MOLECULAR AND CELLULAR BIOLOGY, OCt. 1991, p. 4809-4821

Vol. 11, No. 10

0270-7306/91/104809-13$02.00/0 Copyright © 1991, American Society for Microbiology

The Conserved Carboxy-Terminal Domain of Saccharomyces cerevisiae TFIID Is Sufficient To Support Normal Cell Growth DAVID POON,l STEPHANIE SCHROEDER,' C. KATHY WANG,' TOHRU YAMAMOTO 2 MASAMI HORIKOSHI,2 ROBERT G. ROEDER,2 AND P. ANTHONY WEIL'*

Department of Molecular Physiology and Biophysics, Vanderbilt University School of Medicine, Nashville, Tennessee 37232,1 and Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, New York, New York 100212 Received 9 April 1991/Accepted 28 June 1991

We have examined the structure-function relationships of TFIID through in vivo complementation tests. A yeast strain was constructed which lacked the chromosomal copy of SPT1S, the gene encoding TFIID, and was therefore dependent on a functional plasmid-borne wild-type copy of this gene for viability. By using the plasmid shuffle technique, the plasmid-borne wild-type TFIID gene was replaced with a family of plasmids containing a series of systematically mutated TFIID genes. These various forms of TFIID were expressed from three different promoter contexts of different strengths, and the ability of each mutant form of TFIID to complement our chromosomal TFIID null allele was assessed. We found that the first 61 amino acid residues of TFIID are totally dispensable for vegetative cell growth, since yeast strains containing this deleted form of TFIID grow at wild-type rates. Amino-terminally deleted TFIID was further shown to be able to function normally in vivo by virtue of its ability both to promote accurate transcription initiation from a large number of different genes and to interact efficiently with the Gal4 protein to activate transcription of GAL) with essentially wild-type kinetics. Any deletion removing sequences from within the conserved carboxy-terminal region of S. cerevisiae TFIID was lethal. Further, the exact sequence of the conserved carboxy-terminal portion of the molecule is critical for function, since of several heterologous TFID homologs tested, only the highly related Schizosaccharomyces pombe gene could complement our S. cerevisiae TFIID null mutant. Taken together, these data indicate that all important functional domains of TFIID appear to lie in its carboxyterminal 179 amino acid residues. The significance of these findings regarding TFIID function are discussed.

Transcription by RNA polymerase II requires a number of general transcription initiation factors termed TFIIA, TFIIB, TFIID, TFIIE, TFIIF, and TFIIG (49, 56). Binding of TFIID to the TATA box DNA sequence element is the first committed step in the ordered pathway of RNA polymerase II initiation complex formation (6, 9, 10, 14, 19, 46). Furthermore, TFIID has been implicated as either a direct or an indirect target for transcriptional regulatory proteins (1, 26, 27, 39, 40, 44, 50, 55). These functions of TFIID and the general mechanisms of RNA polymerase II transcription appear to be universally conserved among eucaryotes (42, 43). The gene (cDNA) encoding TFIID has been cloned from such diverse organisms as budding and fission yeasts (Saccharomyces cerevisiae and Schizosaccharomyces pombe) (7, 12, 13, 18, 24, 28, 51), plants (Arabidopsis thaliana) (15), insects (Drosophila melanogaster) (22, 38), and humans (25, 31, 40). A comparison of the amino acid sequences of TFIID from these evolutionarily divergent organisms shows that there is a striking conservation (>80%) of the carboxyterminal 180 amino acid residues of this molecule. However, all of these forms of TFIID contain amino-terminal extensions of variable sequence and length (18 to 172 amino acids). The only common feature of these amino-terminal extensions is that they are all relatively acidic, each having a pl ranging from 3.2 to 4.7. Currently neither the function nor significance of the amino-terminal domain is well understood, although it has been proposed that this region of TFIID may interact with transactivators or adaptors (2, 33, 40, 44). Clearly, since TFIID plays such a central role in *

RNA polymerase 1I-mediated transcription, a detailed analysis of the TFIID molecule is warranted. To assess the structure-function relationships of various putative structural domains of TFIID, we have performed detailed mutagenesis studies of the gene encoding this factor. As the first step toward this goal, we previously tested the effects of amino-terminal, carboxy-terminal, and internal deletions of TFIID amino acid sequences on the ability of this protein to both promote basal-level transcription and to bind to the TATA box in vitro (29). That study indicated that in vitro, the carboxy-terminal 180 amino acid residues of TFIID were necessary and sufficient for both of these functions. However, our previous studies neither tested for subtle defects in TFIID-DNA binding nor examined the mutant forms of TFIID regarding the rate at which they promoted assembly of the transcription initiation complex. Moreover, these in vitro assays failed to address the role of TFIID in regulatory factor interactions. The reasons for these deficiencies are severalfold. First, the gel mobility shift assay used to quantitate specific DNA binding by the mutant forms of TFIID is difficult to quantitate, especially for forms of TFIID that differ drastically in sequence (34, 41). Second, the logistics of assaying the DNA binding and transcriptional properties of large numbers of mutant forms of TFIID under many different conditions (variable salt or divalent cation concentrations, variable temperatures, etc.) and examining the rates of TFIID-DNA association and dissociation, the ability of TFIID to form template committed and/or sarcosyl-resistant complexes, and so forth are daunting. Lastly, in vitro assays are known for their poor levels of transactivation by various known transcription factors. Clearly, subtle effects of mutations upon TFIID function would be difficult

Corresponding author. 4809

4810

POON ET AL.

if not impossible to reproducibly detect. This problem is further compounded by the fact that again, assaying a large number of different transactivators would be extremely laborious. Ultimately this will be required, since many different classes of transcriptional activation domains have been described (see reference 37 for a recent review). Presumably at least several of these transcription factors work to stimulate initiation rates through distinct mechanisms which may or may not involve the same domain(s) of TFIID. To circumvent these drawbacks to in vitro assays of TFIID structure and function, we have assayed this family of TFIID deletion mutants for functionality in vivo; we tested the ability of each mutant to support vegetative cell growth under a variety of conditions. Cell growth tests much more rigorously whether or not mutant forms of TFIID are fully active, since function of this factor inside the cell relies on all potential activities of the TFIID molecule. In our experiments, mutant forms of TFIID were expressed from three different promoters in order to assess the effects of both gene dosage and expression levels on complementation of our TFIID gene null mutant. The results of these studies indicate that TFIID sequences 62 to 240 are both necessary and sufficient to support wild-type levels of vegetative yeast cell growth under all of the conditions tested. Furthermore, amino-terminally deleted TFIID appears to work as well as wild-type TFIID in a number of independent functional assays. Heterologous forms of TFIID were also tested for their ability to substitute for S. cerevisiae TFIID. Of the heterologous forms of TFIID tested, only the highly related S. pombe TFIID could substitute for S. cerevisiae TFIID. MATERIALS AND METHODS

Yeast and Escherichia coli strains. S. cerevisiae YPH252 (53) (MA Ta ura3-52 trpl -Al his3-A200 leu2-AJ iys2-801amber ade2-101Jchre) was used as the parental strain for all experiments described in this report. YPH252 and its derivatives were propagated in rich (yeast extract-peptone supplemented with adenine at 40 pg/ml), yeast synthetic complete (SC), or synthetic minimal (SD) medium (52) supplemented with nutrients as needed and with variable carbon sources at a final concentration of 2% (wt/vol), as indicated in the figure legends. When appropriate, 5-fluoroorotic acid (5-FOA) was added to SC agar plates (4). Plasmids were propagated in E. coli DH5-ot or BL21, using ampicillin selection (100 ,ug/ml) in LB medium (36). Construction of expression vectors bearing wild-type and mutant TFIID gene alleles. (i) Plasmids pPGK and pURATFIID. Plasmid pPGK was derived from pRS313; plasmid pURA-TFIID was derived from pRS316 (53). As indicated in Fig. 2, these two plasmids contain the HIS3 and URA3 selectable markers, respectively. pURA-TFIID and pPGK both contain the PGK promoter and transcriptional terminator. Both of these cis elements were produced by polymerase chain reaction (PCR) amplification from the intact PGK gene. The primers used to amplify the PGK promoter (upstream, 5'-CGACGGTACCGGGCCCTCATAAAGCAC GTGGCCTC [adjacent KpnI and ApaI sites underlined]; downstream, 5'-CGACGTCGACTATTTGTTGTAAAAAG TAG [Sall site underlined]) generated a PCR product corresponding to coordinates at -564 to -9 relative to the translation start site of the PGK transcription unit. This promoter fragment was subcloned into the Sall and ApaI (pRS313) or KpnI (pRS316) sites of these two yeast shuttle vectors to form plasmids pRS313-Pro and pRS316-Pro. The

MOL. CELL. BIOL.

