http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–2 ! 2015 Informa UK Ltd. DOI: 10.3109/19401736.2015.1038798
MITOGENOME ANNOUNCEMENT
The complete mitochondrial genome of Meriones meridianus (Rodentia: Cricetidae) and its phylogenetic analysis Guangjie Luo and Jicheng Liao
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/19/15 For personal use only.
Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou, China Abstract
Keywords
Meriones meridianus belongs to the genus Meriones in Gerbillinae. Total length of complete mitochondrial genome of M. meridianus is 16,376 bp and the heavy strand contains 32.8% A, 13.1% G, 25.3% C and 28.8% T. Sequences of protein-coding genes are 11,341 bp in length, accounting for 69.25%, approximately. Results of phylogenetic analysis shown that M. meridianus and Meriones unguiculatus were clustered in a single branch. This conclusion would be an important data for relevant studies about the genus Meriones, and mitochondrial genome would be an important supplement for the gene pool of Rodentia. It would play a pivotal role in researches about phylogeography and proteomics involving M. meridianus as well.
Complete mitochondrial genome, Gerbillinae, Meriones meridianus, phylogenetic analysis
Mitochondrial (mt) genome not only contains more information about single gene, but also provides larger data at the genomic level (Boore, 2006; Dowton et al., 2002; Masta, 2010). Most mt genomes are about 15–17 kb in size and replicates autonomously. In Metazoa, typical gene arrangement of 37 genes consists 22 transfer RNA genes (tRNAs), 2 ribosomal RNA genes (rRNAs) and 13 protein-coding genes (PCGs) (Boore, 1999; Feng et al., 2010; Liu et al., 2012). Meriones meridianus belongs to the genus Meriones in Gerbillinae (Luo et al., 2000). We extracted total genomic DNA of M. meridianus from its muscle sample using TIANamp Genomic DNA Kit (Tiangen Biotech Beijing, Co., Ltd, Beijing, China). The specimen was preserved in the School of Life Sciences, Lanzhou University, Lanzhou, China. Six pairs of primers (Table 1) were designed based on conserved regions of mt genes aligning mt sequences of M. meridianus and its sibling species with MEGA 6.06 (Tamura et al., 2013). We amplified DNA with 50 ml reaction system containing 10 ml 5PCR buffer (Mg2+ plus), 4 ml dNTP (2.5 mM each), 2 ml of each primer (10 mM each), 1 ml PrimeSTAR GXL DNA Polymerase (1.25 U/ml), 2 ml total genomic DNA (100–200 ng) and 29 ml water. PCR was run with pre-denaturation for 5 min at 98 C, followed by 30 cycles of denaturation for 10 s at 98 C, annealing for 15 s at 60 C, extension for 1 min/kb at 68 C and the final extension at 68 C for 5 min. From the Genbank, we downloaded mt genome of 15 species (Figure 1) with high similarity to M. meridianus and built phylogenetic tree with MrBayes version 3.2 (Ronquist et al., 2012) and Paup 4.0b10 (Swofford, 2002) using maximum
History Received 26 March 2015 Revised 29 March 2015 Accepted 5 April 2015 Published online 15 June 2015
Table 1. Primer pairs used for amplification and sequencing of the complete mitochondrial genome of Meriones meridianus. Name of primer
Sequence of primer (50 –30 )
MM (12S-F) MM (16S-R) MM (16S-F) MM (ND1-R) MM (ND1-F) MM (ND2-R) MM (ND2-F) MM (COX2-R) Inside* (ND2-COX3)
AGCCTATGAGGTGGAAAGCAATG CCCTCGTTTAGCCGTTCATTCT AGAATGAACGGCTAAACGAG GGAGGTGTATTAGTTGGTCGTAT CCTTAGCAGAAACTAACCGAAGTCC TTTCGTGTTTGAGTTTGATTTAGGC CCTCGATCAACCGAAGCAAC GGGGTAATGAAAGAGGCAAATAG AGGTCTTCGTAGTCTGTGTAT CTCCATTAACAGGCTTTCTACC TCGTTTTGAGGCTAGGGCTTCT GGACTGGAACCTCTGTGT GGTCCAACCACAGCTTTATACCG GTTTTTCTGGGCTTTCTACCACTCT AATAAAGGGATGCTCTACTGGTTGC TAAGCTTAACCCTCCTACGAC CCTATTTACGGGGGACTGGT TGCTTACGACAAACAGACCT GGCCTTAGAATCCAAAAAC ACCCTAGTTGACTGGATGTT GTCTAAGAGGTTGGTTGCTGTAT CAGCCTTAGTCCTGGTTCATCTT CCCATTGCTTTCCACCTCAT AAGGAATTAGGCACAGGT AATGATATCTGTGTCTTGGTAGTA
MM (COX3-F) MM (CYTB-R) Inside (COX3-CYTB)
MM (CYTB-F) MM (12S-R) Inside (CYTB-12S)
*Extra internal sequencing primer.
