxicity. The NaOCl hypersensitive phenotype of the oxyR mutant is likely a consequence of losing its ability to adaptively induce its target genes during exposure to NaOCl rather than of a reduction in total catalase activity. Because the expression of ohr was highly induced by the NaOCl treatment, the resistance levels in the ohrR and ohr single mutants were determined. Ohr utilizes OHP as substrates at an efficiency that is several-fold higher than its ability to utilize H2O2. As shown in Fig. 2, there was no significant difference in the resistance levels between the Xcc wild-type strain and the ohrR or ohr mutants, indicating that this system is minimally protective against NaOCl. However, when the NaOCl resistance level in the ahpC–ohr double mutant was determined, we found that the double mutant was roughly 10-fold more sensitive than the ahpC single mutant. This result suggests that Ohr probably contributes to protection from NaOCl toxicity. In Xanthomonas, Ohr is maintained at relatively high levels (Mongkolsuk et al. 2002). Ohr and, to a lesser extent, AhpC are essential for OHP resistance (Vattanaviboon et al. 2002). NaOCl exposure might generate both OHP and H2O2 at levels that are able to activate OhrR and OxyR but are insufficient to cause cell death. We presume that AhpC mainly contributes to the protection against NaOCl toxicity through its ability to detoxify H2O2 as well as OHP generated by the NaOCl treatment (Seaver and Imlay 2001). Pretreatments with oxidants induce cross-protection from NaOCl solution The ability to induce protection against lethal concentrations of chemicals is a crucial physiological response in bacteria. We performed experiments to determine whether pretreatment with a sublethal concentration of oxidants could induce cross-protection
from a subsequent exposure to a killing concentration of NaOCl. All of the pretreatments with tBOOH, H2O2, and menadione resulted in cells that were greater than 100-fold more resistant to the 0.2% NaOCl treatment than the uninduced culture (Fig. 3a). The ability of the different oxidants to induce cross-protection against NaOCl killing strongly suggests that the overall oxidative stress response has an important physiological role in protecting the bacteria from NaOCl toxicity. At the inducing concentrations of oxidants used, ohrR–ohr induction is specific to tBOOH while menadione, tBOOH, and H2O2 are all potent inducers of the OxyR regulon in X. campestris (Panmanee et al. 2006; Jittawuttipoka et al. 2009). Thus, more conclusive experiments were conducted to elucidate which regulons provide the peroxide-induced crossprotection against NaOCl killing. The roles of oxyR and ohrR in the induction of cross-protection against hypochlorite were tested. The results revealed that the tBOOH-, H2O2-, and menadioneinduced cross-protection from NaOCl were abolished in the oxyR mutant (Fig. 3b), whereas the tBOOH-induced cross-protection from NaOCl was not affected by the inactivation of ohrR. These results indicated the physiological function of OxyR in sensing oxidants and activating genes in its regulon that confers protection against NaOCl killing. The observation is consistent with our findings that the loss of OxyR rendered the bacteria more sensitive to NaOCl than the loss of individual genes in the OxyR regulon. In E. coli, OxyR is thought to contribute to HOCl protection (Dukan and Touati 1996; Gundlach and Winter 2014). In addition to the importance of transcriptional sensors and regulators, we believe that the induction of individual genes that encode peroxide scavenging enzymes, i.e., ahpC, katA, and katG, is also responsible for the oxidant-induced cross-protection from lethal concentrations of NaOCl. These genes individually contribute to NaOCl resistance (Fig. 2). The level of total catalase activity in cell Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 6
Can. J. Microbiol. Vol. 61, 2015
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Fig. 3. Oxidants induce cross-protection against sodium hypochlorite (NaOCl) killing. Exponential-phase cells of Xanthomonas campestris pv. campestris (Xcc) wild-type (a) and oxyR mutant (b) cultivated under uninduced condition (Œ) and under induction with 100 mol·L–1 hydrogen peroxide (), t-butyl hydroperoxide (Œ), and menadione () were treated with indicated concentrations of NaOCl for 30 min. Three independent experiments were performed, and the means ± standard deviation are shown.
Fig. 4. Sodium hypochlorite (NaOCl) induces adaptive protection and cross-protection against hydrogen peroxide (H2O2). Exponential-phase Xanthomonas campestris pv. campestris (Xcc) wild-type cells were grown under uninduced conditions (Œ) and inducing conditions with 0.0625% NaOCl () and were subsequently treated with killing concentrations of NaOCl (a) or H2O2 (b) for 30 min. Three independent experiments were performed, and the means ± SD are shown.
lysates prepared from the cultures pretreated with tBOOH, menadione, and H2O2 were 3.1-, 3.2-, and 2.8-fold greater, respectively, than the catalase levels in the uninduced culture (data not shown). Hence, the upregulation of catalases and (or) AhpC contributes to NaOCl resistance in the cells that were pretreated with oxidants. NaOCl pretreatment induces adaptive protection and crossprotection against oxidants NaOCl treatment is a strong inducer of the oxidative stress response. Experiments were performed to assess whether Xcc could develop adaptive protection against NaOCl toxicity. The exponential-phase cultures were pretreated with 0.0625% NaOCl and subsequently challenged with killing doses of NaOCl. The NaOCl-pretreated cells were 10-fold more resistant to NaOCl killing than the uninduced control was (Fig. 4a). This phenotype can most likely be attributed to the ability of NaOCl to induce genes in the OxyR regulon (Fig. 1a) that then conferred protection against
the lethal doses of NaOCl. At the physiological level, prior exposure to a low level of NaOCl can induce an adaptive protection against subsequent exposure to lethal concentrations of the compound, allowing Xcc to proliferate in a highly stressful environment. We have shown that Xanthomonas is able to develop adaptive protection and oxidant-induced cross-protection against H2O2 killing but lacks the ability to develop adaptive protection against OHP and superoxide generators (Mongkolsuk et al. 1997). We then tested if the NaOCl-induced cells were resistant to H2O2 and OHP killing. Figure 4b shows that treatment with NaOCl induced crossprotection against H2O2. The NaOCl pretreated cells were 100-fold more resistant to H2O2 than were the uninduced cells. The ability of the bacterial cultures to degrade exogenous H2O2 was also measured in cultures grown under uninduced and NaOCl-induced conditions. The NaOCl-induced culture could degrade H2O2 at a Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) Charoenlap et al.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Fig. 5. Hydrogen peroxide (H2O2) degradation assay. The rates of H2O2 degradation by Xanthomonas campestris pv. campestris (Xcc) cultivated under uninduced (Œ) and 0.0625% sodium hypochloriteinduced () conditions and a control containing no bacteria (Œ) were determined as described in the Materials and methods. Bacterial cultures were spiked with 200 mol·L–1 H2O2 and the levels of H2O2 remaining in the culture medium were determined at the indicated time points. Three independent experiments were performed, and the means ± SD are shown.
higher rate than could the culture grown under the uninduced condition (Fig. 5). This indicates that the resistance to H2O2 in the NaOCl-induced cells is due to their ability to efficiently metabolize H2O2. This phenotype is in agreement with the ability of NaOCl to induce high levels of expression of genes that encode H2O2 scavenging enzymes (katA, katG, and ahp) (Fig. 1a). Unexpectedly, NaOCl did not induce cross-protection against a lethal dose of tBOOH (data not shown), despite the observation that ohr is one of the most highly induced genes after NaOCl treatment. A mutation analysis has shown that ohr is required for full protection against OHP toxicity in X. campestris (Panmanee et al. 2006). Nonetheless, we have observed that the increased expression of ohr alone from an expression vector did not confer additional resistance to an OHP in wild-type Xcc (data not shown). This phenomenon could be due to several factors, such as the limited availability of the reductant cofactor of the Ohr enzyme. The overall protection against tBOOH toxicity also involves the repair of cellular components that were damaged by OHP and additional factors that are not dependent on the levels of the OHP metabolizing enzymes. Challenging bacterial cultures with sublethal doses of NaOCl increased the transcription of several genes that encode antioxidant enzymes that are members of the OxyR regulon. Adaptive protection against NaOCl and induced cross-protection against H2O2 were also observed after pretreatment with NaOCl. The oxidative stress response that is mediated by the peroxide sensor–regulator OxyR plays a primary role in the ROS-induced cross-protection from NaOCl toxicity.