primers used to PCR amplify the PGK transcriptional terminator fragment were as follows: upstream, 5'-GGAACGGA TCCTCTCTACTGGTGGTGGTGC (BamHI site underlined); downstream, 5'-GGAACGAGCTCCGCTGAAACCC GAACATAG (SacI site underlined). These primers generated a PCR product corresponding to coordinates + 1170 and +1410 relative to the mRNAPGK translation start site. This transcriptional terminator fragment was subcloned into the BamHI and Sacl sites of pRS313-Pro and pRS316-Pro to generate expression plasmids pPGK and pURA, respectively. Plasmid pURA-TFIID was formed when a SallBamHI PCR fragment, containing TFIID-coding sequences, was inserted into Sail- and BamHI-digested pURA- (see below for details of the PCR amplification of TFIID sequences). (ii) Plasmid pTFIID. Vector pTFIID was derived from pRS313 (53). The TFIID transcriptional terminator fragment was generated by PCR as described above, using the following primers: upstream, 5'-GAGAGACGGCCGCGGGGAAG GAGTAGACGAAAAGAAAAAAAGG (NotI site underlined); downstream, 5'-GAGAGGAGCTCTGTAGGAAGC CCACAAGCGG (Sacl site underlined). The PCR amplification product (comprising TFIID gene sequences +721 to +1124 relative to the ATG codon) was digested with NotI and SacI and subcloned into Notl- and SacI-digested pRS313 to form plasmid pRS313-Term. Similarly, a TFIID promoter fragment was generated by PCR using the following primers: upstream, 5'-ATATAAGCTTCTCTGCAGAG CAGGCCC (HindlIl site underlined); downstream, 5'-GGT

GTGTCGACTTGGACTAGAAAAGAAAAATAAAATG CAGCC (Sall site underlined). This PCR-amplified DNA fragment contained TFIID gene sequences -1161 to -36. Following digestion with HindlIl and Sall, this fragment was cloned into pSP72 (Promega) at the Hindlll and Sall sites to form pSP72-Pro. The TFIID promoter fragment was then excised from pSP72-Pro with XhoI and Sall and ligated into the SalI site of pRS313-Term to form expression plasmid pTFIID. (iii) Plasmid pGAL. Expression plasmid pGAL is the 2,um plasmid YEp51 developed by Broach and colleagues (5). pGAL was digested with Sall and BamHI. In pGAL, the highly inducible GALIO promoter drives transcription, while transcription terminates in 2,um REP3 sequences (5). (iv) Plasmid pLEU-A2-61. Plasmid pTFIID was digested with ApaI and Sacl to excise the TFIID promoter and the TFIID terminator cis elements as a single DNA fragment. This fragment was gel purified and subsequently ligated into plasmid pRS315 (53) that had been digested with the same enzymes, generating plasmid pLEU. Mutant TFIID gene allele A2-61, generated by PCR as detailed below, was then ligated into pLEU that had been digested with Sall and BamHI. Formation of plasmids expressing wild-type, mutant, and heterologous forms of TFIID. PCR was used to generate DNA fragments containing all TFIID gene alleles (both wild type and mutant). The starting plasmids for these PCR amplification reactions have been described previously (29); the sole exception is the TFIID gene allele A2-61 (see below for the details of construction of this plasmid). The following oligonucleotides were used for PCR amplification. The upstream primer (5'-GCGCGCGGTCGACTGATCAAATAAACA AAATGGCCGATGAGGAA; Sall site underlined) contains sequences complementary to the first 15 nucleotides of the coding region of TFIID, 11 nucleotides derived from the GPD 5' untranslated leader (3), and the Sall restriction endonuclease recognition site. The downstream PCR ampli-

VOL . 1 l, 1991

STRUCTURE-FUNCTION ANALYSIS OF S. CEREVISIAE TFIID

fication primer (5'-GCGCGGGATCCTATTATCACATTTT TCTAAATTCACTTAGCAC; BamHI site underlined) contains sequences complementary to the last 27 nucleotides of the coding region of TFIID, two additional in-frame translational stop codons, and the BamHI restriction site. Following PCR, all amplification products were digested with Sall and BamHI and cloned into the three different expression plasmids (pTFIID-, pPGK- and pGAL-; see above) that had been digested with SalI and BamHI. The DNA sequence of the TFIID (promoter-coding region-terminator) portions of all pPGK-X constructs was analyzed in its entirety. TFIID gene allele A2-61 was generated by PCR using the following upstream and downstream primers: upstream, 5'-GAGAGGTCGACAATAAACAAAATGGGTATTGTT CCAACACTACAA (Sall site underlined; initiator methionine [codon 1] and glycine [codon 62] codons indicated by bold type); downstream, 5'-GCGCGGATCCTATTATCAC AlTlTTTTCTAAATTCACTTAGCAG (BamHI site underlined). TFIID homologs from other organisms were also generated, using in these cases the appropriate cDNAs as template DNAs for PCR. These reactions used the following oligonucleotides as primers: S. pombe wild-type upstream, 5'-GCGCGGTCGACAAATAAACAAAATGGATTTCGC TTTACCCACCACGGCC (Sall site underlined); S. pombe AN upstream, 5'-GAGAGGTCGACAATAAACAAAATGG GCATTGTTCCAACCCTTCAA (Sall site underlined; initiator methionine [codon 1] and glycine [codon 53] codons indicated by bold type); S. pombe downstream, 5'-GC

CGCGGATCCTTATTATTAATGTTTTCGAAATTCAGA CAATAC (BamHI site underlined); Drosophila wild-type upstream, 5'-GCGCGGTCGACAAATAAACAAAATGGA CCAAATGCTAAGCCCCAACTTC (Sa/l site underlined); Drosophila AN upstream, 5'-GAGAGGTCGACAATAAAC AAAATGGGTATTGTGCCACAACTTCAG (Sall site underlined; initiator methionine [codon 1] and glycine [codon 156] codons indicated by bold type); Drosophila downstream, 5'-GCCGCGGATCCTTATTATTATGACTGCTTC TTGAACTTTTTTAAAATGGG (BamHI site underlined); human wild-type upstream, 5'-GCGCGGTCGACAAATAA ACAAAATGGATCAGAACAACAGCCTGCCACCT (Sall site underlined); human AN upstream, 5'-GAGAGGTCGA CAATAAACAAAATGGGGATTGTACCGCAGCTGCAA (SalI site underlined; initiator methionine [codon 1] and glycine [codon 189] codons indicated by bold type); and human downstream, the M13 universal sequencing primer. The downstream BamHI site required for cloning the human PCR-amplified cDNA sequences into the different expression vectors was generated from polylinker sequences which were incorporated during amplification. Construction of S. cerevisiae YTW22-A, which harbors a chromosomal null mutant form of the gene encoding TFIID. Yeast strain YTW22 was constructed from YPH252. First, YPH252 was transformed to uracil prototrophy by using pURA-TFIID (see Fig. 2) to generate strain YPS1. YPS1 was then transformed to Trp+ by the one-step gene disruption method of Rothstein (48). The DNA fragment used for this transformation, termed Atfiid::TRP1, was generated as follows. The disrupting fragment, Atfiid::TRP1, was constructed by first subcloning an -3.5-kb NdeI (Fig. 1) fragment which contained TFIID-coding sequences and -1 kb of DNA at both the 5' and 3' flanks of the gene. This fragment was derived from plasmid YCPIID (28). The gel-purified DNA fragment was ligated into the NdeI site of pGEM5Zf(+) (Promega) to form plasmid pGEM5-Nde. TFIID-coding sequences were then deleted from pGEM5-

4811

A N

E

E

-,0.

A

N

N

-0. B

-4

D

E

E

-..

-1..

A

C

N

4

D

I kb

B YPH252 YTW22 al la * oalo a + + + 4

+4

4371 -

2322 2028-

FIG. 1. Schematic representation of TFIID gene disruption and confirmation of the structure of the TFIID gene null allele in strain YTW22. (A) Structure of the TFIID locus before and after gene disruption. N and E refer to NdeI and EcoRI restriction endonuclease recognition sites discussed in the text. These enzyme sites were used for various cloning manipulations. A through D designate the sites of annealing of various oligonucleotide primers used for PCR analyses of the TFIID gene loci in YPH252 and YTW22 chromosomal DNAs. (B) Analysis of PCR reactions conducted with genomic DNA derived from YPH252 and YTW22, using the indicated pairs of PCR primers. Amplification products were analyzed by agarose gel electrophoresis using Hindlll-digested X DNA as the size marker. A photograph of the ethidium bromide stained gel is shown. Sizes are shown in nucleotides at the left.

Nde in two steps. M13 universal and M13 reverse sequencing primers were used for PCR in two separate reactions in combination with, respectively, a primer annealing just upstream of the TFIID gene TATA box (5'-GAGAGCGGC CGCCCAAAAAGCTCGCGTAAGAGAAACTTGGAAG; NotI site underlined; TFIID gene sequences -289 to -1263) and a primer annealing just downstream of the TFIID gene stop codon (5'-GAGAGCGQCCGCGGGGAAGGAGTAGA CGAAAAGAAAAAAAGG; Notl underlined; TFIID gene sequences +721 to -+1500). Both internal primers were engineered to contain Notl cloning sites as indicated. PCR amplification products were digested with NotI, XhoI, and BstXI, mixed, ligated, and then subcloned into the XhoI and BstXI sites of pGEM7Zf(+) (Promega) to generate plasmid pAtfiid. This plasmid bears a form of the TFIID gene from which all protein-coding sequences have been deleted and replaced with a NotI restriction endonuclease recognition site. An approximately 1-kb TRPI fragment (engineered to contain flanking Notl ends) was generated by PCR (primers were

5'-AAATGCGQQCGQCCTGATGCGGTATTTlTCTCC

4812

POON ET AL.

