MOLECULAR AND CELLULAR BIOLOGY, Jan. 1991, p. 486-496 0270-7306/91/010486-11$02.00/0 Copyright X 1991, American Society for Microbiology

Vol. 11, No. 1

Suppression of Ribosomal Reinitiation at Upstream Open Reading Frames in Amino Acid-Starved Cells Forms the Basis for GCN4 Translational Control JEAN-PIERRE ABASTADO, PAUL F. MILLER, BELINDA M. JACKSON, AND ALAN G. HINNEBUSCH* Section on Molecular Genetics of Lower Eukaryotes, Laboratory of Molecular Genetics, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892 Received 9 August 1990/Accepted 25 September 1990

GCN4 encodes a transcriptional activator of amino acid-biosynthetic genes in Saccharomyces cerevisiae that is regulated at the translational level by upstream open reading frames (uORFs) in its mRNA leader. uORF4 (counting from the 5' end) is sufficient to repress GCN4 under nonstarvation conditions; uORF1 is required to overcome the inhibitory effect of uORF4 and stimulate GCN4 translation in amino acid-starved cells. Insertions of sequences with the potential to form secondary structure around uORF4 abolish derepression, indicating that ribosomes reach GCN4 by traversing uORF4 sequences rather than by binding internally to the GCN4 start site. By showing that wild-type regulation occurred even when uORF4 was elongated to overlap GCN4 by 130 nucleotides, we provide strong evidence that those ribosomes which translate GCN4 do so by ignoring the uORF4 AUG start codon. This conclusion is in accord with the fact that translation of a uORF4-lacZ fusion was lower in a derepressed gcdl mutant than in a nonderepressible gcn2 strain. We also show that increasing the distance between uORF1 and uORF4 to the wild-type spacing that separates uORFl from GCN4 specifically impaired the ability of uORF1 to derepress GCN4 translation. As expected, this alteration led to increased uORF4-lacZ translation in gcdl cells. Our results suggest that under starvation conditions, a substantial fraction of ribosomes that translate uORFl fail to reassemble the factors needed for reinitiation by the time they scan to uORF4, but become competent to reinitiate after scanning the additional sequences to GCN4. Under nonstarvation conditions, ribosomes would recover more rapidly from uORFl translation, causing them all to reinitiate at uORF4 rather than at GCN4.

The GCN4 protein of the yeast Saccharomyces cerevisiae is a trahscriptional activator of more than 30 genes involved in the biosynthesis of 10 different amino acids. In response to amino acid starvation, transcription of these genes is stimulated because the rate of GCN4 protein synthesis increases under these conditions. GCN4 expression is regulated by amino acid availability through a translational control mechanism involving four short upstream open reading frames (uORFs) in the leader of GCN4 mRNA. A subset of these uORFs strongly inhibit translation initiation at GCN4 under nonstarvation conditions, and this inhibitory effect is overcome when cells are starved for an amino acid (reviewed in reference 11). Translational repression of GCN4 by the uORFs is dependent on negative regulators encoded by GCD genes. In addition to regulating GCN4 expression, it appears that GCD gene products carry out essential cellular functions, and evidence is accumulating that these functions are involved with the initiation of general protein synthesis (11, 35, 37). Positive regulators encoded by GCN2 and GCN3 are required for increased translation of GCN4 mRNA under starvation conditions, and these factors are thought to function by antagonizing one or more of the negative-acting GCD proteins (11). Numerous observations indicate that uORFs in eucaryotic mRNAs can inhibit translation of downstream coding sequences. This inhibitory effect has been explained by proposing that 40S initiation complexes bind at or near the 5' end of the mRNA and must traverse the entire leader to reach the AUG start codon (the scanning model). In the *

presence of a uORF, initiation occurs preferentially at that site, which in turn reduces initiation downstream because reinitiation at internal AUG codons appears to be inefficient (reviewed in reference 18). Interestingly, uORFs 3 and 4 in GCN4 mRNA (counting from the 5' end) inhibit GCN4 expression much more effectively than do uORFs 1 and 2 (24). In a previous report, we showed that uORF4 is more inhibitory than uORF1 partly because it is about 200 nucleotides (nt) closer than uORF1 to the GCN4 start codon (22, 38). More important determinants of the stronger inhibitory effect of uORF4 compared to uORF1 are the sequences surrounding their termination codons. Replacement of the last codon and 10 nt immediately 3' to the uORF1 stop codon with the corresponding sequence from uORF4 increased the inhibitory effect of solitary uORF1 by a factor of 10. Because of their position near the uORF4 stop codon, we proposed that these inhibitory sequences reduce the probability of reinitiation downstream, perhaps by causing ribosomes to dissociate from the mRNA following termination. By contrast, the corresponding sequences at the uORF1 stop codon allow ribosomes to resume scanning and reinitiate at downstream start sites (22). Moving uORF1 farther downstream reduces translation of GCN4, perhaps because the time needed to scan between the two start sites is now insufficient for reacquisition of the factors needed for reinitiation following uORF1 translation (17). When present alone, each of the GCN4 uORFs inhibits GCN4 expression independently of amino acid levels and GCN and GCD regulatory factors, to an extent that depends on the particular uORF. However, when situated upstream from uORF4, uORF1 functions as a positive control element

Corresponding author. 486

VOL. 11, 1991

_

BASIS OF GCN4 TRANSLATIONAL CONTROL

Fr

487

80

[ F' 100 90 10 40 50 60 70 TCTTATATAA TAGATATACA AAACAAAACA AAACAAAAAC TCACAACACA GGTTACTCTC CCCCCTAAAT TCAAATTTTT TTTGCCCATC AGTTTCACTA

200 180 190 160 170 140 150 120 130 110 GCGAATTATA CAACTCACCA GCCACACAGC TCACTCATCT ACTTCGCAAT CAAAACAAAA TATTTTATTT TAGTTCAGTT TATTAAGTTA TTATCAGTAT