Acknowledgements This research was supported by grants from Mahidol University and the Center of Excellence on Environmental Health and Toxicology, Science and Technology Postgraduate Education and Research Development Office (PERDO), Ministry of Education, Thailand. The authors thank Sopapan Atichartpongkul for technical support, and James M. Dubbs for a critical reading of the manuscript.
References Alexeyev, M.F. 1999. The pKNOCK series of broad-host-range mobilizable suicide vectors for gene knockout and targeted DNA insertion into the chromosome of gram-negative bacteria. BioTechniques, 26(5): 824–826, 828. PMID:10337469.
7
Charoenlap, N., Eiamphungporn, W., Chauvatcharin, N., Utamapongchai, S., Vattanaviboon, P., and Mongkolsuk, S. 2005. OxyR mediated compensatory expression between ahpC and katA and the significance of ahpC in protection from hydrogen peroxide in Xanthomonas campestris. FEMS Microbiol. Lett. 249(1): 73–78. doi:10.1016/j.femsle.2005.06.002. PMID:15993009. Chauvatcharin, N., Atichartpongkul, S., Utamapongchai, S., Whangsuk, W., Vattanaviboon, P., and Mongkolsuk, S. 2005. Genetic and physiological analysis of the major OxyR-regulated katA from Xanthomonas campestris pv. phaseoli. Microbiology, 151: 597–605. doi:10.1099/mic.0.27598-0. PMID: 15699208. Chesney, J.A., Eaton, J.W., and Mahoney, J.R., Jr. 1996. Bacterial glutathione: a sacrificial defense against chlorine compounds. J. Bacteriol. 178(7): 2131–2135. PMID:8606194. Chi, B.K., Gronau, K., Mader, U., Hessling, B., Becher, D., and Antelmann, H. 2011. S-Bacillithiolation protects against hypochlorite stress in Bacillus subtilis as revealed by transcriptomics and redox proteomics. Mol. Cell. Proteomics. 10(11): M111.009506. doi:10.1074/mcp.M111.009506. PMID:21749987. da Silva, A.C., Ferro, J.A., Reinach, F.C., Farah, C.S., Furlan, L.R., Quaggio, R.B., et al. 2002. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature, 417(6887): 459–463. doi:10.1038/417459a. PMID:12024217. Davies, M.J. 2011. Myeloperoxidase-derived oxidation: mechanisms of biological damage and its prevention. J. Clin. Biochem. Nutr. 48(1): 8–19. doi:10.3164/ jcbn.11-006FR. PMID:21297906. DeFeyter, R., Kado, C.I., and Gabriel, D.W. 1990. Small, stable shuttle vectors for use in Xanthomonas. Gene, 88(1): 65–72. doi:10.1016/0378-1119(90)90060-5. PMID:2341039. Dubbs, J.M., and Mongkolsuk, S. 2012. Peroxide-sensing transcriptional regulators in bacteria. J. Bacteriol. 194(20): 5495–5503. doi:10.1128/JB.00304-12. PMID:22797754. Dukan, S., and Touati, D. 1996. Hypochlorous acid stress in Escherichia coli: resistance, DNA damage, and comparison with hydrogen peroxide stress. J. Bacteriol. 178(21): 6145–6150. PMID:8892812. Dukan, S., Belkin, S., and Touati, D. 1999. Reactive oxygen species are partially involved in the bacteriocidal action of hypochlorous acid. Arch. Biochem. Biophys. 367(2): 311–316. doi:10.1006/abbi.1999.1265. PMID:10395749. Gundlach, J., and Winter, J. 2014. Evolution of Escherichia coli for maximum HOCl resistance through constitutive expression of the OxyR regulon. Microbiology, 160(8): 1690–1704. doi:10.1099/mic.0.074815-0. PMID:24899627. Hawkins, C.L., Pattison, D.I., and Davies, M.J. 2003. Hypochlorite-induced oxidation of amino acids, peptides and proteins. Amino Acids, 25(3–4): 259–274. doi:10.1007/s00726-003-0016-x. PMID:14661089. Heling, I., Rotstein, I., Dinur, T., Szwec-Levine, Y., and Steinberg, D. 2001. Bactericidal and cytotoxic effects of sodium hypochlorite and sodium dichloroisocyanurate solutions in vitro. J. Endod. 27(4): 278–280. doi:10.1097/ 00004770-200104000-00009. PMID:211485267. Jittawuttipoka, T., Buranajitpakorn, S., Vattanaviboon, P., and Mongkolsuk, S. 2009. The catalase-peroxidase KatG is required for virulence of Xanthomonas campestris pv. campestris in a host plant by providing protection against low levels of H2O2. J. Bacteriol. 191(23): 7372–7377. doi:10.1128/JB.00788-09. PMID: 19783631. Jittawuttipoka, T., Sallabhan, R., Vattanaviboon, P., Fuangthong, M., and Mongkolsuk, S. 2010. Mutations of ferric uptake regulator (fur) impair iron homeostasis, growth, oxidative stress survival, and virulence of Xanthomonas campestris pv. campestris. Arch. Microbiol. 192(5): 331–339. doi:10.1007/s00203010-0558-8. PMID:20237769. Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M., II, and Peterson, K.M. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene, 166(1): 175–176. doi:10.1016/0378-1119(95)00584-1. PMID:8529885. McDonnell, G., and Russell, A.D. 1999. Antiseptics and disinfectants: activity, action, and resistance. Clin. Microbiol. Rev. 12(1): 147–179. PMID:9880479. Mongkolsuk, S., Vattanaviboon, P., and Praitaun, W. 1997. Induced adaptive and cross-protection responses against oxidative stress killing in a bacterial phytopathogen, Xanthomonas oryzae pv. oryzae. FEMS Microbiol. Lett. 146: 217–221. doi:10.1016/S0378-1097(96)00479-X. Mongkolsuk, S., Panmanee, W., Atichartpongkul, S., Vattanaviboon, P., Whangsuk, W., Fuangthong, M., et al. 2002. The repressor for an organic peroxide-inducible operon is uniquely regulated at multiple levels. Mol. Microbiol. 44(3): 793–802. doi:10.1046/j.1365-2958.2002.02919.x. PMID:11994159. Panmanee, W., Vattanaviboon, P., Poole, L.B., and Mongkolsuk, S. 2006. Novel organic hydroperoxide-sensing and responding mechanisms for OhrR, a major bacterial sensor and regulator of organic hydroperoxide stress. J. Bacteriol. 188(4): 1389–1395. doi:10.1128/JB.188.4.1389-1395.2006. PMID:16452421. Patikarnmonthon, N., Nawapan, S., Buranajitpakorn, S., Charoenlap, N., Mongkolsuk, S., and Vattanaviboon, P. 2010. Copper ions potentiate organic hydroperoxide and hydrogen peroxide toxicity through different mechanisms in Xanthomonas campestris pv. campestris. FEMS Microbiol. Lett. 313(1): 75–80. doi:10.1111/j.1574-6968.2010.02124.x. PMID:21029152. Peeters, E., Sass, A., Mahenthiralingam, E., Nelis, H., and Coenye, T. 2010. Transcriptional response of Burkholderia cenocepacia J2315 sessile cells to treatments with high doses of hydrogen peroxide and sodium hypochlorite. BMC Genomics, 11: 90. doi:10.1186/1471-2164-11-90. PMID:20137066. Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 8
