BO LR OI GO ID NCAOLM PA OR NT EI CN LT ES Riboflavin and ultraviolet light for pathogen reduction of murine cytomegalovirus in blood products Shawn D. Keil,1 Natia Saakadze,2 Richard Bowen,3 James L. Newman,2 Sulaiman Karatela,2 Paul Gordy,3 Susanne Marschner,1 John Roback,2 and Christopher D. Hillyer4
BACKGROUND: Two studies were performed to test the effectiveness of riboflavin and ultraviolet (UV) light treatment (Mirasol PRT, Terumo BCT) against murine cytomegalovirus (MCMV). The first study utilized immune-compromised mice to measure the reduction of cell-free MCMV. A second study used a murine model to evaluate the ability of Mirasol PRT to prevent transfusion-transmitted (TT)-MCMV infection. STUDY DESIGN AND METHODS: Human plasma was inoculated with MCMV and then treated with Mirasol PRT. The viral titer was measured using an infectious dose 50% assay in nude mice. Mice were euthanized on Day 10 posttransfusion, and their spleens were tested for the presence of MCMV DNA using polymerase chain reaction (PCR). Mirasol PRT was also evaluated to determine its effectiveness in preventing TT-MCMV in platelets (PLTs) stored in PLT additive solution. PLTs were inoculated with either cellassociated MCMV or cell-free MCMV and then treated with Mirasol PRT. Mice were transfused with treated or untreated product and were euthanized 14 days posttransfusion. Blood and spleens were assayed for MCMV DNA by real-time-PCR. RESULTS: Using nude mice to titer MCMV, a modest 2.1-log reduction was observed in plasma products after Mirasol PRT treatment. TT-MCMV was not observed in the mouse transfusion model when either cell-free or cell-associated MCMV was treated with Mirasol PRT; MCMV transmission was uniformly observed in mice transfused with untreated PLTs. CONCLUSIONS: These results suggest that using riboflavin and UV light treatment may be able to reduce the occurrence of transmission of human CMV from infectious PLTs and plasma units.
858 TRANSFUSION Volume 55, April 2015
H
uman cytomegalovirus (CMV) is a doublestranded DNA virus in the herpes virus family. The virus is ubiquitous around the world with approximately 40% to 100% of adults infected.1 Studies from several years ago in both UK blood donors and US health care workers estimated yearly seroconversion rates in the seronegative population of 1% to 3%.2,3 A recent study of Japanese blood donors identified a similar annual seroconversion rate, which has held constant for the past 15 years.4 CMV infections in healthy individuals are typically asymptomatic, with some individuals experiencing either mild flulike symptoms or symptoms similar to mononucleosis. After resolution of the primary infection, CMV typically establishes a lifelong infection in the host. Transmission of the virus can occur through any close contact with bodily fluid, including blood. When CMV is transmitted via blood transfusion to an immunocompromised individual, this can be cause for high level of concern.5-11 The potential morbidity and mortality associated with transfusion-transmitted (TT)-CMV in these patients led to the introduction of serologic testing and the use of leukoreduction for specific at-risk patient groups.5,9,12,13 With the development of
ABBREVIATIONS: ID50 = infectious dose 50%; MCMV = murine cytomegalovirus; PFU(s) = plaque-forming unit(s); PRT(s) = pathogen reduction technology(-ies); TT = transfusion transmitted. From 1Terumo BCT, Lakewood, Colorado; 2Emory University, Atlanta, Georgia; 3Colorado State University, Fort Collins, Colorado; and 4New York Blood Center, New York, New York. Address reprint requests to: Shawn D. Keil, Terumo BCT, 10810 W. Collins Avenue, Lakewood, CO 80215; e-mail: [email protected]. The studies described in this article were funded by Terumo BCT. Received for publication January 13, 2014; revision received September 10, 2014, and accepted September 11, 2014. doi: 10.1111/trf.12945 © 2014 AABB TRANSFUSION **;**:**-**. 2015;55:858–863. Volume **, ** **
TRANSFUSION
1
KEIL ET AL.