uORF1

210 220 CGTATTAAAA AATTAAAGAT CAT

'310

TGTTAPCTTT

TGGCTTGCTA

280 290 260 270 250 GATTAT ATTTTGTTTT TAAAGTAGAT TATTATTAGA AAATTATTAA

340 350 360 370 380 390 320 330 400 ATTGAAAGAG AAAATTTATT TTCCCTTATT AATTAAAGTC CTTTACTTTT TTTGAAAACT GTCAGTTTTT TGAAGAGTTA TTTGTTTTGT

~~~uORF4

410 TACCAATTGC TATGTA

460

430 CCGTAATT TTATT

TGTTTCC

-/T\

CCCTATACTA TCATTAATTA AATCATTATT

.

....

1

93-codon

4 ACTCGCCA ATAAAAATTT

ULdJN4

46-codon

^

_____I

A

1._.

.

,

_

_

_

__

6

.

rsmvrsse _ . . .

A

GCTCAAGAAA ATAAATTAAA TACAAATAAA ATGTCCGAAT

S2Al

620 640 s^rrsse rsrr ~ ~ ~ ^^rsfe+ ~~--

w. .1

47 TTCTGTCAAA TTATCCAGGT

-

ATTACTAAAGTTGTTTAC CAATSTGTCT

S1 610

,

300

GAGAAT%CTG

670 srsoss

...

(T)

680

690 ssr-e

70 -r

-

C T

. 740 750 + 730 *--71Q ACCAATGGTT GGCCAAT GA TTTTTGATAA ATTCATCAAG ACTGAAGAGG ATCC

/(A)\

FIG. 1. Leader region of GCN4 mRNA. Numbering is relative to the farthest upstream of the three major transcription start sites (arrows at the top) (9). uORFs 1 and 4 and the beginning of GCN4 are boxed with solid lines; uORFs 2 and 3 are boxed with dotted lines, and the substitutions that remove their ATG codons are shown in lowercase letters; the hatched box designates the 93-codon uORF4. The arrow intersecting the latter at +577 marks the end of the 46-codon uORF4, from which the 93-codon uORF4 was derived. Insertions and substitutions shown below the sequence were introduced to construct the 46-codon uORF4 in p470, 93-codon uORF4 in pA59, the GCN4 stop codon mutation in pA73, and the uORF4-1acZ fusion in pA74 (see text). ATG triplets in the region of overlap between the 93-codon uORF4 and GCN4 are indicated by ellipses above the sequence. Hairpin schematics indicate the positions of insertions made to introduce secondary structure in the leader for the constructs shown in Fig. 2. The S1 and S2 sequences used to change the length of the leader are underlined.

by reducing the inhibitory effect of uORF4 on translation initiation at GCN4 (23, 34). The ability of uORF1 to stimulate GCN4 expression was abolished by replacing the uORF1 termination region with that found at uORF4, which prevents reinitiation downstream (22). From this result, we proposed that in amino acid-starved cells, ribosomes must translate uORF1 and resume scanning in order to reinitiate at GCN4. To explain this requirement, we suggested that ribosomes emerge from translation of uORF1 lacking certain initiation factors which are normally present during primary initiation events on the mRNA. For example, factors that bind to the 40S subunit at the mRNA cap may be removed from the ribosome by translation of uORF1. The absence of these factors following uORF1 translation, coupled with reduced function of GCD factors under starvation conditions, increases the probability that ribosomes will traverse uORF4 and reach the GCN4 start site (38). This could occur either by the ribosomes' ignoring the uORF4 AUG codon or by their translating uORF4 and reinitiating again at GCN4. In this report, we provide strong evidence that ribosomes scanning downstream from uORF1 are able to reach GCN4 by ignoring the uORF4 AUG codon. This occurs because uORF4 is too close to uORF1 for efficient reinitiation under amino acid starvation conditions. Thus, we propose that an increased scanning-time requirement for reinitiation in amino acid-starved cells forms the basis for translational control of GCN4 expression.

MATERIALS AND METHODS Construction of mutant GCN4 alleles. Point mutations were introduced by oligonucleotide-directed mutagenesis (40) or by the polymerase chain reaction (28) with synthetic primers containing the desired mutations. The wild-type parental plasmid p200 (24) is an Escherichia coli-yeast shuttle vector carrying the yeast URA3, ARSI, and CEN4 sequences and a GCN4 allele containing wild-type uORF1 and uORF4 but lacking uORF2 and uORF3 (Fig. 1). p413 (13) is identical to p200 except for G to A and T to C substitutions in the GCN4 leader at nt +479 and +481, respectively, that create a BglII site. In addition, the EcoRI site at the junction between GCN4 sequences and the vector is destroyed in p413. pA44 is identical to p200 except for C to T and G to C substitutions at nt +414 and +416, respectively, that create a SnaBI site upstream from uORF4, plus A to G and A to C substitutions at nt +496 and +497, respectively, that create a HindIII site downstream from uORF4. Plasmid pA46 was derived from pA44 by inserting between the SnaBI and BstEII site at positions +414 and +454, respectively, a double-stranded oligonucleotide that differs from the parental sequence by the insertion of GAATTC CCATCTTGGGAATTC between positions +417 and +418. pA47 and pA48 are identical to pA46 except that the inserted sequences are GAATTCCATTTGGAATTC and GAAT TACCATCTTGGGACTTC, respectively. pA50 was derived from pA44 by inserting a double-stranded oligonucleotide between the BstEII and HindIII sites at nt +454 and +494

488

ABASTADO ET AL.

that introduces the sequence GAATTCCCATCTTGGGA ATTC between positions +481 and +482. pA57 is identical to pA50 but contains the same insertion as pA48. Plasmid pA56 was derived from p413 by inserting a double-stranded oligonucleotide that introduces the S2 sequence underlined in Fig. 1 into the EcoRI site at nt +293. pA60 and pA61 were derived in the same way by inserting one or two copies, respectively, of the Si sequence underlined in Fig. 1 at the same EcoRI site. pA75, pA76, and pA77 are identical to pA56, pA60, and pA61, respectively, except that the ATG codon of uORF4 was changed to ATC, creating a BglII site, as described previously (24). pA70, pA71, and pA72 were derived from pA44 by inserting one, two, or three copies, respectively, of an oligonucleotide containing the Si sequence into the HindlIl site at position +494. pA78, pA79, and pA80 are identical to pA70, pA71, and pA72, respectively, except that the T in the ATG of uORF1 was deleted, creating a HindIII site, as described previously (24). pAJ19 was constructed from pA80 by insertion of a double-stranded oligonucleotide that introduces the sequence CGGATCCGTCGACGGATCCG at the BstEII site at position +453. Plasmid p470 (25) was derived from p413 by inserting a T at nt +449 to extend uORF4 by 129 nt (Fig. 1). pA59 has the same T insertion at +449 and also an A to G substitution at nt +565 that creates an XhoI site, which was used to introduce additional mutations by the polymerase chain reaction at nt +577, +621, and +623 (Fig. 1). These mutations remove the next two stop codons present in frame with the 46-codon version of uORF4, producing a 93-codon uORF4, without changing the GCN4 protein coding sequence. pA73 is identical to pA59 except for a G to T substitution at nt +597 that creates an in-frame termination codon just downstream from the +591 start codon. pA74 is identical to pA59 except for an A inserted between nt +712 and +713 that fuses the 93-codon uORF4 in frame with GCN4. pAJ7 was constructed by exchanging the 3.7-kb EcoRI fragments of pA61 and pA59. pAJ8 was constructed by exchanging the 3.7-kb EcoRI fragments of pA61 and pA74. For all of the above plasmids, derivatives containing GCN4-lacZ fusions were obtained by inserting a 3.2-kb BamHI fragment containing codons 9 through 1023 of lacZ at the GCN4 BamHI site at nt +749, as already described (9). Plasmids p235, p237, and their lacZ-containing derivatives were described previously (24). Assays of GCN4 expression. Plasmids shown in the figures that contained GCN4 alleles with different leader sequences were transformed (14) into strain H384 (MATa his1-29 gcn4103 ura3-52) described previously (24). Complementation of the gcn4-103 deletion mutation was assayed by replicaplating transformants to minimal medium (SD) plates containing excess leucine and 3-aminotriazole (3-AT) (12). Plasmids containing the corresponding GCN4-lacZ fusions were introduced into strains F113 (MATa inol cani ura3-52), H15 (MATo gcn2-1 leu2-3 leu2-112 ura3-52), and F98 (MAToa gcdl-J0J ura3-52), all described previously (24). For nonstarvation conditions, these transformants were grown for 6 h at 30°C in SD supplemented with 2 mM leucine, 0.5 mM isoleucine, 0.5 mM valine, and 0.2 mM inositol. For starvation conditions, 3-AT was added to 10 mM after 2 h of growth under nonstarvation conditions, and incubation was continued for another 6 h. Extracts were prepared and assayed for ,-galactosidase activity as previously described (21), except that cells were lysed in the presence of glass beads in a Braun homogenizer for 90 s at 4°C.

MOL. CELL. BIOL.