TTACGCATCTGTGCGG [upstream] and 5'-GGGCGCGG CCGCCATAAACGACATTACTATATATATAATATAG GAAGCA [downstream]) from plasmid pRS314 (53). Following digestion with NotI (NotI sites are underlined), this TRPI fragment was subcloned into the NotI site of pAtfiid to form plasmid pPSTRP1. This plasmid was then digested with EcoRI to generate an approximately 2.5-kb DNA fragment termed Atfiid::TRP1. This DNA fragment was gel purified and used to transform YPS1 to tryptophan prototrophy. The resulting strain was called YTW22. PCR analysis of YTW22 DNA was used to confirm integration of fragment Atfiid::TRP1 at the correct locus. Chromosomal DNAs from the parental (YPH252) and disrupted (YTW22) strains were prepared according to Hoffmann et al. (23). Each PCR reaction contained 2 ,ug of total nucleic acid. As a positive control, primer A (5'-GTCGGATTCCCTTTGCTGATAGAT CTAACT), which anneals to sequences upstream of the TFIID gene TATA box, was used in combination with primer D (5'-CAAATAGTTGAGCTGAACAGATTACAAA AGATACTAT), which anneals just down-stream of the TFIID gene NdeI site (Fig. 1A). Primer B (5'-GCGCGGTC

GACTGATCAAATAAACAAAATGGCCGATGAGGAA) anneals to sequences + 1 to +15 relative to the translation start site of the TFIID gene, while primer C (5'-AAATGCG

GCCGCCTGATGCGGTATTTTCTCCTTACCATCTGT GCGG) anneals to the downstream end of the TRPI portion of the Atfiid::TRP1 DNA fragment. PCR amplification products were resolved on a 1% agarose gel and detected by ethidium bromide staining. Growth curves of yeast strains bearing various forms of TFIID. Cells were grown overnight in the correct test media at 30°C with vigorous shaking to approximately mid-log phase. The cell density of these cultures was measured, and appropriate-volume aliquots of cells were taken. Cells from these aliquots were harvested by centrifugation, and the cell pellets were resuspended in the correct prewarmed media in duplicate culture and incubated at 30°C with shaking. Cell density was estimated by measuring the A600 of duplicate

samples of dilutions of these cultures. RNA 5'-end analyses using primer extension. Total RNA was prepared from various yeast strains basically as described previously (23). Accurate in vivo initiation of transcription of mRNAGAL', mRNAHS4, mRNAHH'' (histone H3), and mRNAPGK was monitored by using primer extension analyses as detailed previously (32). The following oligonucleotides were used to analyze the mRNAs produced from GAL], HIS4, HHT2, and PGK transcription units, respectively: TCTGAATGAGATTTAGTCATTATAGTTTTT (GALl sequences +52 to +81), TCAATTAACGGTAGA ATCGGCAAAACCATT (HIS4 sequences +63 to +92), GGATTTTCTGGCAGCCTTGGAGGCTAATTG (HHT2 sequences +70 to +100), and GACACGCTTGTCCTTGAAG

TCC (PGK sequences +77 to + 98). The numbers refer to the nucleotides relative to the major site of transcription initiation to which these oligonucleotides anneal. Immunoblot analyses of TFIID. Rabbit polyclonal antiTFIID antibodies were prepared by using purified intact yeast TFIID produced in isopropyl-,-D-thiogalactopyranoside (IPTG)-induced E. coli BL21. These cells harbored a plasmid containing the TFIID gene whose expression was driven by a T7 promoter in the vector pET3a (47). TFIID was purified from bacterial lysates by sequential chromatography on DEAE-Sepharose, heparin-Sepharose, and Sephacryl S-300 columns (28). Coomassie blue staining of the TFIID purified through this purification scheme and fractionated on denaturing sodium dodecyl sulfate (SDS)-polyacryl-

MOL. CELL. BIOL.

amide gels indicated that it was >90% pure (41). Approximately 500 jig of purified TFIID was used to prepare antibody in each of two rabbits. Equivalent results were obtained with both antiserum preparations. Immunoblot experiments using intact and amino-terminally deleted forms of TFIID indicated that these antibody preparations reacted primarily with epitopes (differential reactivity estimated to be >500:1 to amino-terminal TFIID epitopes) present in the amino-terminal portion of TFIID (41). The size and intracellular amount of TFIID protein present in various yeast strains were measured by immunoblotting using these rabbit anti-TFIID immunoglobulin G (IgG) preparations. Yeast whole-cell extracts (WCE) were prepared as follows. The different yeast strains were grown in 100 ml of selective medium to mid-log phase. Cells were pelleted by centrifugation at 5,000 x g for 10 min, washed twice with distilled H20, and resuspended in buffer Y (50 mM Tris-HCl [pH 7.9], 1 M sorbitol, 10 mM MgCl2, 14 mM 2-mercaptoethanol). Spheroplasts were generated by treating the cells with 2 packed-cell volumes of buffer Y containing 2 mg of Zymolyase 60T (Miles Laboratories) per ml at 30°C for 30 min with constant shaking at 250 rpm. Spheroplasts were harvested by centrifugation at 10,000 x g for 2 min, washed twice with buffer Y, and then resuspended in 3 pellet volumes of buffer A (10 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid [HEPES; pH 7.9], 15 mM KCl, 5 mM MgCl2, 0.1 mM EDTA, 2 p.g of leupeptin per ml, 1 ,ug of pepstatin per ml, 10 mM benzamidine, 2 mM phenylmethylsulfonyl fluoride) plus 0.6 M NaCl. Spheroplasts were lysed with 10 strokes with pestle A in a Dounce homogenizer. WCE was collected after centrifugation at 10,000 x g for 10 min. After separation on a denaturing SDS-12% polyacrylamide gel, proteins were electroblotted onto Immobilon polyvinylidene difluoride membranes (Millipore) in a Bio-Rad semidry blot apparatus for 1 h at 20 V in a buffer composed of 48 mM Tris base, 39 mM glycine, and 20% (vol/vol) methanol. The membrane was blocked for 1 h at room temperature with Tris-buffered saline (TBS; 100 mM Tris-HCI [pH 7.5], 150 mM NaCI) containing 10% (wt/vol) Carnation nonfat dry milk. The filter was rinsed three times in wash buffer (2% Carnation nonfat dry milk, 0.05% [vol/ vol] Tween 20 in TBS) and then incubated at 4°C for 12 h with a 1:1,000 dilution of anti-TFIID serum or preimmune serum in wash buffer (1 ml of diluted IgG solution per 50 cm2 of membrane). After the excess antiserum was washed away with TBS containing 0.1% Tween 20 (TBST), the membrane was incubated with secondary antibody (biotinylated, affinity-purified goat anti-rabbit IgG; 5 jig/ml; Vector Laboratories) in TBST at room temperature for 1 h. Excess second antibody was removed by washing the filter five times with TBST. An avidin-biotinylated peroxidase complex was added to conjugate with the biotinylated second antibody bound to the filter at room temperature for 30 min. Unbound avidin-biotinylated peroxidase conjugates were removed by washing with TBST. The bound peroxidase was visualized by color development with 1 part phosphate-buffered saline and 2 parts 4-chloro-1-naphthol substrate solution (Kirkegaard & Perry Laboratories) for about 5 min at room temperature. Color development was stopped by washing the membranes twice with TBS, and the membranes were photographed immediately. RESULTS of a Construction yeast strain bearing a chromosomal null allele of the gene encoding TFIID. The gene encoding S.

STRUCTURE-FUNCTION ANALYSIS OF S. CEREVISIAE TFIID

VOL . 1 l, 1991

A CENO/ARS4

CEN6/ARS4

pURA-TFIID

i

u

/RA

HIS

pPGK

PGKpro

PGtrm

PKt.rm

PGKpro

TFI I ID _ S

B

REPS

pGAL

LEU2

2S

GAL1 Opr TF II 10

S

B

4813

cerevisiae TFIID is a single-copy essential gene (7, 12, 41). Therefore, to conduct genetic studies on the structurefunction relationships of TFIID, we first had to construct a yeast strain bearing a chromosomal null mutation which totally lacked TFIID-coding sequences. This chromosomal null allele was generated in a haploid yeast strain in two steps. Yeast strain YPH252 (relevant genotype: ura3 trpl his3 leu2) (35) was first transformed to uracil prototrophy with plasmid pURA-TFIID (Fig. 2A shows the structure of this and other plasmids used) to produce strain YPS1. Plasmid pURA-TFIID carries TFIID-coding sequences on a CEN-ARS vector bearing the URA3 gene. A plasmid containing the prototrophic URA3 marker was chosen so that we could subsequently use the plasmid shuffle technique (4) to select for cells that had lost this plasmid with 5-FOA. Strain YPS1 contained two copies of the gene encoding TFIID, the chromosomal allele and the plasmid-bome allele on pURA-TFIID. Strain YPS1 was then transformed to tryptophan prototrophy as described by Rothstein (48), using a 2.4-kb linear DNA fragment, Atfiid::TRP1 (Fig. 1A), derived from plasmid pAtfiid. This DNA fragment contained TRPI in place of TFIID-coding sequences. Because the disrupting Atfiid:: TRP1 DNA fragment contained no DNA sequence homology to pURA-TFIID and since the parental strain (YPH252) was deleted for chromosomal TRPI sequences, this fragment should preferentially integrate at the TFIID gene locus. Of the many Trp+ transformants obtained, one strain,