MIRASOL PRT INACTIVATION OF MURINE CMV
leukoreduction filters, a further reduction in risk of CMV transmission has been observed. Studies by Bowden and colleagues14 and Narvios and colleagues15 demonstrated the potential of leukofiltration to reduce disease transmission of CMV to levels that were approximately comparable to those observed with CMV-seronegative blood. The available literature and clinical observations suggest that a method capable of achieving a residual white blood cell (WBC) count of fewer than 5 × 106 cells results in a product that is approximately equivalent to a seronegative unit in terms of CMV risk.11,16 This suggestion is further supported by the work of Jordan and colleagues17 who demonstrated in an in vivo mouse model of CMV transmission that a reduction in white cell as well as cell-free CMV is capable of preventing murine CMV (MCMV) transmission. Nonetheless, despite the use of serology and/or leukoreduction, some residual risk of CMV transmission remains. Pathogen reduction technologies (PRTs) have the potential to replace CMV serology and in conjunction with leukoreduction could reduce the risk of TT-CMV. PRT approaches have the ability to inactivate viruses in both their cell-free and cell-associated forms.18-21 Additionally they can inactivate WBCs, which may harbor or carry infectious agents in their latent forms. Examples are members of the herpesvirdae and retroviridae family of viruses. While much clinical focus on CMV centralizes around reducing WBC-associated viral loads through leukoreduction, a recent study discovered that CMV DNA (a surrogate marker for infectious virus) is identified most often in the plasma of window-phase or earlyseroconversion donors and less often within WBCs (presumably as latent virus).22 In the present studies we used mice to model both potentially infectious forms of CMV, WBC-associated virus and cell-free plasma viremia. The use of riboflavin and ultraviolet (UV) light for pathogen reduction is nontoxic and nonmutagenic, and riboflavin and UV light–treated components have been shown to be safe for transfusion recipients as well as for those handling blood products.23 Riboflavin molecules associate with nucleic acids in treated products. Exposure to UV light activates riboflavin, causing a chemical alteration to functional groups of the nucleic acids (primarily guanine bases), preventing DNA replication.24 As with other photosensitizer-based processes, such as methylene blue and psoralen, riboflavin and UV can also induce oxygen-mediated damage to pathogens, proteins, and cellular components.24-26 In this article we examine the log reduction of cell-free MCMV, treated with riboflavin and UV light, using an in vivo infectious dose viral reduction model. We also demonstrate that treatment of MCMV-infected platelet (PLT) products with riboflavin and UV light can prevent TT-MCMV using an in vivo mouse transfusion model. 2
TRANSFUSION
Volume **, ** **
The second study mimics previously published work evaluating a psoralen-based PRT process using the same in vivo mouse transfusion model.17 This TT-MCMV model has proven to be a powerful system for dissecting the biology of TT-CMV as well as developing improved methods to prevent its occurrence. The system can be used to perform experimental manipulations not possible in human subjects. It has been successfully used to study the kinetics and viral compartmentalization of recently infected blood donors, determine the minimum number of residual WBCs necessary for TT-CMV, demonstrate that monocytes are the WBC subset that is primarily responsible for TT-CMV, and also show that TT-CMV can be completely prevented by pathogen inactivation technologies.11
MATERIALS AND METHODS Mouse ID50 viral reduction model ID50 cell-free MCMV stock preparation MCMV Smith strain (ATCC #VR-1399) was prepared from the supernatant of infected C127 cells (ATCC #1616); stock virus was frozen at −80°C until needed. The stock viral titer was 2.8 × 106 plaque-forming units (PFUs)/mL.