Correspondence: Jicheng Liao, Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou 730000, China. Tel: +86 13919484992. E-mail: [email protected]
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/19/15 For personal use only.
2
G. Luo & J. Liao
Mitochondrial DNA, Early Online: 1–2
Figure 1. Phylogenetic tree based on the mitochondrial genome of Meriones meridianus and other 15 species. The Genbank accession number of 15 species are as follows: Rattus niobe (KC152486), Rattus fuscipes (GU570664), Rattus tanezumi (KF011916), Rattus leucopus (GU570660), Mus terricolor (EU352649), Mus fragilicauda (KJ530563), Mus musculus musculus (KF781655), Mus cookii (KJ530561), Mus spretus (KM978950), Cricetulus kamensis (KJ680375), Cricetulus griseus (EU660217), Cricetulus longicaudatus (KM067270), Meriones unguiculatus (KF425526), Nannospalax carmeli (JN571137), Jaculus jaculus (AJ416890). Nannospalax carmeli and J. jaculus are designated as outgroup. The numbers on the right of internode branches are Bayesian posterior probability and bootstrap percentages for MP and ML analysis.
parsimony (MP) and maximum likelihood (ML) methods. In MP and ML methods, we valued 1000 of bootstrap and finally saved the minimum length tree. The total length of mt genome of Meriones meridianus is 16,376 bp in length and it is accessible at GenBank (Accession no.: KR013227). We analyzed the overall base composition of the heavy strand using MEGA 6.06, it contains 32.8% A, 13.1% G, 25.3% C and 28.8% T. PCGs are 11,341 bp in length, approximately accounting for 69.25% of the complete genome. As the initiation codon, GTG is for ND1 and ND4L, ATA is for ND2 and ND5, ATT is for ND3, ATG is for other PCGs. Similarly, TAA is termination codon for most of the PCGs and incomplete termination codon T is used for the genes ND1, COXIII, ND4 and CYTB, TA is for ND2. The heavy strand is conducted as the template for all PCGs except ND6 that is on the light strand. The phylogenetic tree, established by bayesian statistics, MP and ML methods showed a similar topological structure with very high support values (Figure 1). Meriones meridianus and M. unguiculatus were clustered in a single branch. This conclusion was identical to former results by morphological taxonomy and it would be significant molecular evidence for further research as well.
Acknowledgements We are grateful to LM Zhao and QS Zhao, School of Life Sciences, Lanzhou University, Lanzhou, China, who helped in the sampling process.
Declaration of interest The work was supported by the National Natural Science Foundation of China (Nos. 30870294, 31372179). The authors report no conflicts of
interest. The authors alone are responsible for the content and writing of the paper.
References Boore JL. (1999). Animal mitochondrial genomes. Nucleic Acids Res 27: 1767–80. Boore JL. (2006). The use of genome-level characters for phylogenetic reconstruction. Trends Ecol Evol 21:439–46. Dowton M, Castro LR, Austin, AD. (2002). Mitochondrial gene rearrangements as phylogenetic characters in the invertebrates: the examination of genome ‘morphology’. Invertebr Syst 16: 345–56. Feng X, Liu DF, Wang NX, Zhu CD, Jiang GF. (2010). The mitochondrial genome of the butterfly Papilio xuthus (Lepidoptera: Papilionidae) and related phylogenetic analyses. Mol Biol Rep 37:3877–88. Liu G, Zhou LZ, Gu CM. (2012). Complete sequence and gene organization of the mitochondrial genome of scaly-sided merganser (Mergus squamatus) and phylogeny of some Anatidae species. Mol Biol Rep 39:2139–45. Luo Z, Chen W, Gao W. (2000). Fauna Sinica. Beijing: Science Press. Masta SE. (2010). Mitochondrial rRNA secondary structures and genome arrangements distinguish chelicerates: Comparisons with a harvestman (Arachnida: Opiliones: Phalangium opilio). Gene 449: 9–21. Ronquist F, Teslenko M, van der MP, Ayres D, Darling A, Ohna SH, Larget BL, et al. (2012). Efficient bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539–42. Swofford DL. (2002). PAUP*: Phylogenetic analysis using parsimony, Version 4.0 b10. Sunderland (MA): Sinauer Associates. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–9.