B 56

1 234 309-

a

242-

I

go

160-

b

147-

S0

123-

U

110-

a

4-A-

I

4-C

-4-D

a

-P G K

90-

a

C 1 2 3 4

5 6

m-

4--

FIG. 2. Modulation of the intracellular levels of TFIID through the use of appropriate expression vectors. (A) Schematic representation of the various expression vectors used to drive TFIID gene expression. Details of vector construction are presented in Materials and Methods. All TFIID gene alleles were subcloned into these expression plasmids at the SalI (S) and BamHI (B) sites as PCR products that contain Sall and BamHI ends. The DNA sequence of each pPGK-X clone was verified by sequence analysis. (B) mRNATFIID levels produced from the various expression constructs. Total RNA was prepared from YPH252 (lane 1), YTW35 (lane 2), YTW36 (lane 3), or YTW37 (lane 4) cells. The amounts of mRNATFIID in these various RNA samples were compared by the primer extension method. mRNATFIID_specific extension products are marked by the arrows and letters: A, mRNATFIID initiated from the chromosomal gene in YPH252; B, mRNATFIID initiated from pTFIID-WT in YTW35; C, mRNATFIID initiated from pGAL-WT in YTW37; D, mRNATFIID initiated from pPGK-WT in YTW36. The amount of mRNAPG in these RNA preparations was also examined to serve as an internal control. The specific extension product produced from mRNAPGK is labeled PGK. Extension products were fractionated on a sequencing gel along with 32P-labeled MspIdigested pBR322 DNA; all 32P-labeled DNAs were detected by autoradiography. A photograph of the autoradiographic analysis of these primer extension reactions is shown. Mobilities of the length standards are indicated by the numbers (in nucleotides) on the left. Lanes 5 and 6 represent longer exposures of lanes 1 and 2 to better depict the amounts and sizes of mRNATFIID extension products generated from the chromosomal and pTFIID-WT-borne TFIID gene alleles. (C) TFIID levels in the various yeast strains. Immunoblotting of WCE generated from strains containing TFIID that was expressed from the three different promoter backgrounds. Samples containing 100 ,ug of WCE prepared from YPH252 (lane 1) and YTW35 (lane 3), 25 ,ug of WCE prepared from YTW22 (lane 2), 25 ,ug of WCE prepared from YTW36 (lane 4), 25 1Lg of WCE prepared from YTW37 (lane 5), and 20 ng of yeast TFIID expressed from the cloned gene in E. coli (lane 6) were electrophoresed on a 12% SDS-containing polyacrylamide gel, transferred to an Immobilon membrane, and probed with polyclonal anti-TFIID antibodies as detailed in Materials and Methods.

4814

POON ET AL.

termed YTW22, was chosen for further study. To confirm integration of the disrupting Atfiid::TRP1 DNA fragment at the correct locus in YTW22, PCR analyses (Fig. 1B) were performed on genomic DNAs prepared from both the parental strain (YPH252) and the putative disrupted strain (YTW22). PCR using oligonucleotides A and D (Fig. 1A) generated 2.4- and 2.5-kb amplification products, respectively, when YPH252 and YTW22 genomic DNAs were used as templates for the amplification reactions. Oligonucleotide primers A and D anneal to TFIID gene 5'-flanking sequences (primer A) and 3'-flanking sequences (primer D). TFIID gene 5'- and 3'-flanking sequences should be present in both strains. When used for PCR, primers B (internal to TFIIDcoding sequences) and D generated an appropriate-size amplification product only when YPH252 genomic DNA, not YTW22 genomic DNA, was used as the template (Fig. 1B). Conversely, primers C and D generated a PCR amplification product only when YTW22 genomic DNA, not YPH252 genomic DNA, was used as the template. Primer C anneals to sequences downstream of the TRP1 insert (compare lanes C+D in Fig. 1B). These results indicated that the Atfiid:: TRP1 DNA fragment had integrated correctly at the TFIID gene locus in strain YTW22 to replace TFIID-coding sequences, thereby generating the desired chromosomal TFIID gene null mutant. Strain YTW22 was used for all subsequent studies. The intracelular concentration of TFIID can be regulated through the

use

of various expression vectors. The TFIID

encoding the amino-terminally, carboxy-terminally, and internally deleted forms of TFIID shown in Fig. 8 were subcloned, as PCR fragments, into the expression vectors pTFIID, pPGK, and pGAL. The structures of these expression vectors are shown in Fig. 2A. The rationale behind this choice of vectors was that it would allow us to vary the level of expression of TFIID over a wide range since the promoters in each of these vectors are of different strengths. Additionally, these vectors are present intracellularly at different copy numbers. Plasmids pTFIID and pPGK are both single-copy CEN/ARS-containing plasmids, while plasmid pGAL is a high-copy-number 2,um-based (YEp51) vector. Constructs containing the wild-type TFIID gene cloned into each of these three vectors are referred to as pTFIIDWT, pPGK-WT, and pGAL-WT. With use of these three vectors, both low-level expression and overexpression complementation of our TFIID gene null mutant could be tested since these three expression vectors should all generate different, increasing amounts of TFIID (i.e., TFIID expression from pTFIID < pPGK < pGAL). Both mRNA and protein blotting experiments were performed to test this prediction. mRNATFIID levels in YPH252, YTW35, YTW36, and YTW37 cells (these strains contain a single copy of the TFIID gene resident either in the chromosome or on plasmids pTFIID-WT, pPGK-WT, and pGAL-WT, respectively) were assayed by the primer extension method (Fig. 2B, lanes 1 to 4). The amounts of mRNATFIID produced from the chromosomal TFIID gene and pTFIID-WT are equivalent (compare the amounts of mRNATFIID_specific extension products labeled A and B in lanes 1 and 2 of Fig. 2B; lanes 5 and 6 represent longer exposures of lanes 1 and 2). The sizes of the specific extension products generated from these two different forms of TFIID are due to DNA sequence changes introduced into the TFIID gene during the construction of pTFIID-WT (see Materials and Methods for details). Both PGK and GALIO promoters drive mRNATFIID expression at a level significantly higher than does the TFIID gene promoter (Fig. 2B; compare the amounts of specific exten-

genes

MOL. CELL. BIOL.

sion products from pPGK-WT [lane 3; marked D] and pGAL-WT [lane 4; marked C] with those in lanes 1 and 2). These four RNA samples were also analyzed for their mRNAPGK content; this served as an internal control (Fig. 2B, lanes 1 to 4; extension product labeled PGK).

These results indicated that through the use of these three vectors, the intracellular levels of mRNATFIID could be varied over a very wide range. To examine whether TFIID protein levels varied correspondingly, immunoblots were conducted to quantitate steady-state TFIID protein levels in yeast strains YPH252, YTW22, YTW35, YTW36, and YTW37. A 27-kDa TFIID polypeptide was detected with use of rabbit polyclonal anti-TFIID IgGs (see Materials and Methods). The results of these blotting experiments are presented in Fig. 2C. Whole cell extracts were prepared from the parental strain (YPH252) and the disrupted strain (YTW22) containing the various expression plasmids. The sample applied to lane 6 of Fig. 2C contained 20 ng of purified TFIID which was produced in E. coli and served as a positive control. The immunoreactive polypeptide species migrating slightly faster than the 27-kDa TFIID presumably represents TFIID proteolytic degradation products. As expected, specific immunoreactive 27-kDa TFIID levels were higher in YTW22 WCE than in YPH252 extracts since TFIID was being expressed from the strong PGK promoter (pURA-TFIID; Fig. 2A) in strain YTW22 (compare lanes 1 and 2 in Fig. 2B). Using the plasmid shuffle technique (detailed below), the pURA-TFIID plasmid in YTW22 was independently replaced with pTFIID-WT, pPGK-WT, and pGAL-WT to generate strains YTW35, YTW36, and YTW37, respectively. Cells containing pTFIID-WT produced TFIID at levels similar to the TFIID levels found in the parental strain YPH252 (compare lanes 1 and 3 in Fig. 2C). Cells bearing either pPGK-WT or pGAL-WT produced TFIID at amounts 10- to 30-fold greater than did cells bearing pTFIID-WT (Fig. 2B, lanes 2, 4, and 5). All of these results are consistent with mRNATFIID levels (Fig. 2B) analyzed in these same cells. These data indicate that our expression vectors all work as predicted and allow us to vary intracellular TFIID levels over at least a 30-fold range. Plasmid shuffle experiments to test the in vivo functionality of various mutated alleles of the TFIID gene. Our ability to modulate intracellular TFIID concentrations allowed us to investigate two additional aspects of TFIID structure and function. First, we could test whether particular mutant forms of TFIID can complement our TFIID gene null mutant only when overexpressed. Second, we could test whether any or all mutant forms of TFIID would act as transdominant suppressors of growth; i.e., we could investigate whether any mutant forms of TFIID squelch (16, 20), particularly when these mutants are overexpressed. To address these questions, YTW22 was transformed with the family of 22 different TFIID genes shown in Fig. 8. Each of these TFIID genes was cloned into the three expression vectors described above. The various mutant forms of TFIID expressed from these altered TFIID genes are referred to as pTFIID-X, pPGK-X, and pGAL-X, where -X defines the amino acid residues deleted from TFIID (we were unable to generate clone pGAL-A2-61). Strain YTW22 was transformed to His' (pTFIID-X and pPGK-X) or Leu+ (pGAL-X) with each of these plasmids, and multiple transformants were picked and replica plated onto both control and 5-FOA-containing agar plates. In the case of YTW22 transformed with pGAL-X, transformants were plated on galactose-containing medium, with and without 5-FOA, to induce the GALIO promoter. Plating of the transformants