Vattanaviboon, P., Whangsuk, W., Panmanee, W., Klomsiri, C., Dharmsthiti, S., and Mongkolsuk, S. 2002. Evaluation of the roles that alkyl hydroperoxide reductase and Ohr play in organic peroxide-induced gene expression and protection against organic peroxides in Xanthomonas campestris. Biochem. Biophys. Res. Commun. 299(2): 177–182. doi:10.1016/S0006-291X(02)02602-5. PMID:12437966. Wang, S., Deng, K., Zaremba, S., Deng, X., Lin, C., Wang, Q., et al. 2009. Transcriptomic response of Escherichia coli O157:H7 to oxidative stress. Appl. Environ. Microbiol. 75: 6110–6123. doi:10.1128/AEM.00914-09. PMID:19666735.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Romsang, A., Atichartpongkul, S., Trinachartvanit, W., Vattanaviboon, P., and Mongkolsuk, S. 2013. Gene expression and physiological role of Pseudomonas aeruginosa methionine sulfoxide reductases during oxidative stress. J. Bacteriol. 195(15): 3299–3308. doi:10.1128/JB.00167-13. PMID:23687271. Sally, A.M., Sahin, F., and Rowe, R.C. 1996. Black rot of crucifers. The Ohio State University Extension Fact Sheet HYG-3125-96. Sambrook, J., and Russell, D.W. 2001. Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., USA. Seaver, L.C., and Imlay, J.A. 2001. Alkyl hydroperoxide reductase is the primary scavenger of endogenous hydrogen peroxide in Escherichia coli. J. Bacteriol. 183(24): 7173–7181. doi:10.1128/JB.183.24.7173-7181.2001. PMID:11717276.
Can. J. Microbiol. Vol. 61, 2015
Published by NRC Research Press
ARTICLE
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
The roles of peroxide protective regulons in protecting Xanthomonas campestris pv. campestris from sodium hypochlorite stress Nisanart Charoenlap, Phornphan Sornchuer, Anong Piwkam, Kriangsuk Srijaruskul, Skorn Mongkolsuk, and Paiboon Vattanaviboon
Abstract: The exposure of Xanthomonas campestris pv. campestris to sublethal concentrations of a sodium hypochlorite (NaOCl) solution induced the expression of genes that encode peroxide scavenging enzymes within the OxyR and OhrR regulons. Sensitivity testing in various X. campestris mutants indicated that oxyR, katA, katG, ahpC, and ohr contributed to protection against NaOCl killing. The pretreatment of X. campestris cultures with oxidants, such as hydrogen peroxide (H2O2), t-butyl hydroperoxide, and the superoxide generator menadione, protected the bacteria from lethal concentrations of NaOCl in an OxyR-dependent manner. Treating the bacteria with a low concentration of NaOCl resulted in the adaptive protection from NaOCl killing and also provided cross-protection from H2O2 killing. Taken together, the results suggest that the toxicity of NaOCl is partially mediated by the generation of peroxides and other reactive oxygen species that are removed by primary peroxide scavenging enzymes, such as catalases and AhpC, as a part of an overall strategy that protects the bacteria from the lethal effects of NaOCl. Key words: AhpC, catalase–peroxidase, katA, katG, hypochlorite, OxyR, Xanthomonas. Résumé : L’exposition de Xanthomonas campestris pv. campestris a` des concentrations sous-létales d’une solution d’hypochlorite de sodium (NaOCl) a induit l’expression de gènes codant des enzymes de piégeage de peroxydes situées dans les régulons OxyR et OhrR. Une analyse de la sensibilité de divers mutants de X. campestris a indiqué que oxyR, katA, katG, ahpC et ohr contribuaient a` la protection contre le pouvoir bactéricide du NaOCl. Un prétraitement de cultures de X. campestris avec des oxydants tels le peroxyde d’hydrogène (H2O2), le t-butyl hydroperoxyde et la ménadione (un générateur de superoxyde) a protégé les bactéries contre des concentrations létales de NaOCl et cette activité dépendait de la présence d’OxyR. Lorsqu’on a traité les bactéries avec une faible concentration de NaOCl, on a remarqué une protection adaptative contre la toxicité du NaOCl qui s’est aussi traduite en une meilleure défense contre le H2O2. Dans l’ensemble, les résultats tendent a` démontrer que la toxicité du NaOCl découle en partie de la génération de peroxydes et d’autres réactifs oxygénés qui sont éliminés par les principales enzymes de piégeage de peroxydes comme les catalases et AhpC, et ce, dans le cadre d’une stratégie globale de protection de la bactérie contre les effets létaux du NaOCl. [Traduit par la Rédaction] Mots-clés : AhpC, catalase–peroxydase, katA, katG, hypochlorite, OxyR, Xanthomonas.
Introduction Xanthomonas campestris pv. campestris (Xcc) is a soil bacterium and a phytopathogen that causes black rot on cruciferous crops worldwide. Most X. campestris infections originate from planting infected seeds (Sally et al. 1996). Treating the crucifer seeds with disinfectants, such as a sodium hypochlorite (NaOCl) solution, is an effective strategy to eradicate the bacterial contamination before the seeds are planted (Sally et al. 1996). In aqueous solutions, NaOCl ionizes to generate Na+ and hypochlorite (OCl–) that is then transformed into hypochlorous acid (HOCl). The lethal effect of HOCl is believed to be partially due to the disruption of oxidative phosphorylation and the oxidation of macromolecules (McDonnell and Russell 1999). A global transcriptome analysis revealed that the treatment of bacteria with NaOCl
results in the increased expression of genes that are involved in oxidative stress protection (Wang et al. 2009; Peeters et al. 2010), implying that the treatment generates intracellular reactive oxygen species (ROS) that are responsible for the changes in gene expression. Moreover, several genes that mediate resistance to oxidative stress, for example, genes in the OxyR and IscR regulons, have been shown to be involved in protecting bacterial cells from HOCl killing (Dukan and Touati 1996; Romsang et al. 2013; Gundlach and Winter 2014). Accordingly, there is a strong link between oxidative stress and HOCl toxicity. There are 2 major peroxide protective regulons in X. campestris that are regulated by the peroxide-sensing transcription regulators OxyR and OhrR. These transcriptional regulators sense increased levels of peroxides and coordinate the expression of their
Received 28 November 2014. Revision received 17 February 2015. Accepted 3 March 2015. N. Charoenlap, P. Sornchuer, and K. Srijaruskul. Laboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok 10210, Thailand. A. Piwkam. Program in Applied Biological Science: Environmental Health, Chulabhorn Graduate Institute, Bangkok, Thailand. S. Mongkolsuk. Laboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok 10210, Thailand; Department of Biotechnology and Center for Emerging Bacterial Infections, Faculty of Science, Mahidol University, Bangkok, Thailand; Center of Excellence on Environmental Health and Toxicology, Commission on Higher Education, Ministry of Education, Bangkok, Thailand. P. Vattanaviboon. Laboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok 10210, Thailand; Program in Applied Biological Science: Environmental Health, Chulabhorn Graduate Institute, Bangkok, Thailand; Center of Excellence on Environmental Health and Toxicology, Commission on Higher Education, Ministry of Education, Bangkok, Thailand. Corresponding author: Paiboon Vattanaviboon (e-mail: [email protected]). Can. J. Microbiol. 61: 1–8 (2015) dx.doi.org/10.1139/cjm-2014-0792
Published at www.nrcresearchpress.com/cjm on 6 March 2015.