For mRNA analysis, H384 transformants containing plasmid-borne GCN4 alleles were grown under the starvation conditions described above except that the medium was supplemented with 0.2 mM inositol and 0.3 mM histidine, and 0.5 mM 5-methyltryptophan was added to cause tryptophan limitation (39). 5-Methyltryptophan was used instead of 3-AT because H384 contains a leaky HIS] mutation and is unable to grow in the presence of 3-AT when transformed with a plasmid that fails to complement the gcn4 deletion in this strain. By contrast, such transformants can grow in the presence of 5-methyltryptophan. H15 and F98 transformants containing GCN4-lacZ constructs were grown exactly as described above for assaying fusion enzyme activity. Isolation of total RNA and blot hybridization analysis with radiolabeled probes to analyze the steady-state levels of pyruvate kinase (PYK1), GCN4, and GCN4-lacZ mRNAs were all conducted as described previously (10). Pulse-labeling and immunoprecipitation of GCN4-lacZ and uORF4-lacZ fusion proteins. Cells (2 x 108) were grown for 6 h under nonstarvation conditions in SD medium as described above, collected by centrifugation, resuspended in 1 ml of fresh medium, and pulsed for 5 min with 300 ,uCi of [35S] methionine (1,200 Ci/mmol). Cells were lysed immediately as described previously (16) with the addition of several protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 0.15 ,uM aprotinin, 1 ,uM pepstatin, 1 ,uM leucopeptin). Samples of extracts containing equivalent amounts of trichloroacetic acid-precipitable counts were incubated for 2 h with 0.6 ,ug of a monoclonal antibody against 0-galactosidase (Promega, Inc.) in 1 ml of IP buffer (50 mM Tris hydrochloride [pH 7.5], 150 mM NaCl, 0.1 mM EDTA, 0. 5% Tween 20) containing the protease inhibitors listed above and then for 45 min with 60 ,ug of Staphylococcus aureus protein A coupled to agarose beads (Boehringer Mannheim). Immunoprecipitates were collected by centrifugation, washed six times with 1 ml of IP buffer, resuspended in Laemmli loading buffer (20), and boiled, and the supernatants were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (20), followed by fluorography (3). The amounts of radioactivity in the fusion protein bands were quantitated by scanning densitometry of the fluorograms.

RESULTS We showed previously that expression of P-galactosidase activity from a GCN4-lacZ fusion containing only uORFs 1 and 4 is regulated almost identically to that of an analogous construct containing all four uORFs (24, 38). Therefore, in the experiments presented below, we chose to analyze GCN4-lacZ constructs in which uORFs 2 and 3 were eliminated by point mutations in their ATG codons (Fig. 1). Three different constructs were used as parental wild-type alleles, which differed by the presence of restriction sites around uORF4 that were introduced to facilitate site-directed mutagenesis (see Materials and Methods). As expected, all three wild-type fusions expressed eightfold more enzyme activity in wild-type cells grown under histidine starvation conditions (derepressing) than under nonstarvation conditions (repressing). Moreover, expression from each was constitutively derepressed in a gcdl mutant at a level about 10-fold higher than the constitutive level seen in a nonderepressible gcn2 mutant (see below). In addition to assaying fusion enzyme activity, we examined all mutations for their effects on derepression of authentic GCN4 protein by measuring the ability of the mutant GCN4 alleles to complement a gcn4 chromosomal deletion

VOL.

BASIS OF GCN4 TRANSLATIONAL CONTROL

11, 1991

for the failure to grow in the presence of 3-AT, an inhibitor of histidine biosynthesis. As shown below, complementation of the gcn4 deletion was always well correlated with expression of GCN4-lacZ enzyme activity under derepressing conditions. Small insertions with the potential to form secondary structure upstream or downstream from uORF4 greatly inhibit GCN4 expression. Insertions of sequences with the potential to form strong secondary structure in the mRNA leader generally inhibit translation in eucaryotes, presumably because they interfere with the scanning process (reviewed in references 18 and 31). Evidence was presented that, for poliovirus mRNA, these negative elements can be overcome by a specialized process of internal initiation (27). A similar mechanism could be proposed for GCN4 mRNA: under starvation conditions, ribosomes could circumvent the scanning process and bind directly to the GCN4 AUG codon to overcome the inhibitory effects of uORFs 3 and 4. In an effort to rule out this possibility, we introduced a sequence capable of forming a stable secondary structure at different positions in the GCN4 mRNA leader. This sequence, GAATTCCCATCTTGGGAATTC, is expected to form a stem-loop structure in the mRNA consisting of 8 bp (involving the underlined nucleotides) and five unpaired residues forming a loop (8). Sequences with potential secondary structures of similar predicted stabilities greatly inhibited translation of other yeast mRNAs (HIS4 and CYCJ) when introduced into the middle of the leader or just upstream from the AUG codon (1, 2, 6). Therefore, insertions of this sequence at any position in the GCN4 mRNA leader should inhibit GCN4 expression if initiation complexes must traverse the entire 591-nt leader to reach the GCN4 start codon. By contrast, if internal initiation at the GCN4 start site occurs under derepressing conditions, then insertions near uORF4, located more than 100 nt upstream from the GCN4 AUG codon, might not inhibit GCN4 expression. When the GAATTCCCATCTTGGGAATTC insertion was made 22 nt upstream from uORF4 or 30 nt downstream from uORF4 in the wild-type construct pA44, GCN4-lacZ expression was greatly reduced under both repressing and derepressing conditions (constructs pA46 and pA50, Fig. 2). RNA blot hybridization analysis showed that, relative to PYK1 mRNA levels, the steady-state amounts of GCN4 mRNA for these two mutant constructs were equal to or greater than those of the parental wild-type construct in the Agcn4 strain H384 grown under starvation conditions (Fig. 3). (The greater transcript level seen for the pA46 construct probably reflects increased transcription of the GCN4 construct because of amino acid starvation attendant on loss of GCN4 activity. The GCN4 mRNA level is known to increase under such severe starvation conditions [10].) We also examined the levels of the corresponding pA46 and pA50 GCN4-lacZ transcripts in the derepressed gcdl mutant and found them to be very similar to that of the wild-type fusion mRNA (data not shown). These results are consistent with the idea that the insertions inhibited GCN4 expression at the translational level. In an attempt to show that the inhibitory effect of these insertions resulted from formation of the predicted stemloop structures, we inserted at the same positions in the leader two different modifications of the GAATTCCCATCT TGGGAATTC sequence that are expected to form less stable structures than the parental sequence. The predicted stem length for the insert in construct pA47 is 1 bp shorter than that predicted for pA46. The inserts in pA48 and pA57

uORF1

A

uORF4

489

GCN4

/ ~-IZI7/

pA44

pA46, pA47, pA48 pA50, pA57

N

B

x

x i/

-GCN4-lacZ activity Construct

pA44 (wt) pA46 pA47 pA48 pA50 pA57

AH

(kcal)

wt

R

DR

gcn2

gcdl

gcdl/ gcn2

NA

17

130

18

250

14

-8.7

2.5

5.5

5

12

2.4

-5.8

7.6

22

13

41

3

0.3

8

32

14

98

7

-8.7

1

6

1

11

11

0.3

3.6

47

6

69

12

Complementaton of gcn4A

++

++

FIG. 2. Insertion of sequences with the potential to form secondary structure around uORF4 greatly reduces GCN4 expression. (A) Schematic showing the positions of insertions made to introduce stable secondary structure in the vicinity of uORF4 in different constructs. X's indicate point mutations in the ATG codons of uORFs 2 and 3. The constructs are drawn approximately to scale. The insertions in pA47 and pA48 differ from that in pA46 by 1 or 2 bp, respectively, than should produce less stable structures than that predicted for pA46. Likewise, the pA57 insertion should form a less stable structure than that expected to form in pA50. (B) Effects of the hairpin insertions on GCN4 expression. AH gives the predicted stability of the inserted hairpin structures, calculated as described before (41). The plasmids listed carry the GCN4 alleles with the leader sequences indicated in panel A that were tested for complementation of a chromosomal gcn4 deletion (last column) by measuring the growth rate of transformants after replica-plating to medium containing 3-AT. Growth was scored qualitatively after 2 or 3 days at 30°C. P-Galactosidase activities were measured in several wild-type (wt), nonderepressible gcn2-1, and constitutively derepressed gcdl-JO1 transformants containing the corresponding GCN4-lacZ constructs, grown under nonstarvation (R) or histidine starvation (DR) conditions. The results obtained from different transformants of the same strain were averaged; the maximum standard error in these experiments was 27% of the mean value. The results shown for the gcn2 and gcdl mutants are the averages of data obtained under both growth conditions. gcdl/gcn2 gives the ratio of the mean values for the two strains.