MITOGENOME ANNOUNCEMENT
The complete mitochondrial genome of Meriones meridianus (Rodentia: Cricetidae) and its phylogenetic analysis Guangjie Luo and Jicheng Liao
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/19/15 For personal use only.
Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou, China Abstract
Keywords
Meriones meridianus belongs to the genus Meriones in Gerbillinae. Total length of complete mitochondrial genome of M. meridianus is 16,376 bp and the heavy strand contains 32.8% A, 13.1% G, 25.3% C and 28.8% T. Sequences of protein-coding genes are 11,341 bp in length, accounting for 69.25%, approximately. Results of phylogenetic analysis shown that M. meridianus and Meriones unguiculatus were clustered in a single branch. This conclusion would be an important data for relevant studies about the genus Meriones, and mitochondrial genome would be an important supplement for the gene pool of Rodentia. It would play a pivotal role in researches about phylogeography and proteomics involving M. meridianus as well.
Complete mitochondrial genome, Gerbillinae, Meriones meridianus, phylogenetic analysis
Mitochondrial (mt) genome not only contains more information about single gene, but also provides larger data at the genomic level (Boore, 2006; Dowton et al., 2002; Masta, 2010). Most mt genomes are about 15–17 kb in size and replicates autonomously. In Metazoa, typical gene arrangement of 37 genes consists 22 transfer RNA genes (tRNAs), 2 ribosomal RNA genes (rRNAs) and 13 protein-coding genes (PCGs) (Boore, 1999; Feng et al., 2010; Liu et al., 2012). Meriones meridianus belongs to the genus Meriones in Gerbillinae (Luo et al., 2000). We extracted total genomic DNA of M. meridianus from its muscle sample using TIANamp Genomic DNA Kit (Tiangen Biotech Beijing, Co., Ltd, Beijing, China). The specimen was preserved in the School of Life Sciences, Lanzhou University, Lanzhou, China. Six pairs of primers (Table 1) were designed based on conserved regions of mt genes aligning mt sequences of M. meridianus and its sibling species with MEGA 6.06 (Tamura et al., 2013). We amplified DNA with 50 ml reaction system containing 10 ml 5PCR buffer (Mg2+ plus), 4 ml dNTP (2.5 mM each), 2 ml of each primer (10 mM each), 1 ml PrimeSTAR GXL DNA Polymerase (1.25 U/ml), 2 ml total genomic DNA (100–200 ng) and 29 ml water. PCR was run with pre-denaturation for 5 min at 98 C, followed by 30 cycles of denaturation for 10 s at 98 C, annealing for 15 s at 60 C, extension for 1 min/kb at 68 C and the final extension at 68 C for 5 min. From the Genbank, we downloaded mt genome of 15 species (Figure 1) with high similarity to M. meridianus and built phylogenetic tree with MrBayes version 3.2 (Ronquist et al., 2012) and Paup 4.0b10 (Swofford, 2002) using maximum
History Received 26 March 2015 Revised 29 March 2015 Accepted 5 April 2015 Published online 15 June 2015
Table 1. Primer pairs used for amplification and sequencing of the complete mitochondrial genome of Meriones meridianus. Name of primer
Sequence of primer (50 –30 )
MM (12S-F) MM (16S-R) MM (16S-F) MM (ND1-R) MM (ND1-F) MM (ND2-R) MM (ND2-F) MM (COX2-R) Inside* (ND2-COX3)
AGCCTATGAGGTGGAAAGCAATG CCCTCGTTTAGCCGTTCATTCT AGAATGAACGGCTAAACGAG GGAGGTGTATTAGTTGGTCGTAT CCTTAGCAGAAACTAACCGAAGTCC TTTCGTGTTTGAGTTTGATTTAGGC CCTCGATCAACCGAAGCAAC GGGGTAATGAAAGAGGCAAATAG AGGTCTTCGTAGTCTGTGTAT CTCCATTAACAGGCTTTCTACC TCGTTTTGAGGCTAGGGCTTCT GGACTGGAACCTCTGTGT GGTCCAACCACAGCTTTATACCG GTTTTTCTGGGCTTTCTACCACTCT AATAAAGGGATGCTCTACTGGTTGC TAAGCTTAACCCTCCTACGAC CCTATTTACGGGGGACTGGT TGCTTACGACAAACAGACCT GGCCTTAGAATCCAAAAAC ACCCTAGTTGACTGGATGTT GTCTAAGAGGTTGGTTGCTGTAT CAGCCTTAGTCCTGGTTCATCTT CCCATTGCTTTCCACCTCAT AAGGAATTAGGCACAGGT AATGATATCTGTGTCTTGGTAGTA
MM (COX3-F) MM (CYTB-R) Inside (COX3-CYTB)
MM (CYTB-F) MM (12S-R) Inside (CYTB-12S)
*Extra internal sequencing primer.