ID50 cell-free MCMV mouse model A total of four type-matched human recovered plasma products were pooled and split into three 200-mL plasma products. Previous work has found the reduction of viruses in plasma to be equivalent to the reduction of virus observed in PLT units (data not shown); thus plasma was chosen for this study due to the convenience of obtaining plasma units versus PLT units. After transfer of the plasma products to standard Mirasol PRT illumination and storage bags, 10 mL of cell-free MCMV (4% vol/vol) and 35 mL of riboflavin was added to each of the 3 plasma units. The units were treated with the standard riboflavin and UV light process according to methods described previously.19 Pretreatment and posttreatment samples were serially diluted 10-fold in HEPES-buffered Dulbecco’s modified Eagle’s medium containing 1% bovine serum albumin. A total of five nude BALB/c mice (Charles River, Wilmington, MA) were inoculated with 200 μL of sample intraperitoneally at each serial dilution. Ten days after inoculation, recipient mice were euthanized and their spleens were recovered. For each mouse, approximately 10 mg of spleen was homogenized using a mixer mill and stainless-steel ball in a volume of 80 μL of phosphatebuffered saline (PBS). DNA was extracted from the spleen homogenates using a blood and tissue kit (DNeasy, Chatsworth, CA) and eluted into a volume of 200 μL. Extracted DNA was analyzed via conventional polymerase chain reaction (PCR) in 50-μL reactions. A 25-μL reaction volume was created for each sample of extracted DNA. The primers used to amplify the MCMV DNA target the immediate-early (IE1) gene of the virus: 5′-ATT Volume 55, April 2015 TRANSFUSION 859
MIRASOL PRT INACTIVATION OF MURINE CMV
KEIL ET AL.
GTTCATTGCCTGGGGAGTTT and 5′-ATCTGGTGCTCCTC AGATCAGCTAA.27 Amplification was conducted using 40 cycles of 95°C for 30 seconds, 58°C for 60 seconds, and 72°C for 60 seconds. PCR products were run on a 1.5% agarose gel and detected by staining with ethidium bromide. Mice were considered positive for MCMV if the 363-bp amplicon was observed in the tested sample. Mice were scored as either positive or negative for the presence of MCMV.
ID50 cell-free MCMV titer calculation and viral reduction The viral titer was calculated using the Spearman-Karber method and was expressed as infectious dose 50% per mL (ID50/mL). The following equation was used to calculate the viral titer (M):
M = xk + d [0.5 − (1 n) × (r )], where xk is the dose of highest dilution, r is the sum of negative responses, d is the spacing between dilutions, and n is the number of mice per dilution. The reduction factor (log reduction) was calculated by applying the following equation:
RF = log10 [( Volumepreillumination ) × (Concentration preillumination ) ( Volumetreated ) 28 × (Concentration treated )] In the above study the Volumepreillumination and Volumetreated are identical.
TT-MCMV mouse model Cell-associated MCMV stock preparation To prepare the cell-associated MCMV infected murine WBCs, 25 BALB/cByJ mice (The Jackson Laboratories, Bar Harbor, ME) were infected by intraperitoneal injection with 1 × 106 PFUs Smith strain (MCMV) and rested for 14 days. The MCMV-infected mice were then euthanized to collect peripheral blood, which was uniformly positive for MCMV by viral PCR. Whole blood was harvested from the donor mice into approximately 1/10 volume of ACD-A anticoagulant. After pooling, the blood was centrifuged at 400 × g for 5 minutes, and the plasma was decanted. Red blood cells (RBCs) were lysed using lysing buffer (PharM Lyse, BD Biosciences, San Jose, CA) according to manufacturer’s instructions. The WBCs that remained were separated from the RBC lysate through centrifugation at 400 × g for 5 minutes. To remove any remaining serum and free virus, harvested WBCs were washed three times using PBS. The harvested WBCs were counted using a hemocytometer.
Cell-free MCMV stock preparation Cell-free MCMV was prepared by growing Smith strain MCMV (ATCC #VR-1399) in 3T3 cells (ATCC #CRL-1658) 860 TRANSFUSION Volume 55, April 2015
and harvesting the supernatant; stock virus was frozen at −80°C until needed. The stock viral titer was approximately 107 PFUs/mL.