contain 2-nt substitutions that introduce two mismatches into the middle of the predicted stem without changing its base composition. As shown in Fig. 2, decreasing the stability of the predicted secondary structure by these alterations increased GCN4 expression, suggesting that the inhibitory effect of the GAATTCCCATCTTGGGAATTC insertions is due, at least in part, to formation of the predicted secondary structure in the mRNA. The remaining inhibitory effect associated with the insertions in pA48 and pA57 may occur because these sequences are still expected to exist in a stem-loop structure in a significant fraction of the mRNA molecules at any given time. In addition to the constructs shown in Fig. 2, introduction of the GAATTCCCATCTTGGGAATTC sequence at positions 140 nt upstream from uORF1, 140 nt upstream from uORF4, 110 nt downstream from uORF4 (30 nt upstream from GCN4), and between the second and third codons of

490

_

ABASTADO ET AL.

uORF1

A p200 GCN4 *

__

p470

PYK

pA59

NoUPS-~

pA73 FIG. 3. Steady-state levels of GCN4 mRNA in selected transformants containing plasmid-borne GCN4 alleles in a Agcn4 strain. Transformants of strain H384 containing the indicated plasmids were grown under starvation conditions, and total RNA was extracted and analyzed by RNA blot hybridization analysis with radiolabeled probes for GCN4 and PYKI mRNAs. The latter was examined as a control for the total amount of mRNA loaded in each lane. The wild-type construct (WT) analyzed was pA44; YCp5O is the vector alone.

uORF4 all had strong inhibitory effects on GCN4 expression (data not shown). Together with the data shown in Fig. 2, these results strongly suggest that translation of GCN4 coding sequences does not occur by internal initiation. Extensive overlap between uORF4 and the GCN4 coding sequences has little or no effect on GCN4 expression. The results presented in the previous section suggest that ribosomes scanning downstream from uORF1 must physically traverse uORF4 sequences to reach the GCN4 start codon. This process could occur by either of two mechanisms: ribosomes scan past the uORF4 AUG codon without initiating translation and then reinitiate once they reach GCN4, or ribosomes translate uORF4, resume scanning, and reinitiate at GCN4. In a previous study (25) we showed that removing the termination codon of uORF4 and lengthening it to 46 codons to make it terminate only 11 nt upstream from GCN4 had little or no effect on GCN4 expression (p470, Fig. 4). This result is easily explained by the first mechanism, because if ribosomes scan past uORF4 to reach GCN4, then the length and termination site of uORF4 would be of little consequence. To explain this result by the second mechanism, it is necessary to propose that reducing the distance between uORF4 and the GCN4 start site from 140 nt (in the wild type) to 11 nt has little effect on the efficiency of reinitiation at the GCN4 start codon following termination at uORF4. This proposal seems at odds with the results of Kozak, showing that inhibition of preproinsulin synthesis by a uORF increased as the intercistronic distance was decreased from 79 to 11 nt (17); however, the length dependence for reinitiation observed in this study may not apply to all eucaryotic mRNAs. The results of other studies suggested that a uORF which extensively overlaps the downstream cistron is even more inhibitory than one that terminates very close to the beginning of the next coding sequence, presumably because reinitiation is very inefficient when ribosomes are forced to scan "backwards" over large distances or additional AUG codons (15, 26, 29, 33). In view of these findings, we decided to apply a more stringent test of the second hypothesis mentioned above by eliminating two more termination codons from the 46-codon version of uORF4, producing a 93-codon version of uORF4 that terminates 130 nt downstream from the beginning of GCN4 (Fig. 1). Remarkably, this alteration also had little or no effect on GCN4 expression under repressing or derepressing conditions (pA59, Fig. 4). The AUG codon at nt +591 is thought to be the wild-type

E01

B

MOL. CELL. BIOL.

uORF4

GCN4

/ / I/

x

GCN4-lacZ activity

wt

Construct

p200 (wt) p470 pA59 pA73

R

DR

gcdl gcnZ gcdl gcn2

15

130

21

270

14

97

25

200

8

16

115

22

280

13

2

2

3.5

2.3

0.7

13

SD+3AT

C

Complementation of gcn4A

SD

YCp5O- vector alone p2A0 _

pA59

pA73

1

7 _mmm~

FIG. 4. Elongating uORF4 to overlap GCN4 has little or no effect on regulation of GCN4 expression. (A) Schematics of the constructs containing the 46-codon (p470) and 93-codon (pA59) versions of uORF4 (hatched). pA73 contains an in-frame terminator at the third codon in GCN4. X's indicate point mutations in the ATG codons of uORFs 2 and 3. The constructs are drawn approximately to scale. (B) Analysis of the constructs shown in panel A for GCN4 expression was conducted exactly as described in the legend to Fig. 2. The maximum standard error in these experiments was 35% of the mean values shown. (C) Ability to complement the chromosomal gcn4 deletion in H384 is shown for the plasmid-borne GCN4 alleles (depicted on the left) by the amount of growth visible 3 days after replica-plating transformants to SD medium containing 3-AT (SD+ 3AT). The pA59 construct complemented the defect to the same extent as the parental wild-type gene on p200; complementation by the pA73 construct was indistinguishable from that by vector alone.

GCN4 start site (9, 32). To demonstrate this point for the construct containing the 93-codon uORF4, we introduced a stop codon in the GCN4 reading frame at position +597, only two codons downstream from the +591 ATG codon. This mutation abolished GCN4 expression from the allele containing the 93-codon uORF4 (pA73, Fig. 4) without lowering the GCN4 mRNA level (pA73, Fig. 3). (As in the case of pA46 discussed above, the pA73 mRNA level was actually greater than that of the wild type because this construct is severely impaired for GCN4 expression.) The fact that pA73 expresses little or no GCN4 indicates that essentially all GCN4 translation initiates at the +591 AUG codon for construct pA59. Consequently, reinitiation at position +591 after termination of translation of the 93codon uORF4 (as postulated by the second hypothesis) would require scanning upstream for 130 nt, past four AUG codons (at positions +630, +649, +673, and +705), at least one of which (+673) contains a sequence context compatible with efficient initiation in yeast cells (2, 4, 6). The fact that GCN4 expression from the 93-codon uORF4 construct does not differ significantly from that of the parental construct

VOL . 1 l,

1991

containing the three-codon uORF4 strongly suggests that the second hypothesis is incorrect and that scanning ribosomes reach GCN4 under repressing and derepressing conditions by ignoring the uORF4 start codon. Measurement of initiation rates at uORF4 under repressing and derepressing conditions. Expression of a GCN4-lacZ construct containing wild-type uORFs 1 and 4 is roughly 50% of that of one containing uORF1 alone when both constructs are examined in the derepressed gedi mutant (25) (compare p413 and p235 under the gedi column in Fig. 6). This comparison suggests that under fully derepressing conditions, only about one-half of the ribosomes scanning downstream from uORF1 are able to scan beyond uORF4 and initiate at GCN4 (350 units . 670 units = 0.52). Comparing the same two constructs in the gcn2 mutant suggests that under repressing conditions, only about 4% of the ribosomes that scan downstream from uORF1 subsequently reach GCN4 (31 units . 710 units = 0.04). If ribosomes reach GCN4 by ignoring the uORF4 start site, as suggested above, then the rate of initiation at uORF4 for a construct containing uORFs 1 and 4 should be about 50% lower in the derepressed gcdi mutant than in the nonderepressible gcn2 strain ([1.0 - 0.52] . [1.0 - 0.04] = 0.50). In addition, uORF4 and GCN4 should be translated at similar rates in the gcdl mutant, since roughly one-half of the ribosomes scanning from uORF1 are expected to initiate at uORF4 and the remainder should initiate at GCN4 under