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 2
Can. J. Microbiol. Vol. 61, 2015
Table 1. Bacterial strains and plasmids used in this study.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Strain and plasmid Strains Xanthomonas campestris Wild-type Strain containing mutation in: ahpC katA katG ohr ohrR oxyR Plasmids pKNOCK pBBR1MCS-4 pAhpC pKatA pKatG pOxyR
Description
Source
X. campestris pv. campestris ATCC 33913
da Silva et al. 2002
ahpC::pKNOCK-Km katA::pKNOCK-Gm katG::pKNOCK-Km ohr::tet ohrR::pKNOCK-Km oxyR::pKNOCK-Km
Patikarnmonthon et al. 2010 Jittawuttipoka et al. 2009 Jittawuttipoka et al. 2009 This study This study Jittawuttipoka et al. 2009
Suicide vector; RP4 oriT, R6 K ␥-ori, Broad-host-range cloning vector; rep, mob, lacZ␣, Apr pBBR1MCS-4 containing ATCC 22913 ahpC pBBR1MCS-4 containing ATCC 22913 katA pBBR1MCS-4 containing ATCC 22913 katG pBBR1MCS-4 containing ATCC 22913 oxyR
Alexeyev 1999 Kovach et al. 1995 Patikarnmonthon et al. 2010 Jittawuttipoka et al. 2009 Jittawuttipoka et al. 2009 Jittawuttipoka et al. 2009
target genes to minimize the damage caused by the hostile conditions. Xanthomonas OxyR is a H2O2 sensor and a transcriptional regulator of the katA, katG, and ahpC genes, which encode a monofunctional catalase, catalase-peroxidase, and alkyl hydroperoxide reductase, respectively (Charoenlap et al. 2005; Chauvatcharin et al. 2005; Jittawuttipoka et al. 2009). OhrR senses organic hydroperoxides (OHP) and regulates the gene ohr, which encodes a thiol peroxidase-like enzyme (Panmanee et al. 2006). In this communication, we evaluated the role of these peroxide protective regulons in the protection of Xcc from NaOCl toxicity. Our findings provide an insight into the mechanisms that are responsible for NaOCl toxicity and for the induced adaptive resistance to NaOCl in Xcc. Moreover, the presence of NaOCl-induced crossprotection against H2O2 suggests that exposure of Xcc to a nonlethal dose of NaOCl may affect plant–microbe interaction given that H2O2 is among the first line of plant defense responses.
Materials and methods Bacterial strains and growth conditions The Xcc wild-type strain ATCC 33913 and mutants (Table 1) were cultured aerobically in Silva–Buddenhagen (SB) medium (Patikarnmonthon et al. 2010) at 28 °C. Molecular genetics techniques Molecular genetics techniques were performed using standard protocols (Sambrook and Russell 2001). Xcc was transformed by electroporation as previously described (Patikarnmonthon et al. 2010). The plasmids and primer sequences used in this study are shown in Tables 1 and 2, respectively. Construction of ohr and ohrR mutants The ohrR mutant was constructed using the pKNOCK suicide plasmid system (Alexeyev 1999). An ohrR gene fragment was PCR amplified from Xcc genomic DNA with the primers BT1602 and BT1603 that were designed according to xcc0263 sequence (da Silva et al. 2002). A 200 bp PCR product was cloned into the vector pGemT-Easy (Promega, USA), and the SalI–SacII fragment was subcloned into pKNOCK-Km to generate the plasmid pKNOCK-ohrR. The recombinant plasmid was transformed into the wild-type cells and the putative ohrR mutants were selected by kanamycin resistance phenotype. The ohrR mutant was confirmed by Southern blot analysis (data not shown). The ohr mutant was constructed using the gene replacement method. The DNA sequences flanking the putative ohr gene (xcc0264) were PCR amplified from Xcc genomic DNA with the
Table 2. Primers used in this study. Primer
Sequence (5= ¡ 3=)
BT1413 BT1414 BT1602 BT1603 BT1834 BT1835 BT1836 BT1837 BT2237 BT2238 BT2239 BT2240 BT2684 BT2685 BT2781 BT2782 BT2808 BT2809
GTCGTGCCGCGACAGCGG GCATCCGCGAGCGTTTTC CCTGACCTATCCGCAGTA CGGCATCGGCAAGCCCGA GCGGCATTTTGTGGGACT CCATGGTGGTTCTCCTGAGT ACTCAGGAGAACCACCATGGCCTGAAGCTTTCCCGGAT TCGGTGGTGTAGCTGTCC GGCCAGGTCGTCCGGCTT GAATCCACCCGCACGCTG TCTGCTTGCCACCGGACT TGTGGGAGGACCCGATCC CGCAGCGTCTCGGTGACG AGTGGAAGACGCCGCTGA GCCCGCACAAGCGGTGGAG ACGTCATCCCCACCTTCCT GCACCAACCCGGAGCAGC TACGGGCACACCTGGTGG
primer pair BT1834 and BT1835 and primer pair BT1836 and BT1837 to yield the fragments OhrUP (1.1 kb) and OhrDOWN (0.7 kb), respectively. The BT1836 primer sequence contains a HindIII site and a sequence that is complementary to that of BT1835. The OhrUP and OhrDOWN fragments were mixed together, denatured, annealed, and extended, and the mixture was used as the template in a PCR reaction with the primers BT1834 and BT1837 and Pfu DNA polymerase to generate a PCR product with blunt ends. This PCR product was cloned into the HincII and EcoRV sites of the vector pBluescript II KS (Stratagene, USA) to produce pOhrUP-DOWN. Next, the tetracycline resistance gene released by the HindIII digestion of pUFR027tet, a derivative of pUFR027 (DeFeyter et al. 1990), was inserted at the HindIII site between the OhrUP and OhrDOWN sequences in pOhrUP-DOWN to yield the plasmid pOhr::tet. This plasmid was then electroporated into the Xcc wild type. A double cross-over between the plasmid-borne OhrUP–OhrDOWN sequences and their counterparts on the Xcc chromosome led to the replacement of the ohr gene with the tet gene. Transformants were selected based on their Tcr and Aps phenotypes, and the ohr mutation was confirmed by Southern blot analysis. Real-time reverse transcription – polymerase chain reaction (qRT–PCR) The exponential growth cultures were challenged with 0.0625 and 0.0313% (m/v) NaOCl for 15 min. Bacterial cells from the uninPublished by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI)
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Charoenlap et al.