Mirasol treatment of TT-MCMV products PLT products were collected using an automated blood collection system (Trima, Terumo BCT, Lakewood, CO) with a targeted product volume of 125 mL at 2.3 × 109 cell/L concentration. Products were rested for 2 hours postcollection and then were evaluated for acceptable cell quality before they were shipped overnight to Atlanta, Georgia. However, due to the difficulty of obtaining large quantities of infected mouse WBCs, all riboflavin and UV light treatments used for the evaluation of Mirasol against TT-MCMV were done using a 250 μL treatment volume in a 48-well plate. A single layer of the bag material made from the standard Mirasol treatment bag was placed on top of the 48-well plate before treatment to ensure the same light attenuation as in the standard riboflavin and UV light PRT process. A quartz glass lid was placed on top to keep the bag material in place during illumination. Each 48-well plate was treated with a predetermined energy dose. This energy dose was established by equivalent reduction of encephalomyocarditis virus in the 48-plate set-up compared to the standard riboflavin and UV light process at 6.24 J/mL (data not shown). Wells of the 48-well plate contained 80 μL of hyperconcentrated PLT product, 25 μL of riboflavin, 47 μL of SSP+ (Macopharma, Mouvaux, France), and 98 μL of viral inoculum. The final product had a 32% plasma carryover. Previous studies performed with the cell-associated TT-MCMV model found one viral genome per 510 donor WBCs. Thus, if one extrapolates this value to the 1 × 106 WBCs dosed in this experiment a total of 1961 infected WBCs were transfused into each mouse.17 A total of three replicate PLT units were evaluated for both cell-associated and cell-free MCMV.
Animals Cohorts of BALB/cByJ recipient mice (n = 10 per condition; The Jackson Laboratories) were injected via tail vein infusion. The volume of all transfusions was 200 μL. All recipient mice were euthanized 14 days after transfusion. Blood and spleens were collected and assayed for MCMV DNA by real-time PCR.
PCR amplification of TT-MCMV DNA DNA was isolated from mouse spleens and whole blood (EZNA kit, Omega Bio-Tek, Doraville, GA) and quantitated (PicoGreen dsDNA quantitation kit; Molecular Probes, Eugene, OR). MCMV DNA was amplified by PCR in a 96-well plate (iCycler, Bio-Rad Laboratories, Hercules, CA). Each 15-μL reaction contained 7.5 μL of SYBR Green master mix (Applied Biosystems, Foster City, CA), Primers IE1.1983 and IE1.2345, and 40 ng of DNA. Samples were Volume **, ** **
TRANSFUSION
3
KEIL ET AL.
MIRASOL PRT INACTIVATION OF MURINE CMV
TABLE 1. MCMV-positive mice as measured by qualitative PCR* Plasma Unit 1 Untreated Treated 5/5 3/5 5/5 1/5 2/5 0/5 1/5 0/5 0/5 1/5
Tenfold serial dilution scheme 100 10−1 10−2 10−3 10−4 10−5 10−6
Plasma Unit 2 Untreated Treated 4/5 1/5 4/5 1/5 2/5 0/5 0/5 0/5 0/5 0/5
Plasma Unit 3 Untreated Treated 5/5 1/5 5/5 0/5 2/5 0/5 0/5 0/5 0/5 0/5
* Infectious dose response of immune-compromised mice inoculated with 0.2 mL of either untreated or riboflavin and UV light–treated sample as measured by qualitative PCR targeting the IE1 gene of CMV.