STRUCTURE-FUNCTION ANALYSIS OF S. CEREVISIAE TFIID

VOL. 11, 1991

A A75-94

A7-118

0

0 -

A94-115

A7-152

A188-195

0 A197-208

WT

0 0 0 0 A214-223

A115-134 A7-177

0 0 0

A7-57

A123-164 A155-169 A34-56

A2-61

0 0 0

0 0 0

0 0

A174-181 A58-75

A7-83

0 0

0

pPGK-X

pTFIID-X

I

-5-FOA

0

A137-152 A13-39

A123-158

B

A7-33

In pGAL-X

+5-FOA

yp + Glucose

C

E 76 -IY-

4YTW32 0 22 form0YfTIDcnspotgrwth36 ige ersnatv

T2

.0 0

4

4815

onto plates containing 5-FOA selects for cells that have lost the pURA-TFIID plasmid present in YTW22. If the plasmidborne TFIID gene mutant allele encoded a nonfunctional TFIID, then the loss of pURA-TFIID would be a lethal event since YTW22 lacks the chromosomal copy of the gene encoding TFIID. However, if the particular plasmid-borne TFIID gene mutant allele encoded a functional form of TFIID, then it would be possible to obtain Ura- His+ (or Ura- Leu+) cells which could grow on media containing 5-FOA. Loss of pURA-TFIID from YTW22 transformants was verified by subsequent replica plating of 5-FOA-resistant cells onto minimal medium either containing or lacking uracil. All viable cells, after plasmid replacement using 5-FOA selection, were Ura- (41). The results of these plasmid shuffle experiments are presented in Fig. 3. A single representative YTW22 transformant containing each TFIID gene expressed in plasmid pTFIID, pPGK, or pGAL is shown. Cells were replica plated onto SC medium and SC medium containing 5-FOA (see legend to Fig. 3A), and the plates were incubated at 30°C. Yeast cells containing only TFIID gene alleles A13-39, A7-33, A34-56, A7-57 and A2-61 all grew in the presence of 5-FOA and at all temperatures tested (12, 22, 30, and 34°C) (41). These data indicate that TFIID with certain aminoterminal residues removed could still support vegetative yeast cell growth. Any deletion mutation removing TFIID residues between 62 and 240, however, generated a nonfunctional form of the molecule since these forms of TFIID could not support growth (Fig. 3B; mutants A7-83, A7-118, A7-152, A7-177, A58-75, A75-94, A94-115, A115-134, A137-152, A155169, A174-181, A188-195, A197-208, A214-223, A123-158, and A123-164). Importantly, similar complementation results were obtained regardless of the promoter used to drive expression of the various deleted forms of TFIID (Fig. 3B). Finally, it should be noted that no functional or nonfunctional mutant allele of TFIID was a strong transdominant suppressor of growth (i.e., no mutant forms of TFIID squelched growth). Transformants containing both the pURA-TFIID and the mutant TFIID genes grew perfectly well (Fig. 3B, plates marked -5-FOA). The sole exception was YTW22 containing plasmid pPGK-A13-39 (Fig. 3B, plate marked pPGK-X, -5-FOA). This construct reproducibly reduces growth when present in YTW22. Multiple isolates of YTW22 transformed with this plasmid all exhibited this behavior. It is notable that neither plasmid pGTFA13-39 nor pGAL-A13-39 significantly affect the growth of YTW22 in this fashion. The reasons for this behavior remains to be elucidated. Further experiments to rule out trivial explanations for this phenomenon are in progress. That TFIID was stably produced from the majority of the mutant alleles of TFIID was demonstrated by the experimental results presented in Fig. 4. WCE were prepared from all of the yeast strains tested in the plasmid shuffle experiments. Since some mutated forms of TFIID could not support growth, extracts were prepared from strains prior to plasmid shuffling. These yeast strains contained two plas-

81 2

Time (Hours)

FIG. 3. Plasmid shuffle experiments indicating which mutant forms of TFIID can support growth. A single representative YTW22 transformant colony was picked and replica plated according to the grid pattern shown in panel A onto appropriately supplemented SC agar plates either lacking (-5-FOA) or containing (+5-FOA) 5-FOA, as shown in panel B. All mutant forms of TFIID were expressed from pTFIID, pPGK, and pGAL, as indicated (pGALA2-61 was not analyzed; this is indicated by N.D. [not determined]). Cells containing pGAL-X constructs were plated on SC medium

containing galactose as the sole carbon source. The plates shown were incubated at 30°C. (C) Growth of yeast strains bearing wildtype and mutant forms of TFIID expressed from several different promoters. The indicated yeast strains (see text) were grown in YP plus glucose at 30°C to compare the abilities of wild-type and mutant forms of TFIID to support growth under these conditions. The average cell densities of duplicate samples of two identical cultures are plotted.

4816

MOL. CELL. BIOL.

POON ET AL.

co

0 A

*vv

I

A

A~A!

Cr

A6~~~~~~~~~~ ft~~~~~, "

v v v v v v v v v v v v v

v v v v

'1

-qwwp

4-TFIID

11...

FIG. 4. Protein blotting using anti-TFIID IgG to quantitate the sizes and amounts of TFIID produced by various mutated forms of TFIID expressed from the PGK promoter. Yeast strain YSD13 bearing plasmid pLEU-A2-61 was transformed with pPGK-X plasmids. These cells were grown to approximately mid-log phase and processed to produce WCE. Proteins present in these extracts were fractionated by denaturing polyacrylamide gel electrophoresis and blotted to an Immobilon membrane; bound TFIID polypeptides were detected by immunoblotting as detailed in Materials and Methods. Migration of the 27-kDa TFIID polypeptide (20 ng) produced in E. coli, used as a marker, is indicated on the right. The form of the TFIID gene in the pPGK-X expression plasmid in the yeast cells is indicated above each lane.

mids, the test plasmid pPGK-X and a functional allele of the TFIID gene. The functional form of TFIID used to cover the chromosomal null mutation was TFIID A2-61 driven by the TFIID promoter in vector pLEU-A2-61 (see the legend to Fig. 4 and Materials and Methods for details of this expression plasmid). This amino-terminally deleted form of TFIID was used so that we could easily detect the TFIID polypeptides produced from the various other mutant forms of TFIID present in pPGK-X. As described in Materials and Methods, our polyclonal anti-TFIID antibodies react almost exclusively with epitopes in the immediate amino-terminal portion of TFIID. Use of the A2-61 deleted form of TFIID to cover the chromosomal TFIID gene null mutation therefore increased signal to noise in these immunoblotting experiments since only the TFIID produced from plasmid pPGK-X would be detected with use of our antibodies. Proteins present in the WCE were fractionated by SDS-polyacrylamide gel electrophoresis and blotted to membranes, and bound TFIID was detected by immunoblotting as described for the experiment depicted in Fig. 2C. These immunoblot analyses showed that derivatives of yeast strain YSD13 (which contains pLEU-A2-61) transformed with TFIID gene alleles A13-39, A34-56, A58-75, A94-115, A115-134, A137-152, A155-169, A123-158, A123-164, A174-181, and A181-195 all contain stable mutant forms of this factor. Stable immunoreactive forms of TFIID could not be detected in any of the other YSD13 transformants by these methods. The reasons for the lack of detection of these forms of TFIID are twofold. First, some mutant forms of TFIID are not detected simply because they lack epitopes which are recognized by our antisera. In this regard, it is worth noting that two of the A7-X mutants were not detected by this procedure yet these same two alleles, A7-33 and A7-57, are both able to complement our null mutant. Second, some mutant forms of TFIID might be particularly sensitive to proteolysis. As evident from the data presented in Fig. 4, even wild-type TFIID is subject to proteolytic degradation (lane marked wildtype). Amino-terminally deleted forms of TFHD support wild-type rates of growth under a variety of growth conditions. Growth curves were determined by using selected 5-FOA-resistant strains identified in the experiment shown in Fig. 3A and B. These experiments were performed to determine whether any of these strains exhibited significant defects in growth rates. Both the parental strain YPH252 (transformed with HIS3- and TRPI-marked plasmids pRS313 and pRS314 when

appropriate) and strains YTW35, YPH36, and YSD21 were analyzed. Strain YPH252 served as a control; the others contained plasmid pTFIID-WT (YTW35), pPGK-WT (YTW36), or pTFIID-A2-61 (YSD21). These strains were propagated on rich (YP plus glucose) or minimal (SC or SD) medium (see Materials and Methods). These media contained various carbon sources, either glucose, galactose, or lactate. Media of such widely varying composition were purposely chosen so that the ability of amino-terminally deleted TFIID (A2-61) to facilitate accurate transcription (both fidelity and amount) of a very large sampling of transcription units could be quickly and rapidly assessed. Typical results of these growth curve experiments comparing strains bearing wild-type and A2-61 forms of TFIID are presented in Fig. 3C. No significant reproducible differences in either growth rate or cell density reached at saturation were observed between these yeast strains, regardless of the level of expression or form of TFIID complementing the chromosomal null allele (Fig. 3C). Moreover, equivalent results were obtained with use of either rich (YP plus glucose [Fig. 3C]; YP plus galactose or YP plus lactate [41]) or minimal (SC plus galactose, SC plus glucose, or SD plus glucose [41]) medium containing various carbon sources such as glucose, lactate, or galactose. All viable aminoterminal mutant alleles of TFIID were also tested for their ability to function in these same growth tests (i.e., A13-39,

A34-56, and A7-57 [33]), and results essentially equivalent to those presented in Fig. 3C were obtained (not shown). The accuracy of initiation site selection in vivo does not depend on TFIID amino-terminal sequences. To examine whether the accuracy of transcription initiation was affected by the presence or absence of TFIID amino-terminal sequences, we monitored in vivo 5'-end formation from a number of quite distinctly regulated transcription units. This sampling of genes included the inefficiently transcribed but Gcn4-inducible HIS4 (11); the cell cycle-regulated histone H3-encoding gene (HH12 [54]); the highly constitutively expressed PGK gene (21), and the highly expressed but Gal4/Gal80-regulated GAL] gene (30). Total RNA was prepared from cells containing either wild-type (pTFIID-WT; strain YTW35) or mutant (pTFIID-A2-61; strain YSD21) TFIID genes. Equivalent amounts of these RNAs were analyzed by the primer extension method; specific extension products were fractionated by denaturing polyacrylamide gel electrophoresis and detected by autoradiography (Fig. 5).