3
duced and NaOCl-induced cultures were collected. The total RNA was prepared and qRT–PCR was performed as described (Jittawuttipoka et al. 2010). The reverse transcription reaction was conducted with a RevertAidTM M-MuLV Reverse Transcriptase kit (Fermentas) using random hexamers according to the manufacturer’s recommendation. The specific primer pairs for ahpC (BT2684 and BT2685), katG (BT2239 and BT2240), katA (BT2237 and BT2238), ohr (BT1602 and BT1603), and the 16S rRNA (BT2781 and BT2782) are listed in Table 2. The qRT–PCR was performed with a specific primer pair using SYBR green PCR Master Mix (Applied Biosystems), and Xcc 16S rRNA gene was used as the normalizing gene. The relative expression analysis was executed using StepOne software version 2.1, and the gene expression levels were presented as the fold change in expression relative to the uninduced Xcc wild-type culture.
®
Determination of minimal inhibitory concentration (MIC) of NaOCl The MIC of NaOCl for Xcc was determined using the broth dilution method as previously described (Heling et al. 2001). Bacterial suspensions in SB broth containing a NaOCl solution (12.5% (m/v), Ajax Finechem) at final concentrations of 0.25%, 0.125%, 0.0625%, 0.0313%, 0.0156%, and 0.008% were incubated overnight at 28 °C with shaking at 150 r·min–1. The MIC was defined as the lowest concentration of NaOCl at which no bacterial growth was measured. Determination of resistance to NaOCl Exponential-phase cultures of Xcc strains were treated with 0.1% (m/v) concentrations of NaOCl for 30 min. After treatment, the cultures were 10-fold serially diluted and 10 L of each dilution was spotted onto SB medium. The plates were incubated at 28 °C for 2 days before the colonies were counted. The survival percentage was determined by dividing the colony-forming units (CFUs) of the NaOCl-treated culture with the CFUs of the untreated control and multiplying by 100. Induced adaptive and cross-protection responses NaOCl-induced adaptation was achieved by pretreating exponential cultures with 0.0625% NaOCl for 30 min, and oxidantinduced cross-protection against NaOCl was carried out by pretreating cells with 100 mol·L–1 H2O2, t-butyl hydroperoxide (tBOOH), and menadione for 30 min (Chauvatcharin et al. 2005). The pretreated cultures were washed once with fresh SB medium before being subjected to killing concentrations of 0.05%, 0.1%, 0.15%, and 0.2% NaOCl for 30 min. The NaOCl-induced crossprotection from oxidants was determined by treating the NaOClinduced cultures with killing concentrations of H2O2 (20, 30, and 40 mmol·L–1), tBOOH (50, 100, and 150 mmol·L–1), and menadione (100, 200, and 300 mmol·L–1) for 30 min. The cells that survived the treatment were scored using viable cell counting on SB medium. H2O2 degradation assay The ability of the bacteria to metabolize H2O2 was measured using a modified ferrous oxidation – xylenol orange (FOX) assay (Vattanaviboon et al. 2002). Exponential-phase cultures were adjusted to an OD600 of 0.5 prior to adding H2O2 at a final concentration of 200 mol·L–1. The residual peroxide was monitored at 1 min intervals for 5 min. The concentration of residual H2O2 was calculated from a standard curve generated from medium containing known peroxide concentrations. GSH and GSSG assay The ratios of reduced glutathione (GSH) per oxidized glutathione (GSSG) in cells were monitored using the GSH/GSSG-Glo™ assay (Promega) according to the manufacturer's protocol.
Catalase activity assay Catalase activity was measured via the decomposition of H2O2 by monitoring the absorbance at a wavelength of 240 nm (Chauvatcharin et al. 2005). One unit of catalase was defined as the amount of enzyme capable of catalyzing the turnover of 1 mol of H2O2 per minute under the assay conditions.
Results and discussion Exposure to NaOCl solution upregulates genes in peroxide protective regulons NaOCl solution is a versatile antiseptic that is used in hospitals as well as in agriculture to disinfect the surface of seeds. The MIC of NaOCl for Xcc was determined and found to be 0.125% (equivalent to 1250 mg·L−1). The effects of sub-MIC concentrations of NaOCl (0.0313% and 0.0625%) on the expression of the katA, katG, ahpC, and ohr genes, which encode a monofunctional catalase, a catalase-peroxidase, an alkyl hydroperoxide reductase, and a thiol peroxidase-like enzyme, respectively, were determined using qRT–PCR. The treatment of the bacterial cultures with 0.0625% NaOCl increased the expression of ahpC, katA, katG, and ohr by 5.5- ± 1.5-, 5.4- ± 1.4-, 3.3- ± 0.6-, and 25.7- ± 2.4-fold, respectively, over the expression levels of uninduced culture. Treating the cultures with 0.0313% NaOCl also induced the expression of all of the antioxidant genes tested, but the expression levels were much lower than after treatment with 0.0625% NaOCl (Fig. 1a). NaOCl at a concentration of 0.0313% might not reach sufficient levels for full induction of the NaOCl regulatory response. The expression of ohr showed the highest level of induction by NaOCl treatment, and ahpC, katA, and katG were induced to similar magnitudes by the treatment. Typically, the expression of katA, katG, and ahpC is controlled by OxyR, and these genes are induced in response to exposure to H2O2, OHP, and redox cycling drugs (Chauvatcharin et al. 2005; Jittawuttipoka et al. 2009). The expression of ohr is regulated by OhrR, an OHP sensor and transcriptional regulator that primarily responds to OHP (Panmanee et al. 2006). The gene expression profiles suggest that the treatment of bacterial cultures with NaOCl could lead to the generation and accumulation of intracellular peroxides to the levels sufficient to oxidize OxyR and OhrR. The precise mechanisms by which NaOCl generates ROS are unclear, but several reports have shown a strong linkage between exposure to NaOCl and the oxidative stress response (Dukan and Touati 1996; Wang et al. 2009; Gundlach and Winter 2014). HOCl, a highly reactive oxidant generated from dissolved NaOCl, is capable of reacting with intracellular compounds and affects metabolic processes, including oxidative phosphorylation (McDonnell and Russell 1999). Antioxidant enzymes and molecules such as superoxide dismutases, catalases and glucose-6-phosphate dehydrogenase are highly susceptible to inactivation by HOCl (Dukan et al. 1999). Inactivation of these enzymes gives rise to the accumulation of ROS. Disruption of cellular redox balance appears to be one of the toxic effects of HOCl exposure (Davies 2011). GSH is believed to play a direct role in detoxification of HOCl. GSH is directly oxidized by HOCl to form GSSG, the oxidized glutathione. Depletion of GSH renders the bacteria more vulnerable to oxidative stress (Chesney et al. 1996). The involvement of GSH redox status in NaOCl protection was investigated through determination of the GSH/GSSG ratio. The results showed that the GSH/GSSG ratio was considerably decreased in response to NaOCl exposure, from a level of 24.9 ± 1.8 in uninduced cells to 0.8 ± 0.1 in the NaOClpretreated cells (Fig. 1b). Thus, pretreatment with NaOCl drastically reduces intracellular GSH levels that would lead to accumulation of ROS. OxyR and OhrR are thiol-based transcriptional regulators (Dubbs and Mongkolsuk 2012). Xanthomonas OhrR repressor belongs to the 2-Cys subfamily in which oxidation of OhrR occurs Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 4
Can. J. Microbiol. Vol. 61, 2015
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Fig. 1. The effects of sodium hypochlorite (NaOCl) on expression of genes that encode peroxide scavenging enzymes and reduced glutathione/oxidized glutathione (GSH/GSSG) ratio. (a) The relative expression levels of ahpC, ohr, katA, and katG in Xanthomonas campestris pv. campestris (Xcc) in response to exposure to 0.0625% (shaded bars) and 0.0313% (open bars) NaOCl were determined using qRT–PCR. The relative expression values over the uninduced levels are shown. (b) The GSH/GSSG ratio in Xcc treated with 0.0625% NaOCl (shaded bar) and the untreated control (UN, open bar) were determined. Three independent experiments were performed and the means ± SD are shown.