derepressing conditions. We attempted to test these predictions about uORF4 translation by comparing the synthesis rates of uORF4-LacZ and GCN4-LacZ fusion proteins in gcdl and gcn2 transformants. The uORF4-lacZ fusion in pA74 (Fig. SC) was generated by making a 1-bp insertion in the construct containing wild-type uORF1 and 93-codon uORF4 (pA59) in the region where the elongated uORF4 overlaps GCN4 (Fig. 1). This frameshift mutation should abolish production of wildtype GCN4-LacZ fusion protein and cause lacZ sequences to be translated from the uORF4 start codon. Translation of the uORF4-lacZ fusion was measured by quantitative immunoprecipitation of the fusion protein from extracts of cells pulse-labeled with [35S]methionine. Initial studies in which pulse-labeling was followed by a chase with excess nonradioactive methionine indicated that the fusion protein is unstable, decaying with a half-life of about 10 min, and that the decay rate was similar in the two mutant strains (data not shown). The half-life of the GCN4-LacZ fusion protein is greater than 90 min (25). From these results, we chose a labeling time of 5 min to measure the synthesis rates of the two fusion proteins. The results (Fig. 5A) show that the rate of uORF4-lacZ translation for the pA74 construct was lower in the gcdl mutant than in the gcn2 strain (DR and R lanes, respectively). Measurements for three different transformants of each strain gave very similar results and indicated that the translation rate of uORF4-lacZ is ca. twofold higher in the gcn2 mutant than in the gcdl strain. As expected, synthesis of GCN4-LacZ protein from p200 containing wild-type uORFs 1 and 4 was much greater in the gcdl mutant than in the gcn2 strain. In addition, the rates of uORF4-LacZ and GCN4LacZ synthesis from pA74 and p200, respectively, were similar in gedi cells (Fig. 5A). The steady-state levels of the p200 and pA74 fusion mRNAs were indistinguishable and did not differ significantly between the gcn2 and gedi strains (data not shown). These results are in accord with the above prediction that a 50% reduction in the number of ribosomes initiating at uORF4 is responsible for increased translation of

BASIS OF GCN4 TRANSLATIONAL CONTROL

A

491

B

p200

pA74

R DR

R

DR

pA74

pAJ8

R DR

R

DR

c p200 -i :

pA74 pAJ8

-o

/ac

- 146

FIG. 5. Synthesis of a uORF4-lacZ fusion protein under repressing and derepressing conditions. (A and B) Transformants of the nonderepressible gcn2-1 strain (R) and the constitutively derepressed gcdl-1O1 strain (DR) containing the wild-type GCN4-lacZ construct on p200 or the uORF4-lacZ constructs on pA74 or pAJ8 were pulse-labeled with [35S]methionine for 5 min. The labeled fusion proteins were immunoprecipitated from samples of each extract, containing equivalent amounts of trichloroacetic acid-precipitable counts, and analyzed by SDS-PAGE and fluorography. The arrowheads indicate the positions of the fusion proteins. (C) The three fusion constructs are shown in schematic form. pA74 and pAJ8 each contain a 1-bp insertion in the beginning of GCN4 at position +712 that fuses lacZ sequences to the elongated versions of uORF4 present in these constructs. (The GCN4 start codon is thus out of frame with lacZ in pA74 and pAJ8.) pAJ8 contains a 146-nt insertion between uORFs 1 and 4 (see text for details).

GCN4 under derepressing conditions. As shown below, this reduction in uORF4 translation can be abolished by increasing the size of the uORF1-uORF4 interval. Increasing the distance between uORFI and uORF4 specifically reduces derepression of GCN4 under starvation conditions. Kozak showed that translational inhibition of preproinsulin synthesis by a uORF increased as the uORF was brought closer to the preproinsulin start site (17). This finding suggested to us the possibility that some ribosomes which translate uORF1 will scan past uORF4 under starvation conditions because uORF4 is too close to uORF1 for efficient reinitiation under these conditions. To test this possibility, we increased the separation between uORF1 and uORF4 by introducing between them one or more copies of a sequence normally present downstream from uORF4 (designated Si and S2 in Fig. 1). The Si sequence interval was shown previously to be dispensable for GCN4 translational control (38). Position +299 was chosen as the insertion site because it is roughly equidistant from uORF1 and uORF4 and because its surrounding sequences are also dispensable for regulation (38). Tandem copies of the Si sequence were introduced in the same orientation in which Si occurs in the normal leader. The results obtained for the first four constructs shown in

492

MOL. CELL. BIOL.

ABASTADO ET AL. GCN4-lacZ activity wt

uORF4

uORF1

/I /

p413 (wt) 30

pA56 pA60

GCN4

Ila173

_

1

X

L

7_/

pA61

pA.J7

0-

p235

_7/ZI7

pA75

30I I7I3I

pA76

pA77

1 1 1111 46l

-0

A x1x x

1l114116lil

//

Lx

/ /

|

xx

c=zz/

pA44 (wt)

724z7/

pA70 pA71

0

3

144

I I I iFi- III I

-i

I

d111//

p237 72

pA78

pA80

pAJ19

x

216

Complementation of gcn4A

22

170

31

350

11

20

120

30

190

6.3

12

41

27

89

3.3

12

42

28

67

2.4

14

45

15

67

4.5

+

370

390

710

670

0.9

+++++

360

380

690

700

1

+++ §

340

430

600

750

1.3

+++++

360

510

720

770

1.1

++

17

130

18

250

14

++++

28

150

29

300

10

++++

38

200

32

370

12

+

5

16

11

21

1.9

+l-

8

36

21

29

1.4

61

25

53

2.1

+l

87

38

82

2.2

++

21

17

24

1.4

ND

~EZ7

IIIIIIIIIIII I -II

gcdl/ gcn2

DR

pA79

216

gcn2 gcdl

R

19

FIG. 6. Increasing the distance between uORFs 1 and 4 reduces derepression of GCN4 expression. The schematics

l

a

l

a

++

on

the left depict the

constructs containing insertions of sequence S2 (30 nt) or one or more copies of sequence Si (both indicated in Fig. 1) that introduce 73 or 146 nt between uORFs 1 and 4 or that insert 72, 144, or 216 nt between uORF4 and GCN4. X's indicate point mutations in the ATG codons of uORFs 2 and 3. pAJ7 contains the 93-codon version of uORF4 present in pA59 (Fig. 4). pAJ19 contains an insertion expected to form a stable stem-loop structure just downstream from uORF4 at position +460. The constructs are drawn approximately to scale. Analysis of the constructs was conducted exactly as described in the legend to Fig. 2. The maximum standard errors were 29, 41, 17, and 12% of the mean values, respectively, for the four groups of constructs shown from top to bottom. ND, Not determined.

Fig. 6 indicate that increasing the distance between uORF1 and uORF4 by 30, 73, or 146 nt has little effect on GCN4 expression in wild-type cells under nonstarvation conditions and in the gcn2 mutant (both repressing conditions). By contrast, these insertions led to a progressive reduction in GCN4 expression in histidine-starved wild-type cells and in the gcdl mutant (derepressing conditions). Consequently, the insertions led to a stepwise decrease in the derepression ratio relative to that in the wild-type construct. Replacing wild-type uORF4 in the construct containing an extra 146 nt between uORFs 1 and 4 with the 93-codon version of uORF4 had no additional effect on GCN4 expression (pAJ7, Fig. 6). The latter result indicates that the residual GCN4 expression

given by construct pA61 involves ribosomes that scan past uORF4, just as was shown for the wild-type allele in Fig. 4. The insertions between uORFs 1 and 4 shown in Fig. 6 alter GCN4-lacZ expression in the same qualitative fashion described previously for removal of uORF1 (24) (compare p413, pA61, and p237 in Fig. 6). Thus, increasing the distance between uORF1 and uORF4 appears to impair specifically the ability of uORF1 to overcome the inhibitory effect of uORF4 on GCN4 expression under derepressing conditions. If this explanation is correct, then insertions between uORFs 1 and 4 should not reduce GCN4 expression when uORF4 is absent. This prediction was borne out by the results shown in Fig. 6 for constructs p235, pA75, pA76, and

VOL . 1 l, 1991

pA77. When uORF4 was removed by a point mutation in its ATG codon, the insertions made between uORFs 1 and 4 had no significant effect on GCN4-lacZ expression. Likewise, inserting one or two copies of the Si sequence at a position 43 nt downstream from uORF4 appeared to cause a small increase, rather than a decrease, in GCN4-lacZ expression under both repressing and derepressing conditions (compare pA44 with pA70 and pA71 in Fig. 6). None of the 144-nt insertions caused any reduction in the steady-state amounts of GCN4 mRNA relative to PYKI mRNA levels (Fig. 3). It is noteworthy that the 146-nt insertion between uORFs 1 and 4 in pA61, which greatly reduces derepression of GCN4 expression, increases the distance between the two uORFs to about the same distance that normally separates uORF1 from the GCN4 start codon. A priori, the latter spacing should be sufficient for efficient reinitiation at GCN4 following translation of uORF1. Therefore, we suggest that many ribosomes which would normally bypass uORF4 and reinitiate at GCN4 under derepressing conditions will reinitiate at uORF4 instead after scanning the expanded uORFluORF4 interval in pA61. Supporting this interpretation, we found that introducing the 146-nt insertion present in pA61 upstream from the uORF4-lacZ fusion in pA74, creating pAJ8 (Fig. 5C), specifically increased the uORF4-lacZ translation rate in the gcdl mutant (compare DR lanes for pA74 and pAJ8 in Fig. 5B). As