STRUCTURE-FUNCTION ANALYSIS OF S. CEREVISIAE TFIID

VOL . 1 l, 1991 ,-

I-

Y-

co

co

s co co MF 1>eCM

NM 123

-

110

-

I-

V

YTW35 YSD21

I

I p

123

-

U

110

-

U

0'30'60'

ail;

4- P G K

*0 4-HIS 4 04D -

-

TI 0'30'60'

4-Hlstone

__

76

4817

4-oGALI

a

90

_

76

_-

1 2 3 4 5 6 7 8 910

FIG. 5. Evidence that both wild-type and amino-terminally deleted forms of TFIID can function in vivo to promote high levels of accurate initiation of transcription from a variety of genes. Total RNA was prepared from fully induced log-phase cultures of YTW22 and YSD21. Primer extension analyses utilizing appropriate genespecific primers were used to analyze both the accuracy and frequency of transcription initiation from the GAL], HHT2 (histone H3), HIS4, and PGK transcription units. Primer extension products were fractionated on a DNA sequencing gel along with 32P-labeled MspI-digested pBR322. Labeled DNAs were detected by autoradiography; a photograph of the autoradiogram is shown. The mobilities of the length markers are indicated by numbers (in nucleotides) on the left; the PGK (lanes 1 and 2), HHT2 (histone; lanes 3 and 4), GAL] (lanes 5 and 6), and HIS4 (lanes 7 and 8) extension products are indicated on the right. RNA was prepared from cells containing wild-type TFIID (WT) and from cells carrying TFIID-A2-61 (A2-61). Lanes 9 and 10 depict longer exposures of lanes 7 and 8 to better illustrate the pattern of HIS4-specific extension products.

Neither qualitative nor quantitative differences are observed between initiation patterns produced by wild-type and A2-61 forms of TFIID in vivo on any of the transcription units analyzed (Fig. 6). Amino-terminally deleted TFIID can efficiently mediate transactivation of GAL] transcription by the transcriptional activator Gal4. The results presented in Fig. 3 to 5 strongly suggest that forms of TFIID totally lacking amino-terminal sequences between residues 2 and 61 can productively interact with transactivating enhancer-binding proteins. However, the 5'-end analyses performed on the samples analyzed in the experiment shown in Fig. 5 all used RNA prepared from cells cultured for long periods of time under fully inducing conditions. Therefore, these analyses do not directly address the question of the efficiency with which amino-terminally deleted forms of TFIID interact with transcriptional regulatory proteins. To examine this point directly, we compared the kinetics of induction of GAL] transcription (RNA accumulation mapped by 5'-end analysis) by Gal4 in cells containing wild-type and mutant TFIIDs. We chose the galactose-inducible gene GALI for this purpose because the positive regulator of GAL] transcription, Gal4, has been highly studied. Gal4 has been extensively mapped as to its transcriptional activation functions, and specific domains of the Gal4 protein have been shown to be responsible for stimulating transcription initiation from cis-

a

-

67

-o*-4PG K

"*

4-GALl

-

1 23

456

FIG. 6. Galactose-mediated induction kinetics of mRNAGALI expression in cells containing either the wild-type or A2-61 form of TFIID. Strains YTW35 and YSD21 were grown overnight in glycerol-containing yeast extract-peptone medium, harvested by centrifugation, and washed once with 10 mM Tris-0.1 mM EDTA. An aliquot of cells was taken to provide a 0-min sample (lanes 1 and 4); the remainder of the washed cells were resuspended in prewarmed medium at a cell density of 0.5 A6w units per ml and shaken at 30°C in SC medium lacking histidine and containing galactose (2%, wt/vol) as the sole carbon source. At 30 (lanes 2 and 5) and 60 (lanes 3 and 6) min after resuspension of the cells in galactose-containing medium, aliquots of cells were removed and total RNA was prepared. These RNA preparations were analyzed by the primer extension method for both mRNAGAL' and mRNAPGK (as an internal control) levels as detailed in Materials and Methods. Primer extension products were analyzed as described in the legend to Fig. 5. RNA samples in lanes 1 to 3 were prepared from cells containing wild-type TFIID (YTW35); RNAs analyzed in lanes 4 to 6 were prepared from cells containing only A2-61 amino-terminally deleted TFIID (YSD21). The mobilities of PGK- and GALI-specific primer extension products are indicated on the right. Lengths (in nucleotides) of size markers are shown on the left.

linked TATA boxes (35). Moreover, data that infer direct interactions between Gal4 and TFIID have been reported (26). If an obligate target for transactivation resides within TFIID amino-terminal sequences, then the kinetics of induction of GAL] (transcription) expression should minimally be delayed in yeast strains containing pTFIID-A2-61 as the sole source of TFIID. To test this hypothesis, the kinetics of GAL] transcription induction (mRNAGAL' accumulation) was examined in YTW35 and YSD21 cells. At various times after galactose addition to yeast cultures, total RNA was prepared from samples of cells removed from the culture and mRNAGALI production was monitored by primer extension analyses. mRNAPGK content was also measured in these same RNA samples to serve as an internal control. The RNA analysis data presented in Fig. 6 clearly indicate that the kinetics of mRNAGAL' 5'-end formation are identical in strains containing either wild-type (YTW35) or A2-61 (YSD21) forms of TFIID. Only highly related heterologous forms of TFIID can complement the S. cerevisiae TFIID gene null mutant allele. The complementation data presented in Fig. 3 indicated that any deletion mutation within carboxy-terminal residues 62 to 240 inactivated TFIID function. This noncomplementation could

4818

C-GgK

POON ET AL.

MOL. CELL. BIOL.

A [

S. cerevlslae

-

*1 fl S. pombe *|1 *f D.melanogaDser *

fl human

-5-FOA +5-FOA

B rsce vlslae H1

[] U [

Glu

Gal

-5-FOA

1

D. r-. 235 :r a. 278 4 S. p S. C. 23 C n s e r ss D. m.

296

Fi .a~

278 75

S. p

S

Gal +5-FOA

*

* S

S. pombe

C] ] 13

* *

D. melanogaster hum an

Glu Gal -5-FOA

Din. 1 -74 h ma 156 S. p. 53 S. c 62 Consens,s

D. melanogaster humran

* J

C

n

D

l,^ S. pombe

Gal +5-FOA

Lc. sI .p QHT .T '';LrKLPA.

I FDCI,

g

A L; R. .: -

'F.L

TA:

L ." ..i ED: SLAS KL AR ?.,

t;

AA r AA-. -MR: ?K-r?. SA : 'F

...

'.

I..

:.A-RF:YARiir.. : -:AaSEIS ..-.-

FYPPEIAL:YRM:rFPVLL',PEL

:rM:K. i. : . X..

PF. F .iR ... . A L MVIK P ;. F FSA .8 1 8f4 P i F7L,IPCT sPFPGLYIR9VK K SV

*.

v.

Co1'nsens,s S SELF

SGL1

FIG. 7. Evidence that only highly related TFIID homologs can substitute for S. cerevisiae TFIID in vivo. YTW22 was transformed with pTFIID-X (A), pGAL-X (B), or pGAL-ANX (C) (X is the organism from which TFIID coding sequences were derived, as indicated to the right of panels A, B, and C). A single colony of each strain of each type of transformant was plated on medium either lacking (-5-FOA) or containing (+5-FOA) 5-FOA. pGAL-X constructs were plated on medium containing either glucose (Glu) or galactose (Gal). Plates were incubated at 30°C for various lengths of time and then photographed. (A) Complementation patterns by intact S. cerevisiae, S. pombe, D. melanogaster, and human TFIIDs. (B) Overexpression complementation by TFIID or by the same collection of TFIID homologs as shown in panel A when these sequences are expressed from pGAL. (C) Overexpression complementation patterns of amino-terminally truncated TFIID homologsexpressed from pGAL. (D) Alignment of carboxy-terminal sequences of S. cerevisiae (S.c.), S. pombe (S.p.), D. melanogaster (D.m.), and human TFIIDs. The TFIID amino acid sequence coordinates of each TFIID compared are indicated by the numbers after the genus designation. The one-letter amino acid code is used.