through oxidizing of the sensing cysteine and a subsequent sulfide bond formation with a resolving cysteine (Panmanee et al. 2006). In addition to ROS-mediated disulfide bond formation between 2 conserved cysteine residues (Cys-199 and Cys-208) that activate OxyR, reactive nitrogen species generating agents S-nitrosoglutathione and S-nitrosocysteine, and GSSG are capable of oxidizing and activating OxyR (Dubbs and Mongkolsuk 2012). Thus, we cannot rule out the possibility that HOCl directly oxidizes the OxyR and OhrR regulators leading to upregulation of genes in the regulons. The thiol group of cysteine residues reacts with HOCl to yield an unstable sulfenyl chloride intermediate that would undergo reaction with another thiol to form a disulfide bond (Hawkins et al. 2003; Davies 2011). Direct HOCl-mediated oxidation of protein thiols has been experimentally demonstrated (Chi et al. 2011). Indeed, OhrR has been shown to be susceptible to direct oxidation and inactivated by HOCl (Chi et al. 2011; Dubbs and Mongkolsuk 2012). Catalases and AhpC protect X. campestris from NaOCl toxicity The protective role of the individual genes that encode peroxide scavenging enzymes was evaluated through the use of gene knockout mutants. The NaOCl resistance levels in various mutants were determined. Among the genes in the OxyR regulon, the inactivation of katA and ahpC substantially reduced NaOCl resistance by 100-fold relative to wild-type levels, while a katG mutant was 10-fold less resistant than the parental strain (Fig. 2). The increased susceptibility to NaOCl observed for the katA, katG, oxyR mutants could be complemented by ectopic expression of each individual gene from the vector pBBR1MCS plasmid (Fig. 2). The only exception was that the complementation of an ahpC mutant with pAhpC was unable to restore the NaOCl-sensitive phenotype of the mutant. The high expression level of AhpC from the pAhpC plasmid led to a compensatory decrease in KatA and KatG levels (Jittawuttipoka et al. 2009). The compensatory expression between ahpC and catalases is modulated by OxyR (Charoenlap et al. 2005; Jittawuttipoka et al. 2009). The decrease in total catalase
Table 3. Total catalase activity in Xanthomonas campestris pv. campestris strains. Strain Wild-type Strain containing mutation in: ahpC/pAhpC oxyR katA katG
Catalase (U·(mg protein)–1)
Reference
6.1±0.5
This study
2.1±0.4 3.6±0.4 1.2±0.3
This study This study Jittawuttipoka et al. 2009 Jittawuttipoka et al. 2009
4.7±0.5
activity from 6.1 ± 0.5 U·(mg protein)−1 in the wild-type cells to 2.1 ± 0.4 U·(mg protein)−1 in the ahpC mutant complemented with pAhpC is likely responsible for the inability of pAhpC to complement the NaOCl-sensitive phenotype of the ahpC mutant (Table 3). The results clearly show the contribution of katA, katG, and ahpC to the overall protection of the bacteria from NaOCl. Because these genes encode peroxide scavenging enzymes that belong to the OxyR regulon, we examined the NaOCl resistance level in an oxyR mutant and found that it had the lowest resistance levels to NaOCl killing compared with the katA, katG, and ahpC single mutants (Fig. 2). Nonetheless, the genes that encode the peroxide scavenging enzymes have unequal roles in the NaOCl protective process. Although the expression of katA, katG, and ahpC are all regulated by OxyR, they have differing patterns of expression in the oxyR mutant. The total catalase activity of the oxyR mutant (3.6 ± 0.4 U·(mg protein)−1) is lower than that of the wild-type strain (6.1 ± 0.5 U·(mg protein)−1) but it is still much higher than the levels attained for the katA single mutant (1.2 ± 0.3 U·(mg protein)−1) (Table 3). It is unlikely that decreased catalase activity of the oxyR mutant could account for the decreased resistance to NaOCl. Hence, in addition to ahpC, katA, and katG, other genes in the OxyR regulon as well as the ability of OxyR to sense oxidative stress and Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) Charoenlap et al.
5
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Fig. 2. The levels of sodium hypochlorite (NaOCl) resistance in various Xanthomonas campestris pv. campestris (Xcc) strains. Exponential-phase cultures of various mutant strains that were deficient in antioxidant enzymes were treated with 0.1% NaOCl for 30 min. Three independent experiments were performed, and the means ± SD are shown. The asterisk (*) indicates statistically significant differences (P < 0.05) compared with the wild-type level, as determined by Student's t test.
activate the transcription of genes in its regulon all contribute to the overall protection against NaOCl toxicity. The NaOCl hypersensitive phenotype of the oxyR mutant is likely a consequence of losing its ability to adaptively induce its target genes during exposure to NaOCl rather than of a reduction in total catalase activity. Because the expression of ohr was highly induced by the NaOCl treatment, the resistance levels in the ohrR and ohr single mutants were determined. Ohr utilizes OHP as substrates at an efficiency that is several-fold higher than its ability to utilize H2O2. As shown in Fig. 2, there was no significant difference in the resistance levels between the Xcc wild-type strain and the ohrR or ohr mutants, indicating that this system is minimally protective against NaOCl. However, when the NaOCl resistance level in the ahpC–ohr double mutant was determined, we found that the double mutant was roughly 10-fold more sensitive than the ahpC single mutant. This result suggests that Ohr probably contributes to protection from NaOCl toxicity. In Xanthomonas, Ohr is maintained at relatively high levels (Mongkolsuk et al. 2002). Ohr and, to a lesser extent, AhpC are essential for OHP resistance (Vattanaviboon et al. 2002). NaOCl exposure might generate both OHP and H2O2 at levels that are able to activate OhrR and OxyR but are insufficient to cause cell death. We presume that AhpC mainly contributes to the protection against NaOCl toxicity through its ability to detoxify H2O2 as well as OHP generated by the NaOCl treatment (Seaver and Imlay 2001). Pretreatments with oxidants induce cross-protection from NaOCl solution The ability to induce protection against lethal concentrations of chemicals is a crucial physiological response in bacteria. We performed experiments to determine whether pretreatment with a sublethal concentration of oxidants could induce cross-protection
from a subsequent exposure to a killing concentration of NaOCl. All of the pretreatments with tBOOH, H2O2, and menadione resulted in cells that were greater than 100-fold more resistant to the 0.2% NaOCl treatment than the uninduced culture (Fig. 3a). The ability of the different oxidants to induce cross-protection against NaOCl killing strongly suggests that the overall oxidative stress response has an important physiological role in protecting the bacteria from NaOCl toxicity. At the inducing concentrations of oxidants used, ohrR–ohr induction is specific to tBOOH while menadione, tBOOH, and H2O2 are all potent inducers of the OxyR regulon in X. campestris (Panmanee et al. 2006; Jittawuttipoka et al. 2009). Thus, more conclusive experiments were conducted to elucidate which regulons provide the peroxide-induced crossprotection against NaOCl killing. The roles of oxyR and ohrR in the induction of cross-protection against hypochlorite were tested. The results revealed that the tBOOH-, H2O2-, and menadioneinduced cross-protection from NaOCl were abolished in the oxyR mutant (Fig. 3b), whereas the tBOOH-induced cross-protection from NaOCl was not affected by the inactivation of ohrR. These results indicated the physiological function of OxyR in sensing oxidants and activating genes in its regulon that confers protection against NaOCl killing. The observation is consistent with our findings that the loss of OxyR rendered the bacteria more sensitive to NaOCl than the loss of individual genes in the OxyR regulon. In E. coli, OxyR is thought to contribute to HOCl protection (Dukan and Touati 1996; Gundlach and Winter 2014). In addition to the importance of transcriptional sensors and regulators, we believe that the induction of individual genes that encode peroxide scavenging enzymes, i.e., ahpC, katA, and katG, is also responsible for the oxidant-induced cross-protection from lethal concentrations of NaOCl. These genes individually contribute to NaOCl resistance (Fig. 2). The level of total catalase activity in cell Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 6
Can. J. Microbiol. Vol. 61, 2015
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Fig. 3. Oxidants induce cross-protection against sodium hypochlorite (NaOCl) killing. Exponential-phase cells of Xanthomonas campestris pv. campestris (Xcc) wild-type (a) and oxyR mutant (b) cultivated under uninduced condition (Œ) and under induction with 100 mol·L–1 hydrogen peroxide (), t-butyl hydroperoxide (Œ), and menadione () were treated with indicated concentrations of NaOCl for 30 min. Three independent experiments were performed, and the means ± standard deviation are shown.