a result, the uORF4-lacZ fusion in pAJ8 was translated at nearly the same rate in gcdl and gcn2 transformants. Results indistinguishable from those shown in Fig. 5B were obtained for several independent pAJ8 transformants of the two strains. Thus, the 146-nt insertion between uORFs 1 and 4 that lowers translation of GCN4lacZ from pA61 increases uORF4-lacZ translation from pAJ8. These findings support the notion that translation of uORF4 and GCN4 is inversely related. Inserting one, two, or three copies of the S1 sequence at a position 43 nt downstream from uORF4 in a construct lacking uORF1 led to a progressive increase in GCN4-lacZ expression under both repressing and derepressing conditions (p237 and pA78 through pA80, Fig. 6). Because these insertions are not expected to alter the initiation rate at uORF4, their enhancing effects are more readily explained by stimulation of reinitiation following translation of uORF4. Alternatively, the inserted sequences might allow direct binding of ribosomes between uORF4 and GCN4 (27). In an attempt to rule out the latter possibility, we showed that introduction of a sequence capable of forming a stable secondary structure (AH, -15.2 kcal) at position +453, between uORF4 and the inserted S1 elements, eliminated most of the increase in GCN4-lacZ expression associated with the 216-nt insertion in pA80 (compare pA80 and pAJ19 in Fig. 6). This result makes it likely that reinitiation can occur following translation of uORF4, provided that the uORF4-GCN4 interval is increased considerably beyond the wild-type distance. Nevertheless, uORF4 remains at least 10-fold more inhibitory than uORF1 when the two uORFs are separated from GCN4 by the same distance (compare pA79 with p235 in Fig. 6). These results add further support to the idea that the uORF4 sequence is inherently less efficient than uORF1 at promoting reinitiation downstream following its own translation (22, 38). DISCUSSION Regulation of GCN4 expression occurs in the context of the scanning mechanism of translation initiation. We found that a

BASIS OF GCN4 TRANSLATIONAL CONTROL

493

small sequence element with the potential to form a stable stem-loop structure inhibits GCN4 expression when inserted at a variety of positions in the mRNA leader. The fact that such insertions located very close to uORF4 greatly reduce GCN4 expression under derepressing conditions (Fig. 2) is at odds with the possibility that the inhibitory effect of uORF4 might be overcome by direct binding of ribosomes downstream from uORF4 (27). Another difficulty with this hypothesis is its failure to explain the fact that removing the uORF1 start codon (24) or changing the uORF1 termination site by a single codon (22) specifically impairs derepression of GCN4 expression, as does inserting additional sequences between uORFs 1 and 4 (pA61, Fig. 6). It could be argued that all of these mutations impair derepression by causing a conformational change in the mRNA leader which destroys the postulated internal ribosome binding site; however, this stipulation is at odds with the fact that certain deletions of sequences surrounding the uORFs (38) and insertions downstream from uORF4 (pA71, Fig. 6) have relatively little effect on derepression of GCN4. Therefore, the available data are more easily explained by a mechanism involving the movement of ribosomes through the uORF4 sequence to the GCN4 start codon. Evidence that ribosomes which synthesize GCN4 have not translated uORF4. Various mutations which increase or decrease the length of uORF1 or alter sequences 3' to its stop codon significantly impair derepression of GCN4 under starvation conditions (22, 25). The structural requirements for uORF1 function identified by these results suggest that uORF1 is translated and that, after terminating at this site, ribosomes must resume scanning to subsequently reinitiate at GCN4. These findings stand in sharp contrast to the wild-type expression given by constructs in which uORF4 was lengthened to 46 or 93 codons, overlapping GCN4 by 130 nt in the latter case (Fig. 4). Ribosomes which translate the 93-codon uORF4 would be required to scan backwards in the 3' to 5' direction for 130 nt to initiate at the +591 start codon, which was used exclusively for GCN4 protein synthesis in the 93-codon uORF4 construct. Four other AUG codons would have to be ignored as start sites during this backwards scanning to the +591 AUG codon. Studies on CYCI and HIS4 translation strongly suggest that the first AUG codon downstream from the mRNA cap is the predominant start site used in yeast mRNA, regardless of its surrounding sequence context (5, 7, 30). Therefore, most ribosomes engaged in the hypothetical backwards scanning would be expected to initiate at one of the other AUG codons at +630, +649, +673, and +705 rather than at the +591 start site. Consequently, the fact that elongating uORF4 to 93 codons has little effect on GCN4 expression is much more consistent with the idea that GCN4 is translated by ribosomes that ignore the uORF4 AUG codon and continue scanning downstream in the 5' to 3' direction. The results with the uORF4-lacZ fusion in pA74 (Fig. 5) are in accord with this conclusion in suggesting that translation of uORF4 decreases under derepressing conditions in which translation of GCN4 is stimulated. The fact that translation of uORF4-lacZ for this construct is reduced but not abolished under derepressing conditions agrees with the fact that uORF1 cannot overcome the uORF4 translational barrier to the same extent as mutational inactivation of the uORF4 start codon (24), i.e., only about one-half of the ribosomes scanning from uORF1 are expected to scan past uORF4 to GCN4 under starvation conditions. The significance of the observed reduction in uORF4-lacZ translation under derepressing conditions was established by the fact

494

_ * ~ ~GCN4

ABASTADO ET AL.

that it did not occur for the uORF4-1acZ fusion in pAJ8 containing the 146-nt insertion between uORFs 1 and 4. This insertion nearly eliminates derepression of GCN4-lacZ from pA61 (Fig. 6). Together, these results strongly suggest that inserting 146 nt between uORFs 1 and 4 impairs derepression of GCN4 by causing essentially all ribosomes scanning downstream from uORF1 under starvation conditions to reinitiate at uORF4. These findings are at odds with certain results obtained with uORF3-1acZ and uORF4-1acZ fusions constructed by a different approach (13, 36), in that expression of these other fusions generally increased, rather than decreased, under derepressing conditions. One potential problem with the previous constructs is that the fusion junctions are much closer to the initiation codons of the uORFs than is the case for the uORF4-lacZ fusion analyzed here. As a result, the insertion of lacZ sequences in the previous constructs could have altered important initiation properties of uORFs 3 and 4. This possibility is supported by our recent finding that insertion of codons 5 to 61 of lacZ (encoding the a-peptide) into the middle of uORF4 completely abolished GCN4 expression under derepressing conditions (data not shown). This phenotype could indicate that sequences in the beginning of lacZ increase the probability of reinitiation at uORF4 under derepressing conditions when inserted close to the uORF4 start site (19). If so, the previously constructed uORF4-lacZ fusion cannot provide meaningful results about the rate of initiation at uORF4. The uORF4-lacZ fusion described here should be more reliable in this respect because the lacZ sequences were inserted more than 300 nt downstream from the uORF4 start site. In addition, it differs by only one nucleotide from the 93-codon uORF4 construct in pA59, which shows wild-type regulation, and therefore its transcript should adopt a conformation very similar to that of wild-type GCN4-lacZ mRNA. An alternative explanation for the fact that altering the location of the uORF4 stop codon has no effect on GCN4 expression is that ribosomes initiate at uORF4 under derepressing conditions but undergo a frameshift in the second or third codon, causing them to terminate farther downstream in the uORF4-GCN4 interval in one of the other two reading frames. Following termination at the new stop codon, ribosomes would reinitiate efficiently at GCN4. One argument against this hypothesis is that the pA59 construct with the 93-codon version of uORF4 contains a 1-bp insertion in the wild-type uORF4 stop codon. If the postulated frameshifting occurred for this construct, uORF4 translation would terminate at a different downstream stop codon in the uORF4GCN4 interval than the one that would be used in the wild-type leader. If, instead, the frameshifting no longer occurred because of the insertion in pA59, uORF4 translation would terminate 130 nt downstream from the GCN4 start codon. In either case, the wild-type GCN4 expression shown by pA59 would be surprising. Similarly, a large deletion between uORF4 and GCN4 that removes many of the stop codons in this interval and shifts the reading frame between uORF4 and GCN4 has no effect on the derepression ratio of GCN4 expression (38). A second complicating issue connected with the frameshifting model is that uORF3 can substitute for uORF4 in GCN4 translational control (24), but uORF3 has a different second codon and is present in a different reading frame than uORF4. Moreover, several completely heterologous uORFs have been substituted for uORFs 3 and 4 without loss of the important qualitative features of GCN4 translational control (25, 36); in fact, the three codons in uORF4 can be replaced