be due to exact amino acid sequence requirements for proper TFIID function; alternatively, these internal deletions could have altered critical spacing parameters within the TFIID molecule. All eucaryotic TFIIDs contain a directly repeated sequence ca. 60 amino acid residues long (S. cerevisiae TFIID residues 67 to 127 and 158 to 218; Fig. 7D shows the carboxy-terminal sequences of several different TFIIDs and a consensus sequence derived from them). The exact significance of these putative repeated structural motifs remains to be established. One way to potentially distinguish between these two possibilities as to why internally deleted forms of TFIID fail to complement is to mutate specific residues within the carboxy-terminal conserved region and test these mutant alleles for their ability to complement our S. cerevisiae TFIID gene null mutant. This is a very labor-intensive endeavor. Fortunately, nature has provided us with a range of TFIID sequence variants which all maintain the appropriate spacing of direct repeats but vary the amino acids within the direct repeats; these are the genes (cDNAs) encoding TFIID from S. pombe, D. melanogaster, and humans (HeLa cells). The intact cDNAs encoding each of these heterologous forms of TFIID were cloned into expression vector pTFIID, and by using the plasmid shuffle technique, the ability of each of these cDNAs to produce a form of TFIID which could substitute for the S. cerevisiae factor in vivo was analyzed (Fig. 7A). Only the S. pombe TFIID gene (cDNA) could efficiently substitute for S. cerevisiae TFIID. Neither Drosophila nor human TFIID-encoding cDNAs could produce TFIID that functioned in this assay. We next tested whether overexpression of these cDNAs would alter this pattern of complementation. Accordingly, the cDNAs encoding S. pombe, Drosophila, and human TFIIDs were cloned into pGAL. Previous experiments (Fig. 2 and 4) indicated that use of expression vector pGAL effects at least a 30-fold increase in intracellular TFIID levels. The plasmid shuffle results presented in Fig. 7B indicate that the complementation patterns are unchanged; S. pombe TFIID efficiently substituted for S. cerevisiae TFIID, while neither of the metazoan TFIIDs could. It should also be noted that (as observed previously [Fig. 3B]) none of these forms of TFIID appear to be transdominant suppressors of growth (Fig. 7B). To rule out potential complications due to the nonconserved amino-terminal sequences of these heterologous forms of TFIID, the conserved carboxyl-terminal portion from each cDNA was subcloned into pGAL, forming a collection of plasmids designated pGAL-/N. The ability of each of these GALJO-driven cDNAs to complement our S. cerevisiae TFIID gene null mutant was then tested by using the plasmid shuffle method. Once again, only S. pombe TFIID could substitute for S. cerevisiae TFIID (Fig. 7C). It is interesting that in this context that both Drosophila and human TFIID homologs appear to decrease growth rates (Fig. 7B and C). The cause(s) of this apparent suppression of growth is currently under investigation. In summary, metazoan TFIID homologs could not complement our TFIID gene null mutant allele under any of the conditions tested.

Residues in capital letters are found in at least two of the four sequences compared. Sequences were aligned by using the Intelligenetics GENALIGN routine.

STRUCTURE-FUNCTION ANALYSIS OF S. CEREVISIAE TFIID

VOL. 11, 1991

4819

direct repeats 0

--Io

In vitro

basic repeat

phenotype

viability 40

TFIID mutant

wildt ype I A7-33 A7-57 i A2-61 A7-83 A7-118 A7-152 A7-177 A13-39 A34-56 A58-75 A75-94 A94-115 A115- 134 I A137-152

80

120 160 200 240

TATA box

binding +

Basal l*v*i Transcription +

In vivo phenotype Viability 'I + +

N.D.

N.D.

4

77::= 1 + +

4

I

A155-169

A174-181 A188-195 A197-208 A214-223 A123-158 A123-164

I~~~~~~~~~~~~~~~~~~~~~~ I~~~~~~~~~~~~~~~~~~~~~~

I~~~~~~~~~~~~~~~~~~~~~~ I~~~~~~~~~~~~~~~~~~~~~~ I

::~~~~~~~~~~~~~~~~~~~~D~~~

FIG. 8. Summary of the ability of TFIID gene mutant alleles to complement our TFIID gene null mutant allele and comparison with data generated by using in vitro assays of activity (29).

DISCUSSION The data presented in this report demonstrate that the amino-terminal residues of S. cerevisiae TFIID between 2 and 61 are totally dispensable for vegetative cell growth. This portion of yeast TFIID represents the region of the molecule which is nonconserved between various eucaryotic species. For a number of reasons (see introduction), these results were completely unexpected. A comparison of the structure-function relationships of TFIID assessed both in vivo and in vitro is presented in Fig. 8. An amazing concordance between these two sets of data is evident. Our results therefore lead us to hypothesize that all essential sequences of this molecule must map to TFIID residues between 62 and 240. These essential sequences include the DNA binding domain(s), a general transcription initiation factor interaction domain(s), an RNA polymerase II binding domain(s), nuclear localization signals, and presumptive activator/coactivator interaction domains. This region of S. cerevisiae TFIID is exactly that portion of all TFIIDs whose sequence is very highly conserved between species. A corollary of this hypothesis is that the amino terminus of yeast TFIID cannot be involved in making the sole obligatory interactions with enhancer-binding factors or coactivators since our A2-61 construct is entirely lacking this region of the molecule. Cells containing only this amino-terminally deleted form of TFIID grow on both rich and minimal media supplemented with a variety of different carbon sources. These growth conditions

surely sample for appropriate expression patterns (both qualitative and quantitative) of a large number of different genes. The amino-terminally deleted forms of TFIID appear to support this disparate array of transcriptional activation (and presumably also repression) events. This contention is further supported by the fact that 5'-end analyses performed on a number of mRNAs derived from several distinctly regulated transcription units showed that neither initiation accuracy nor frequency depended on the presence of an intact amino terminus on TFIID. Not only could A2-61 TFIID support transcription initiation from the appropriate site(s), but at least in the case of GAL], induction kinetics (rate of mRNAGAL' 5'-end formation) were indistinguishable from the wild-type value when A2-61 TFIID was the sole form of this factor in vivo. Taken together, these data document that for vegetative yeast cell functions, the amino terminus of TFIID is totally dispensable. Experiments to probe for a role of TFIID amino-terminal sequences in mating-type control, sporulation, and germination will test the totality of potential TFIID functions. Such experiments are planned. Our data indicating that the amino terminus of yeast TFIID plays no role in TFIID function conffict with the conclusions of Tjian and colleagues. Using two different transactivators, these workers showed that the amino terminus of metazoan TFIID was absolutely required for enhancement of transcription in vitro (40, 44). The exact reason(s)

4820

POON ET AL.

for this discrepancy is currently unknown but could be due to the use of in vitro assays by these investigators. Further experimentation will be required to resolve this issue. However, it should be noted that our results are entirely consistent with the data recently described by Fikes et al. (13). These authors found that overexpression (2,m-based, ADH promoter-driven vector) of the cDNA encoding S. pombe TFIID in S. cerevisiae could complement an sptl5 null allele. Although not emphasized by these authors, the most straightforward explanation for this observation is that the amino terminus of TFIID is not critical for TFIID function(s). However, this conclusion does not automatically follow from these data since in their experiments, complementation was tested only when the S. pombe TFIID cDNA was overexpressed. S. cerevisiae and S. pombe TFIIDs are greater than 93% homologous in their carboxy-terminal 180 amino acid residues but are essentially nonhomologous in their amino termini (13, 24). In this report, we describe data which confirm and extend the results of Fikes et al. (13). We have found that even when the S. pombe TFIID cDNA is expressed at normal levels it can substitute for S. cerevisiae TFIID, apparently because of the high degree of TFIID sequence identity between these two organisms. TFIID homologs from Drosophila and human cells, being more diverged than S. pombe TFIID from S. cerevisiae TFIID, fail to complement our S. cerevisiae null allele even when overexpressed. Another interesting facet of the results presented here is that the intracellular concentration of TFIID does not appear to be rate limiting for vegetative yeast cell growth. This conclusion follows from the fact that cells expressing TFIID from the TFIID, PGK, and GALIO promoters all appear to grow at about the same rate regardless of medium composition. If the intracellular concentration of TFIID were rate limiting for growth, strains containing pPGK-WT or pGAL-WT would have grown more rapidly than wild-type strains. Such an enhanced rate of growth was not observed. This fact should be taken into account in models of TFIID function. Although it remains formally possible that the results reported here apply only to S. cerevisiae, the apparent extreme conservation of fundamental transcription mechanisms among all eucaryotes argues against this possibility. Further detailed experimentation with S. cerevisiae, S. pombe, Drosophila, and human TFIIDs is under way to address this issue. After this report was submitted, three papers describing studies that examined the structure-function relationships of various forms of TFIID were published (8, 17, 45). Our results are entirely consistent with those reported by these other laboratories. ACKNOWLEDGMENTS We thank Jackie Segall, Marie Parsons, and Roger Chalkley for thoughtful comments on the manuscript. We are grateful to Ian Jones for technical assistance in the early phases of this work. We also thank Robert Sikorski and Phil Hieter for providing plasmids and yeast strains. This work was supported by NIH grants DK42502 (P.A.W.), CA42567 and A127397 (R.G.R.), and GM45258 (M.H.) and by general funding from the Pew Trusts to The Rockefeller University. M.H. is an Alexandrine and Alexander L. Sinsheimer Scholar. REFERENCES 1. Abmayr, S. M., J. L. Workman, and R. G. Roeder. 1988. The pseudorabies immediate early protein stimulates in vitro tran-

MOL. CELL. BIOL.