Fig. 4. Sodium hypochlorite (NaOCl) induces adaptive protection and cross-protection against hydrogen peroxide (H2O2). Exponential-phase Xanthomonas campestris pv. campestris (Xcc) wild-type cells were grown under uninduced conditions (Œ) and inducing conditions with 0.0625% NaOCl () and were subsequently treated with killing concentrations of NaOCl (a) or H2O2 (b) for 30 min. Three independent experiments were performed, and the means ± SD are shown.
lysates prepared from the cultures pretreated with tBOOH, menadione, and H2O2 were 3.1-, 3.2-, and 2.8-fold greater, respectively, than the catalase levels in the uninduced culture (data not shown). Hence, the upregulation of catalases and (or) AhpC contributes to NaOCl resistance in the cells that were pretreated with oxidants. NaOCl pretreatment induces adaptive protection and crossprotection against oxidants NaOCl treatment is a strong inducer of the oxidative stress response. Experiments were performed to assess whether Xcc could develop adaptive protection against NaOCl toxicity. The exponential-phase cultures were pretreated with 0.0625% NaOCl and subsequently challenged with killing doses of NaOCl. The NaOCl-pretreated cells were 10-fold more resistant to NaOCl killing than the uninduced control was (Fig. 4a). This phenotype can most likely be attributed to the ability of NaOCl to induce genes in the OxyR regulon (Fig. 1a) that then conferred protection against
the lethal doses of NaOCl. At the physiological level, prior exposure to a low level of NaOCl can induce an adaptive protection against subsequent exposure to lethal concentrations of the compound, allowing Xcc to proliferate in a highly stressful environment. We have shown that Xanthomonas is able to develop adaptive protection and oxidant-induced cross-protection against H2O2 killing but lacks the ability to develop adaptive protection against OHP and superoxide generators (Mongkolsuk et al. 1997). We then tested if the NaOCl-induced cells were resistant to H2O2 and OHP killing. Figure 4b shows that treatment with NaOCl induced crossprotection against H2O2. The NaOCl pretreated cells were 100-fold more resistant to H2O2 than were the uninduced cells. The ability of the bacterial cultures to degrade exogenous H2O2 was also measured in cultures grown under uninduced and NaOCl-induced conditions. The NaOCl-induced culture could degrade H2O2 at a Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) Charoenlap et al.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Fig. 5. Hydrogen peroxide (H2O2) degradation assay. The rates of H2O2 degradation by Xanthomonas campestris pv. campestris (Xcc) cultivated under uninduced (Œ) and 0.0625% sodium hypochloriteinduced () conditions and a control containing no bacteria (Œ) were determined as described in the Materials and methods. Bacterial cultures were spiked with 200 mol·L–1 H2O2 and the levels of H2O2 remaining in the culture medium were determined at the indicated time points. Three independent experiments were performed, and the means ± SD are shown.
higher rate than could the culture grown under the uninduced condition (Fig. 5). This indicates that the resistance to H2O2 in the NaOCl-induced cells is due to their ability to efficiently metabolize H2O2. This phenotype is in agreement with the ability of NaOCl to induce high levels of expression of genes that encode H2O2 scavenging enzymes (katA, katG, and ahp) (Fig. 1a). Unexpectedly, NaOCl did not induce cross-protection against a lethal dose of tBOOH (data not shown), despite the observation that ohr is one of the most highly induced genes after NaOCl treatment. A mutation analysis has shown that ohr is required for full protection against OHP toxicity in X. campestris (Panmanee et al. 2006). Nonetheless, we have observed that the increased expression of ohr alone from an expression vector did not confer additional resistance to an OHP in wild-type Xcc (data not shown). This phenomenon could be due to several factors, such as the limited availability of the reductant cofactor of the Ohr enzyme. The overall protection against tBOOH toxicity also involves the repair of cellular components that were damaged by OHP and additional factors that are not dependent on the levels of the OHP metabolizing enzymes. Challenging bacterial cultures with sublethal doses of NaOCl increased the transcription of several genes that encode antioxidant enzymes that are members of the OxyR regulon. Adaptive protection against NaOCl and induced cross-protection against H2O2 were also observed after pretreatment with NaOCl. The oxidative stress response that is mediated by the peroxide sensor–regulator OxyR plays a primary role in the ROS-induced cross-protection from NaOCl toxicity.
Acknowledgements This research was supported by grants from Mahidol University and the Center of Excellence on Environmental Health and Toxicology, Science and Technology Postgraduate Education and Research Development Office (PERDO), Ministry of Education, Thailand. The authors thank Sopapan Atichartpongkul for technical support, and James M. Dubbs for a critical reading of the manuscript.
References Alexeyev, M.F. 1999. The pKNOCK series of broad-host-range mobilizable suicide vectors for gene knockout and targeted DNA insertion into the chromosome of gram-negative bacteria. BioTechniques, 26(5): 824–826, 828. PMID:10337469.