MOL. CELL. BIOL.

Nonstarvation conditions or gcn2IF

eF

_w

wUw w

Starvation conditions or gcdl elF

w_

IFN4 IF ~_

lF

elF _

;{\

Lr

nsert , in I I 11111111111111111I elF

elF

,

_

w

IV

FIG. 7. Model for GCN4 translational control. The leader of GCN4 mRNA is shown with uORFs 1 and 4 and the beginning of GCN4 coding sequences all indicated as boxes. 40S subunits containing the full complement of initiation factors (eIFs) are shown hatched; those lacking certain factors are shown empty. 80S translating ribosomes are also hatched. Ribosomes translate uORF1, and the 40S subunits resume scanning. Under repressing conditions (nonstarved wild-type or gcn2 mutant cells), initiation factors are rapidly reassembled on the 40S subunit and reinitiation occurs efficiently at uORF4. Following uORF4 translation, no reinitiation occurs at GCN4, perhaps because the ribosomes dissociate from the mRNA. Under derepressing conditions (starved wild-type or gcdl mutant cells), reassembly of the 40S initiation complex is slower and many 40S subunits are not ready to initiate when they reach uORF4; consequently, they continue scanning, and many reinitiate at GCN4 instead. When the distance between uORFs 1 and 4 is increased the wild-type separation between uORF1 and GCN4, most ribosomes are competent for reinitiation by the time they reach uORF4 even under derepressing conditions, excluding them from translation of GCN4.

with the three codons of uORF1 with no detectable effect on GCN4 expression (unpublished observations). Efficient frameshifting in uORF4 would be expected to have more stringent sequence and reading-frame requirements than this, whereas these parameters should be flexible if, as we suggest, uORFs 3 and 4 are simply ignored by the ribosomes that reach GCN4. Model for GCN4 translational control. Studies on preproinsulin mRNA showed that the inhibitory effect of a single upstream AUG codon could be reduced by inserting an additional uORF farther upstream in the leader (17). To explain this finding, Kozak proposed that ribosomes which translate the 5'-proximal uORF fail to reinitiate at the nearby second AUG codon because a certain amount of time is needed for the scanning ribosomal subunit to reacquire initiation factors and MetAtRNAMet. Thus, some 40S subunits that bypass the second AUG codon become competent to reinitiate by the time they reach the third AUG codon, which is the preproinsulin start site (17). We suggest that a similar mechanism operates in GCN4 translational control, with the added complexity that the scanning time required for reinitiation following uORF1 translation is greater under amino acid starvation conditions than under normal growth conditions (Fig. 7). We assume that a similar number of ribosomes translate uORF1 and resume scanning under starvation and nonstarvation conditions (24) (see p235 in Fig. 6). Under nonstarvation conditions, an initiation complex is reassembled rapidly enough to allow most ribosomes to reinitiate at uORF4. After completing uORF4 translation, the majority of these ribosomes are unable to reinitiate at GCN4, perhaps

VOL. 11, 1991

because they dissociate from the mRNA. Under starvation conditions, more time is required to reassemble an initiation complex after termination at uORF1. Consequently, about 50% of the ribosomes scanning from uORF1 are unable to reinitiate by the time they reach uORF4 and scan past this site. Most of these ribosomes are ready to initiate after scanning the extra 149 nt between uORF4 and GCN4 (Fig. 7). Because nearly all ribosomes reinitiate at uORF4 under nonstarvation conditions, even if only 50% scan past uORF4 under starvation conditions, this will lead to a large derepression ratio for GCN4 expression. According to our model, when the interval between uORF1 and uORF4 was increased by 146 nt to the distance that normally separates uORF1 from the start site of GCN4, most ribosomes are competent to reinitiate by the time they reach uORF4 even under starvation conditions. The majority of ribosomes thus initiate before rather than at GCN4, explaining the reduced amount of GCN4-lacZ translation seen for pA61 relative to the wild-type construct (Fig. 6), as well as the increased uORF4-lacZ translation seen for pAJ8 compared with pA74 (Fig. SB), under derepressing conditions. When the 144-nt insertion was made downstream from uORF4 in a construct containing both uORFs, GCN4 expression was increased under repressing conditions about twofold (a difference of 14 units between pA71 and pA44 in the gcn2 column, Fig. 6). This small increase may result from reinitiation following uORF4 translation due to the expanded uORF4-GCN4 interval, because a similar increase was observed in the absence of uORF1 (compare pA79 with p237 in the gcn2 mutant, Fig. 6). There also appears to be an increase in GCN4 expression associated with the 144-nt insertion in pA71 under derepressing conditions (a difference of 120 units between pA71 and pA44 in the gcdl strain, Fig. 6), only a small fraction of which was observed in the absence of uORF1 (a difference of 32 units between pA79 and p237 in gcdl cells, Fig. 6). Consequently, most of the increased expression seen for pA71 under derepressing conditions is probably attributable to ribosomes that translate uORF1 and skip over uORF4. This explanation implies that reassembly of factors needed for reinitiation is so slow under derepressing conditions that not all ribosomes which scan past uORF4 become competent to reinitiate by the time they reach GCN4. By increasing the uORF4-GCN4 interval beyond the wild-type spacing, more ribosomes can recover and translate GCN4 after skipping over uORF4. One aspect of the results in Fig. 6 not directly predicted by our model is the increased expression under repressing conditions associated with insertions of the Si sequence downstream from uORF4. After inserting one copy of Si (forming pA78), the uORF4-GCN4 interval is slightly greater than the wild-type uORF1-uORF4 spacing, which is thought to be adequate for complete reinitiation under repressing conditions. However, it appears that two- to threefold greater reinitiation at GCN4 occurs after further increasing the uORF4-GCN4 interval by inserting additional copies of Si (compare pA80 and pA79 with pA78 in the gcn2-1 column, Fig. 6). One possible explanation for this discrepancy is that distance alone would not be the only determinant of the time required to scan the GCN4 leader. Perhaps secondary structure also makes an important contribution to the rates of scanning in the uORF1-uORF4 and uORF4GCN4 intervals. In a previous study (38) we showed that a large deletion between uORF4 and GCN4 lowered GCN4 expression under both repressing and derepressing conditions. This reduction

BASIS OF GCN4 TRANSLATIONAL CONTROL

495

is predicted by our model, because the deletion shortens the interval in which ribosomes that bypass uORF4 must recover to initiate at GCN4. The effect on GCN4 expression of progressively shortening the uORF1-uORF4 interval is currently under investigation. Why should reinitiation require a greater scanning time under starvation conditions than nonstarvation conditions? One possibility is that amino acid starvation is associated with a general reduction in the efficiency of reinitiation. This hypothesis is consistent with several recent observations. First, shifting cells from rich medium to one lacking amino acids leads to transient derepression of GCN4 expression that appears to be associated with reduced formation of 43S preinitiation complexes, containing Met-tRNAMet in a ternary complex with initiation factor 2 (eIF-2) and GTP (35). Second, many gcd mutations that cause constitutive derepression of GCN4 expression at 30°C are lethal at 36°C (11), and incubation of one such mutant at the restrictive temperature leads to reduced levels of 43S complexes (35). Third, certain mutations in the structural genes for two subunits of eIF-2 in S. cerevisiae lead to constitutive derepression of GCN4 expression in the same manner found for gcd mutations (37). These results suggest that reducing certain steps in the initiation process is sufficient to