scription by facilitating TFIID:promoter interactions. Genes Dev. 2:542-553. 2. Berger, S. L., W. D. Cress, A. Cress, S. J. Triezenberg, and L. Guarente. 1990. Selective inhibition of activated but not basal transcription by the acidic activation domain of VP16: evidence for transcriptional adaptors. Cell 61:1199-1208. 3. Bitter, G. A., and K. M. Egan. 1984. Expression of heterologous genes in Saccharomyces cerevisiae from vectors utilizing the glyceraldehyde-3-phosphate dehydrogenase gene promoter. Gene 32:263-274. 4. Boeke, J. D., J. Trueheart, G. Natsoulis, and G. R. Fink. 1987. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154:164-175. 5. Broach, J. R., Y. Li, L. C. Wu, and M. Jayaram. 1983. Vectors for high-level, inducible expression of cloned genes in yeast, p. 83-117. In M. Inouye (ed.), Experimental manipulation of gene expression. Academic Press, Inc., New York. 6. Buratowski, S., S. Hahn, L. Guarente, and P. Sharp. 1989. Five intermediate complexes in transcription initiation by RNA polymerase II. Cell 56:549-561. 7. Cavallini, B., I. Faus, H. Matthes, J. M. Chipoulet, B. Winsor, J. M. Egly, and P. Chambon. 1989. Cloning of the gene encoding the yeast protein BTF1Y, which can substitute for the human TATA box-binding factor. Proc. Natl. Acad. Sci. USA 86:98039807. 8. Cormak, B. P., M. Strubin, A. S. Ponticell, and K. Struhl. 1991. Functional differences between yeast and human TFIID are localized to the highly conserved region. Cell 65:341-348. 9. Conaway, R. C., and J. W. Conaway. 1990. Transcription initiated by RNA polymerase II and purified factors from liver: transcription factors a, 3-y and 8 promote formation of intermediates in assembly of the functional preinitiation complex. J. Biol. Chem. 265:7559-7563. 10. Davison, B. L., J. M. Egly, E. R. Mulvihill, and P. Chambon. 1983. Formation of stable preinitiation complexes between eukaryotic class B transcription factors and promoter sequences. Nature (London) 301:680-686. 11. Donahue, T. F., P. J. Farabaugh, and G. R. Fink. 1982. The nucleotide sequence of the HIS4 region of yeast. Gene 18:47-59. 12. Eisenmann, D. M., C. Dollard, and F. Winston. 1989. SPT15, the gene encoding the yeast TATA binding factor TFIID, is required for normal transcription initiation in vivo. Cell 58:11831191. 13. Fikes, J. D., D. M. Becker, F. Winston, and L. Guarente. 1990. Striking conservation of TFIID in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Nature (London) 346:291-294. 14. Fire, A., M. Samuels, and P. Sharp. 1984. Interactions between RNA polymerase II, factors, and template leading to accurate transcription. J. Biol. Chem. 259:2509-2516. 15. Gasch, A., A. Hoffmann, M. Horkoshi, R. G. Roeder, and N. Chua. 1990. Arabidopsis thaliana contains two genes for TFIID. Nature (London) 346:390-394. 16. Gill, G., and M. Ptashne. 1988. Negative effect of the transcriptional activator GAL4. Nature (London) 334:721-724. 17. Gill, G., and R. Tjian. 1991. A highly conserved domain of TFIID displays species specificity in vivo. Cell 65:333-340. 18. Hahn, S., S. Buratowski, P. Sharp, and L. Guarente. 1989. Isolation of the gene encoding the yeast TATA binding protein TFIID: a gene identical to the SPT15 suppressor of Ty element insertions. Cell 58:1171-1181. 19. Hawley, D., and R. G. Roeder. 1985. Separation and partial characterization of three functional steps in transcription initiation by human RNA polymerase II. J. Biol. Chem. 260:81638172. 20. Herskowitz, I. 1987. Functional inactivation of genes by dominant negative mutations. Nature (London) 329:219-222. 21. Hitzeman, R. A., F. E. Hagie, J. S. Hayflick, C. Y. Chen, P. H. Seeburg, and R. Derynck. 1982. The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase. Nucleic Acids Res. 10:7791-7808. 22. Hoey, T., B. D. Dynlacht, M. G. Peterson, B. F. Pugh, and R. Tjian. 1990. Isolation and characterization of the Drosophila gene encoding the TATA box binding protein, TFIID. Cell

VOL . 1 l, 1991

STRUCTURE-FUNCTION ANALYSIS OF S. CEREVISIAE TFIID

61:1179-1186. 23. Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57:267-272. 24. Hoffmann, A., M. Horikoshi, C. K. Wang, S. Schroeder, P. A. Weil, and R. G. Roeder. 1990. Cloning of the Schizosaccharomyces pombe TFIID gene reveals a strong conservation of functional domains present in Saccharomyces cerevisiae TFIID. Genes Dev. 4:1141-1148. 25. Hoffmann, A., E. Sinn, T. Yamamoto, J. Wang, A. Roy, M. Horikoshi, and R. G. Roeder. 1990. Highly conserved core domain and unique N terminus with presumptive regulatory motifs in a human TATA factor (TFIID). Nature (London) 346:387-390. 26. Horikoshi, M., M. F. Carey, H. Kakidani, and R. G. Roeder. 1988. Mechanism of action of a yeast activator: direct effect of GAL4 derivatives on mammalian TFIID-promoter interactions. Cell 54:665-669. 27. Horikoshi, M., T. Hai, Y. S. Lin, M. R. Green, and R. G. Roeder. 1988. Transcription factor ATF interacts with the TATA factor to facilitate establishment of a preinitiation complex. Cell 54:1033-1042. 28. Horikoshi, M., C. K. Wang, H. Fujii, J. A. Cromlish, P. A. Weil, and R. G. Roeder. 1989. Cloning and structure of a yeast gene encoding a general transcription initiation factor TFIID that binds to the TATA box. Nature (London) 341:299-303. 29. Horikoshi, M., T. Yamamoto, Y. Ohkuma, P. A. Weil, and R. G. Roeder. 1990. Analysis of structure-function relationships of yeast TATA box binding factor TFIID. Cell 61:1171-1178. 30. Johnston, M., and R. W. Davis. 1984. Sequences that regulate the divergent GALI-GALIO promoter in Saccharomyces cerevisiae. Mol. Cell. Biol. 4:1440-1448. 31. Kao, C. C., P. M. Lieberman, M. C. Schmidt, Q. Zhou, R. Pei, and A. J. Berk. 1990. Cloning of a transcriptionally active human TATA binding factor. Science 248:1646-1650. 32. Karnitz, L., D. Poon, P. A. Weil, and R. ChaLkley. 1989. Purification and properties of the Rous sarcoma virus internal enhancer binding factor. Mol. Cell. Biol. 9:1929-1939. 33. KelHeher, R. J., HI, P. M. Flanagan, and R. D. Kornberg. 1990. A novel mediator between activator proteins and the RNA polymerase II transcription apparatus. Cell 61:1209-1215. 34. Lieberman, P. M., M. C. Schmidt, C. C. Kao, and A. J. Berk. 1991. Two distinct domains in the yeast transcription factor IID and evidence for a TATA box-induced conformational change. Mol. Cell. Biol. 11:63-74. 35. Ma, J., and M. Ptashne. 1987. Deletion analysis of GAL4 defines two transcriptional activating segments. Cell 48:847853. 36. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 37. Mitchell, P. J., and R. Tjian. 1989. Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245:371-378. 38. Muhich, M. L., C. T. Iida, M. Horikoshi, R. G. Roeder, and

39.

40. 41. 42. 43. 44.

45. 46.

47. 48.

49. 50. 51.

52. 53. 54.

55. 56.

4821

C. S. Parker. 1990. cDNA clone encoding Drosophila transcription factor TFIID. Proc. Natl. Acad. Sci. USA 87:9148-9152. Okhuma, Y., M. Horikoshi, R. G. Roeder, and C. Desplan. 1990. Engrailed, a homeodomain protein, can repress in vitro transcription by competition with the TATA box-binding protein transcription factor IID. Proc. Natl. Acad. Sci. USA 87:22892293. Peterson, M. G., N. Tanese, B. F. Pugh, and R. Tjian. 1990. Functional domains and upstream activation properties of cloned human TATA binding protein. Science 248:1625-1630. Poon, D., S. Schroeder, and C. K. Wang. Unpublished data. Ptashne, M. 1988. How eukaryotic transcriptional activators work. Nature (London) 335:683-689. Ptashne, M., and A. A. F. Gann. 1990. Activators and targets. Nature (London) 346:329-331. Pugh, B. F., and R. Tjian. 1990. Mechanism of transcriptional activation by Spl: evidence for coactivators. Cell 61:1187-1197. Reddy, P., and S. Hahn. 1991. Dominant negative mutations in yeast TFIID define a bipartite DNA-binding region. Cell 65:349357. Reinberg, D., and R. G. Roeder. 1987. Factors involved in specific transcription by mammalian RNA polymerase II: purification and functional analysis of initiation factors IIB and IIE. J. Biol. Chem. 262:3310-3321. Rosenberg, A. H., B. N. Lade, D. Chui, S. Lin, J. J. Dunn, and F. W. Studier. 1987. Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56:125-135. Rothstein, R. J. 1983. One step gene disruption in yeast. Methods Enzymol. 101:202-211. Saltzman, A. G., and R. Weinmann. 1989. Promoter specificity and modulation of RNA polymerase II transcription. FASEB J. 3:1723-1733. Sawadogo, M., and R. G. Roeder. 1985. Interaction of a genespecific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell 43:165-175. Schmidt, M. C., C. C. Kao, R. Pei, and A. J. Berk. 1989. Yeast TATA-box transcription factor gene. Proc. Natl. Acad. Sci. USA 86:7785-7789. Sherman, F., G. R. Fink, and J. B. Hicks. 1986. Methods in yeast genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Sikorski, R., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27. Smith, M. M., and 0. S. Andresson. 1983. DNA sequences of yeast H3 and H4 histone genes from two non-allelic gene sets encode identical H3 and H4 proteins. J. Mol. Biol. 196:663-690. Stringer, K. F., C. J. Ingles, and J. Greenblatt. 1990. Direct and selective binding of an acidic transcriptional activation domain to the TATA-box factor TFIID. Nature (London) 345:783-786. Sumimoto, H., Y. Ohkuma, T. Yamamoto, M. Horikoshi, and R. G. Roeder. 1990. Factors involved in specific transcription by mammalian RNA polymerase II: identification of general transcription factor TFIID. Proc. Natl. Acad. Sci. USA 87:91589162.