7
Charoenlap, N., Eiamphungporn, W., Chauvatcharin, N., Utamapongchai, S., Vattanaviboon, P., and Mongkolsuk, S. 2005. OxyR mediated compensatory expression between ahpC and katA and the significance of ahpC in protection from hydrogen peroxide in Xanthomonas campestris. FEMS Microbiol. Lett. 249(1): 73–78. doi:10.1016/j.femsle.2005.06.002. PMID:15993009. Chauvatcharin, N., Atichartpongkul, S., Utamapongchai, S., Whangsuk, W., Vattanaviboon, P., and Mongkolsuk, S. 2005. Genetic and physiological analysis of the major OxyR-regulated katA from Xanthomonas campestris pv. phaseoli. Microbiology, 151: 597–605. doi:10.1099/mic.0.27598-0. PMID: 15699208. Chesney, J.A., Eaton, J.W., and Mahoney, J.R., Jr. 1996. Bacterial glutathione: a sacrificial defense against chlorine compounds. J. Bacteriol. 178(7): 2131–2135. PMID:8606194. Chi, B.K., Gronau, K., Mader, U., Hessling, B., Becher, D., and Antelmann, H. 2011. S-Bacillithiolation protects against hypochlorite stress in Bacillus subtilis as revealed by transcriptomics and redox proteomics. Mol. Cell. Proteomics. 10(11): M111.009506. doi:10.1074/mcp.M111.009506. PMID:21749987. da Silva, A.C., Ferro, J.A., Reinach, F.C., Farah, C.S., Furlan, L.R., Quaggio, R.B., et al. 2002. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature, 417(6887): 459–463. doi:10.1038/417459a. PMID:12024217. Davies, M.J. 2011. Myeloperoxidase-derived oxidation: mechanisms of biological damage and its prevention. J. Clin. Biochem. Nutr. 48(1): 8–19. doi:10.3164/ jcbn.11-006FR. PMID:21297906. DeFeyter, R., Kado, C.I., and Gabriel, D.W. 1990. Small, stable shuttle vectors for use in Xanthomonas. Gene, 88(1): 65–72. doi:10.1016/0378-1119(90)90060-5. PMID:2341039. Dubbs, J.M., and Mongkolsuk, S. 2012. Peroxide-sensing transcriptional regulators in bacteria. J. Bacteriol. 194(20): 5495–5503. doi:10.1128/JB.00304-12. PMID:22797754. Dukan, S., and Touati, D. 1996. Hypochlorous acid stress in Escherichia coli: resistance, DNA damage, and comparison with hydrogen peroxide stress. J. Bacteriol. 178(21): 6145–6150. PMID:8892812. Dukan, S., Belkin, S., and Touati, D. 1999. Reactive oxygen species are partially involved in the bacteriocidal action of hypochlorous acid. Arch. Biochem. Biophys. 367(2): 311–316. doi:10.1006/abbi.1999.1265. PMID:10395749. Gundlach, J., and Winter, J. 2014. Evolution of Escherichia coli for maximum HOCl resistance through constitutive expression of the OxyR regulon. Microbiology, 160(8): 1690–1704. doi:10.1099/mic.0.074815-0. PMID:24899627. Hawkins, C.L., Pattison, D.I., and Davies, M.J. 2003. Hypochlorite-induced oxidation of amino acids, peptides and proteins. Amino Acids, 25(3–4): 259–274. doi:10.1007/s00726-003-0016-x. PMID:14661089. Heling, I., Rotstein, I., Dinur, T., Szwec-Levine, Y., and Steinberg, D. 2001. Bactericidal and cytotoxic effects of sodium hypochlorite and sodium dichloroisocyanurate solutions in vitro. J. Endod. 27(4): 278–280. doi:10.1097/ 00004770-200104000-00009. PMID:211485267. Jittawuttipoka, T., Buranajitpakorn, S., Vattanaviboon, P., and Mongkolsuk, S. 2009. The catalase-peroxidase KatG is required for virulence of Xanthomonas campestris pv. campestris in a host plant by providing protection against low levels of H2O2. J. Bacteriol. 191(23): 7372–7377. doi:10.1128/JB.00788-09. PMID: 19783631. Jittawuttipoka, T., Sallabhan, R., Vattanaviboon, P., Fuangthong, M., and Mongkolsuk, S. 2010. Mutations of ferric uptake regulator (fur) impair iron homeostasis, growth, oxidative stress survival, and virulence of Xanthomonas campestris pv. campestris. Arch. Microbiol. 192(5): 331–339. doi:10.1007/s00203010-0558-8. PMID:20237769. Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M., II, and Peterson, K.M. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene, 166(1): 175–176. doi:10.1016/0378-1119(95)00584-1. PMID:8529885. McDonnell, G., and Russell, A.D. 1999. Antiseptics and disinfectants: activity, action, and resistance. Clin. Microbiol. Rev. 12(1): 147–179. PMID:9880479. Mongkolsuk, S., Vattanaviboon, P., and Praitaun, W. 1997. Induced adaptive and cross-protection responses against oxidative stress killing in a bacterial phytopathogen, Xanthomonas oryzae pv. oryzae. FEMS Microbiol. Lett. 146: 217–221. doi:10.1016/S0378-1097(96)00479-X. Mongkolsuk, S., Panmanee, W., Atichartpongkul, S., Vattanaviboon, P., Whangsuk, W., Fuangthong, M., et al. 2002. The repressor for an organic peroxide-inducible operon is uniquely regulated at multiple levels. Mol. Microbiol. 44(3): 793–802. doi:10.1046/j.1365-2958.2002.02919.x. PMID:11994159. Panmanee, W., Vattanaviboon, P., Poole, L.B., and Mongkolsuk, S. 2006. Novel organic hydroperoxide-sensing and responding mechanisms for OhrR, a major bacterial sensor and regulator of organic hydroperoxide stress. J. Bacteriol. 188(4): 1389–1395. doi:10.1128/JB.188.4.1389-1395.2006. PMID:16452421. Patikarnmonthon, N., Nawapan, S., Buranajitpakorn, S., Charoenlap, N., Mongkolsuk, S., and Vattanaviboon, P. 2010. Copper ions potentiate organic hydroperoxide and hydrogen peroxide toxicity through different mechanisms in Xanthomonas campestris pv. campestris. FEMS Microbiol. Lett. 313(1): 75–80. doi:10.1111/j.1574-6968.2010.02124.x. PMID:21029152. Peeters, E., Sass, A., Mahenthiralingam, E., Nelis, H., and Coenye, T. 2010. Transcriptional response of Burkholderia cenocepacia J2315 sessile cells to treatments with high doses of hydrogen peroxide and sodium hypochlorite. BMC Genomics, 11: 90. doi:10.1186/1471-2164-11-90. PMID:20137066. Published by NRC Research Press
Pagination not final (cite DOI) / Pagination provisoire (citer le DOI) 8
Vattanaviboon, P., Whangsuk, W., Panmanee, W., Klomsiri, C., Dharmsthiti, S., and Mongkolsuk, S. 2002. Evaluation of the roles that alkyl hydroperoxide reductase and Ohr play in organic peroxide-induced gene expression and protection against organic peroxides in Xanthomonas campestris. Biochem. Biophys. Res. Commun. 299(2): 177–182. doi:10.1016/S0006-291X(02)02602-5. PMID:12437966. Wang, S., Deng, K., Zaremba, S., Deng, X., Lin, C., Wang, Q., et al. 2009. Transcriptomic response of Escherichia coli O157:H7 to oxidative stress. Appl. Environ. Microbiol. 75: 6110–6123. doi:10.1128/AEM.00914-09. PMID:19666735.
Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by University of Nebraska Lincoln on 04/06/15 For personal use only.
Romsang, A., Atichartpongkul, S., Trinachartvanit, W., Vattanaviboon, P., and Mongkolsuk, S. 2013. Gene expression and physiological role of Pseudomonas aeruginosa methionine sulfoxide reductases during oxidative stress. J. Bacteriol. 195(15): 3299–3308. doi:10.1128/JB.00167-13. PMID:23687271. Sally, A.M., Sahin, F., and Rowe, R.C. 1996. Black rot of crucifers. The Ohio State University Extension Fact Sheet HYG-3125-96. Sambrook, J., and Russell, D.W. 2001. Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., USA. Seaver, L.C., and Imlay, J.A. 2001. Alkyl hydroperoxide reductase is the primary scavenger of endogenous hydrogen peroxide in Escherichia coli. J. Bacteriol. 183(24): 7173–7181. doi:10.1128/JB.183.24.7173-7181.2001. PMID:11717276.
Can. J. Microbiol. Vol. 61, 2015
Published by NRC Research Press