derepress translation of GCN4 mRNA in the absence of amino acid starvation. Perhaps alteration of the activity of eIF-2 under starvation conditions is responsible for retarding the reassembly of initiation complexes following uORF1 translation, thereby allowing a fraction of ribosomes to scan past uORF4 and initiate at GCN4. An important feature of our model is that, under starvation conditions, the efficiency of reinitiation at internal AUG codons is reduced more than that of primary initiation events at 5'-proximal AUG codons. This differential effect explains why a GCN4-lacZ construct containing uORF4 alone is derepressed by only a small amount compared with one containing both uORFs 1 and 4 (compare p413 and p237, Fig. 6). uORF1 is thought to stimulate GCN4 expression under derepressing conditions, because its translation removes certain factors from the ribosome that cannot be reassembled in the time it takes to scan to uORF4. Perhaps this reassembly process is less efficient than formation of the primary initiation complex at the first AUG codon, because reassembly occurs without the facilitating effect of the 5' cap (31). For example, efficient binding of the eIF-2-MettRNAM"tGTP ternary complex may require one or more of the cap-associated initiation factors (eIF-4F, eIF-4A, and eIF-4B), which may not be readily accessible to 40S subunits engaged in reinitiation at sites distant from the cap. If reinitiation is less efficient than primary initiation, it may be more sensitive to partial inhibition of a factor like eIF-2 in amino acid-starved cells. ACKNOWLEDGMENTS We thank James Broach, Marilyn Kozak, Janet Leatherwood, and Charles Moehle for their valuable comments on the manuscript. REFERENCES 1. Baim, S. B., D. F. Pietras, D. C. Eustice, and F. Sherman. 1985. A mutation allowing an mRNA secondary structure diminishes translation of Saccharomyces cerevisiae iso-1-cytochrome c.

Mol. Cell. Biol. 5:1839-1846. 2. Bain, S. B., and F. Sherman. 1988. mRNA structures influencing translation in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 8:1591-1601. 3. Bonner, W. M., and R. A. Laskey. 1974. A film detection

496

4.

5. 6. 7. 8. 9. 10. 11. 12.

13. 14. 15.

16.

17.

18. 19. 20. 21. 22.

23.

24.

MOL. CELL. BIOL.

ABASTADO ET AL.

method for tritium-labeled proteins and nucleic acids in polyacrylamide gels. Eur. J. Biochem. 46:83-88. Cigan, A. M., and T. F. Donahue. 1987. Sequence and structural features associated with translational initiator regions in yeast-a review. Gene 59:1-13. Cigan, A. M., L. Feng, and T. F. Donahue. 1988. tRNAMet functions in directing the scanning ribosome to the start site of translation. Science 242:93-97. Cigan, A. M., E. K. Pabich, and T. F. Donahue. 1988. Mutational analysis of the HIS4 translational initiator region in Saccharomyces cerevisiae. Mol. Cell. Biol. 8:2964-2975. Donahue, T. F., and A. M. Cigan. 1988. Genetic selection for mutations that reduce or abolish ribosomal recognition of the HIS4 translational initiator region. Mol. Cell. Biol. 8:2955-2963. Groebe, D. R., and 0. C. Uhlenbeck. 1988. Characterization of RNA hairpin loop stability. Nucleic Acids Res. 16:11725-11735. Hinnebusch, A. G. 1984. Evidence for translational regulation of the activator of general amino acid control in yeast. Proc. Natl. Acad. Sci. USA 81:6442-6446. Hinnebusch, A. G. 1985. A hierarchy of trans-acting factors modulate translation of an activator of amino acid biosynthetic genes in yeast. Mol. Cell. Biol. 5:2349-2360. Hinnebusch, A. G. 1988. Mechanisms of gene regulation in the general control of amino acid biosynthesis in Saccharomyces cerevisiae. Microbiol. Rev. 52:248-273. Hinnebusch, A. G., and G. R. Fink. 1983. Positive regulation in the general amino acid control of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 80:5374-5378. Hinnebusch, A. G., B. M. Jackson, and P. P. Mueller. 1988. Evidence for regulation of reinitiation in translational control of GCN4 mRNA. Proc. Natl. Acad. Sci. USA 85:7279-7283. Ito, H., Y. Fukada, K. Murata, and A. Kimura. 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:163-168. Johansen, H., D. Schumperli, and M. Rosenberg. 1984. Affecting gene expression by altering the length and sequence of the 5' leader. Proc. Natl. Acad. Sci. USA 81:7698-7702. Klionsky, D. J., L. M. Banta, and S. D. Emr. 1988. Intracellular sorting and processing of a yeast vacuolar hydrolase: proteinase A propeptide contains vacuolar targeting information. Mol. Cell. Biol. 8:2105-2116. Kozak, M. 1987. Effects of intercistronic length on the efficiency of reinitiation by eucaryotic ribosomes. Mol. Cell. Biol. 7:34383445. Kozak, M. 1989. The scanning model for translation: an update. J. Cell Biol. 108:229-241. Kozak, M. 1989. Context effects and inefficient initiation at non-AUG codons in eucaryotic cell-free translation systems. Mol. Cell. Biol. 9:5073-5080. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. Lucchini, G., A. G. Hinnebusch, C. Chen, and G. R. Fink. 1984. Positive regulatory interactions of the HIS4 gene of Saccharomyces cerevisiae. Mol. Cell. Biol. 4:1326-1333. Miller, P. F., and A. G. Hinnebusch. 1989. Sequences that surround the stop codons of upstream open reading frames in GCN4 mRNA determine their distinct functions in translational control. Genes Dev. 3:1217-1225. Mueller, P. P., S. Harashima, and A. G. Hinnebusch. 1987. A segment of GCN4 mRNA containing the upstream AUG codons confers translational control upon a heterologous yeast transcript. Proc. Natl. Acad. Sci. USA 84:2863-2867. Mueller, P. P., and A. G. Hinnebusch. 1986. Multiple upstream AUG codons mediate translational control of GCN4. Cell 45: 201-207.

25. Mueller, P. P., B. M. Jackson, P. F. Miller, and A. G. Hinne-

26. 27. 28.

29.

30.

31. 32.

33. 34.

35.

36. 37.

38.

busch. 1988. The first and fourth upstream open reading frames in GCN4 mRNA have similar initiation efficiencies but respond differently in translational control to changes in length and sequence. Mol. Cell. Biol. 8:5439-5447. Peabody, D. S., and P. Berg. 1986. Termination-reinitiation occurs in the translation of mammalian cell mRNAs. Mol. Cell. Biol. 6:2695-2703. Pelletier, J., and N. Sonenberg. 1988. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature (London) 334:320-325. Saiki, R. K., S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. Arnheim. 1985. Enzymatic amplification of beta globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350-1354. Sedman, S. A., P. J. Good, and J. E. Mertz. 1989. Leaderencoded open reading frames modulate both the absolute and relative rates of synthesis of the virion proteins of simian virus 40. J. Virol. 63:3884-3893. Sherman, F., and J. W. Stewart. 1982. Mutations altering initiation of translation of yeast iso-1-cytochrome c: contrasts between the eukaryotic and prokaryotic initiation process, p. 301-334. In J. N. Strathern, E. W. Jones, and J. R. Broach (ed.), The molecular biology of the yeast Saccharomyces:metabolism and gene expression. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Sonenberg, N. 1988. Cap-binding proteins of eukaryotic messenger RNA: functions in initiation and control of translation. Prog. Nucleic Acid Res. Mol. Biol. 35:173-207. Thireos, G., M. Driscoll-Penn, and H. Greer. 1984. 5' untranslated sequences are required for the translational control of a yeast regulatory gene. Proc. Natl. Acad. Sci. USA 81:50965100. Thomas, K. R., and M. R. Capecchi. 1986. Introduction of homologous DNA sequences into mammalian cells induces mutations in the cognate gene. Nature (London) 324:34-38. Tzamarias, D., D. Alexandraki, and G. Thireos. 1986. Multiple cis-acting elements modulate the translational efficiency of GCN4 mRNA in yeast. Proc. Natl. Acad. Sci. USA 83:48494853. Tzamarias, D., I. Roussou, and G. Thireos. 1989. Coupling of GCN4 mRNA translational activation with decreased rates of polypeptide chain initiation. Cell 57:947-954. Tzamarias, D., and G. Thireos. 1988. Evidence that the GCN2 protein kinase regulates reinitiation by yeast ribosomes. EMBO J. 7:3547-3551. Williams, N. P., A. G. Hinnebusch, and T. F. Donahue. 1989. Mutations in the structural genes for eukaryotic initiation factors 2a and 2p of Saccharomyces cerevisiae disrupt translational control of GCN4 mRNA. Proc. Natl. Acad. Sci. USA 86:7515-7519. Williams, N. P., P. P. Mueller, and A. G. Hinnebusch. 1988. The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences. Mol. Cell. Biol. 8:3827-3836.

39. Wolfner, M., D. Yep, F. Messenguy, and G. R. Fink. 1975. Integration of amino acid biosynthesis into the cell cycle of Saccharomyces cerevisiae. J. Mol. Biol. 96:273-290. 40. Zoller, M. J., and M. Smith. 1982. Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any fragment of DNA. Nucleic Acids Res. 10:6487-6500. 41. Zuker, M., and P. Stiegler. 1981. Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 9:133-148.