Correspondence: Jicheng Liao, Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou 730000, China. Tel: +86 13919484992. E-mail: [email protected]
Mitochondrial DNA Downloaded from informahealthcare.com by Nyu Medical Center on 06/19/15 For personal use only.
2
G. Luo & J. Liao
Mitochondrial DNA, Early Online: 1–2
Figure 1. Phylogenetic tree based on the mitochondrial genome of Meriones meridianus and other 15 species. The Genbank accession number of 15 species are as follows: Rattus niobe (KC152486), Rattus fuscipes (GU570664), Rattus tanezumi (KF011916), Rattus leucopus (GU570660), Mus terricolor (EU352649), Mus fragilicauda (KJ530563), Mus musculus musculus (KF781655), Mus cookii (KJ530561), Mus spretus (KM978950), Cricetulus kamensis (KJ680375), Cricetulus griseus (EU660217), Cricetulus longicaudatus (KM067270), Meriones unguiculatus (KF425526), Nannospalax carmeli (JN571137), Jaculus jaculus (AJ416890). Nannospalax carmeli and J. jaculus are designated as outgroup. The numbers on the right of internode branches are Bayesian posterior probability and bootstrap percentages for MP and ML analysis.
parsimony (MP) and maximum likelihood (ML) methods. In MP and ML methods, we valued 1000 of bootstrap and finally saved the minimum length tree. The total length of mt genome of Meriones meridianus is 16,376 bp in length and it is accessible at GenBank (Accession no.: KR013227). We analyzed the overall base composition of the heavy strand using MEGA 6.06, it contains 32.8% A, 13.1% G, 25.3% C and 28.8% T. PCGs are 11,341 bp in length, approximately accounting for 69.25% of the complete genome. As the initiation codon, GTG is for ND1 and ND4L, ATA is for ND2 and ND5, ATT is for ND3, ATG is for other PCGs. Similarly, TAA is termination codon for most of the PCGs and incomplete termination codon T is used for the genes ND1, COXIII, ND4 and CYTB, TA is for ND2. The heavy strand is conducted as the template for all PCGs except ND6 that is on the light strand. The phylogenetic tree, established by bayesian statistics, MP and ML methods showed a similar topological structure with very high support values (Figure 1). Meriones meridianus and M. unguiculatus were clustered in a single branch. This conclusion was identical to former results by morphological taxonomy and it would be significant molecular evidence for further research as well.
Acknowledgements We are grateful to LM Zhao and QS Zhao, School of Life Sciences, Lanzhou University, Lanzhou, China, who helped in the sampling process.
Declaration of interest The work was supported by the National Natural Science Foundation of China (Nos. 30870294, 31372179). The authors report no conflicts of
interest. The authors alone are responsible for the content and writing of the paper.
References Boore JL. (1999). Animal mitochondrial genomes. Nucleic Acids Res 27: 1767–80. Boore JL. (2006). The use of genome-level characters for phylogenetic reconstruction. Trends Ecol Evol 21:439–46. Dowton M, Castro LR, Austin, AD. (2002). Mitochondrial gene rearrangements as phylogenetic characters in the invertebrates: the examination of genome ‘morphology’. Invertebr Syst 16: 345–56. Feng X, Liu DF, Wang NX, Zhu CD, Jiang GF. (2010). The mitochondrial genome of the butterfly Papilio xuthus (Lepidoptera: Papilionidae) and related phylogenetic analyses. Mol Biol Rep 37:3877–88. Liu G, Zhou LZ, Gu CM. (2012). Complete sequence and gene organization of the mitochondrial genome of scaly-sided merganser (Mergus squamatus) and phylogeny of some Anatidae species. Mol Biol Rep 39:2139–45. Luo Z, Chen W, Gao W. (2000). Fauna Sinica. Beijing: Science Press. Masta SE. (2010). Mitochondrial rRNA secondary structures and genome arrangements distinguish chelicerates: Comparisons with a harvestman (Arachnida: Opiliones: Phalangium opilio). Gene 449: 9–21. Ronquist F, Teslenko M, van der MP, Ayres D, Darling A, Ohna SH, Larget BL, et al. (2012). Efficient bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539–42. Swofford DL. (2002). PAUP*: Phylogenetic analysis using parsimony, Version 4.0 b10. Sunderland (MA): Sinauer Associates. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–9.