TABLE 2. Viral titer and log reduction of cell-free MCMV treated with riboflavin and UV light as measured by an immune-compromised in vivo infectious dose-response assay (ID50) Viral titer (log ID50/mL) Plasma Unit 1 2 3 Mean SD
Pretreatment 4.0 3.4 3.6 3.7 0.3
Posttreatment 2.0 1.4 1.4 1.6 0.3
Log reduction 2.0 2.0 2.2 2.1 0.1
assayed in quadruplicate. Amplification conditions were as follows: 95°C × 10 minutes, followed by 50 cycles of 95°C × 15 seconds, 62°C × 15 seconds, and 72°C × 60 seconds. The PCR assay used in this study can routinely detect 1 to 5 MCMV genome-equivalents per reaction.29
RESULTS Mouse ID50 viral reduction model The mouse ID50 study evaluated the log reduction of MCMV after treatment with riboflavin and UV light using immune-compromised mice to titer the virus. Groups of five mice per dilution received untreated or treated virus samples that were serially diluted. After 10 days, mice spleens were analyzed for the presence of MCMV DNA. Mice with detectable quantities of MCMV DNA in their spleen homogenate, as measured by qualitative PCR, were considered to be infected with virus (Table 1). The Spearman-Karber method was used to calculate each sample’s viral titer. The mean viral titer of the pretreatment samples was 3.7 ± 0.3 log ID50/mL and the mean viral titer for the posttreatment samples was 1.6 ± 0.3 log ID50/mL. The calculated reduction for cell-free MCMV using an immune-compromised mouse dose-response model was 2.1 ± 0.1 log (Table 2).
TT-MCMV mouse model In the cell-associated MCMV group, mice were inoculated with 1 × 106 MCMV-infected WBCs/0.2 mL. The PLT units were either untreated or treated with the riboflavin and 4
TRANSFUSION
Volume **, ** **
TABLE 3. MCMV detection in mice 2 weeks posttransfusion*
PLT Unit Untreated Unit 1 Unit 2 Unit 3 Treated Unit 1 Unit 2 Unit 3
Cell-free MCMV Spleen Blood
Cell-associated/latent MCMV Spleen Blood
10/10 10/10 8/10
10/10 10/10 8/10
8/10 9/10 8/10
8/10 9/10 8/10
0/10 0/10 0/10
0/10 0/10 0/10
0/10 0/10 0/10
0/10 0/10 0/10
* MCMV was prepared either as cell-free virus or as WBCassociated virus. For cell-associated transmission studies, MCMV-infected WBCs were added to PLT units at a concentration of 1 × 106 WBCs/200 μL of PLTs. Cell-free MCMV was added to PLT units at a final concentration of 1 × 106 PFUs/ 200 μL of PLTs. Each experimental configuration (cell-associated or cell-free MCMV, untreated or Mirasol treated) was then transfused by tail vein into a cohort of 10 BALB/cByJ mice. The mice were rested for 14 days and then euthanized to harvest spleen and WBC samples. Each sample was subjected to sensitive nested PCR amplification of MCMV DNA.
UV light process. A total of 80% to 90% of the mice that received untreated PLT product were positive for the presence of MCMV in both their circulating WBCs and their spleen 14 days after inoculation, as measured by PCR. Comparatively, all of the mice that were inoculated with riboflavin and UV light–treated samples were negative for the presence of CMV (Table 3). The effectiveness of the riboflavin and UV light PRT system against cell-free MCMV was also evaluated. The mice that received untreated samples were again highly susceptible to TT-MCMV, with 80% to 100% of the mice testing positive for the presence of MCMV in their circulating WBCs and in their spleen 14 days after inoculation. All of the mice that were inoculated with riboflavin and UV light–treated samples were negative for MCMV (Table 3).
DISCUSSION Despite the use of seronegative and/or leukoreduced products, there remains a residual risk of human TT-CMV. Volume 55, April 2015 TRANSFUSION 861
KEIL ET AL.
Some of the remaining risk may originate from donations collected from donors in the early viremic or periseroconversion period. This period represents a time of potentially high risk of CMV transmission since plasma contains CMV DNA (which may represent infectious virus), neutralizing anti-CMV are not yet present, and the free virus cannot be eliminated by leukoreduction.30 The few cases of breakthrough CMV infections in patients who received leukoreduced units may represent infections caused either by the rare infected monocytes not removed by leukoreduction or possibly by plasma-free virus that cannot be removed by WBC filters. At present, there is not enough evidence to differentiate between these possibilities.30 One potential way to lower the remaining transfusion risk could be through the routine use of a pathogen reduction process. Our studies used both an in vivo infectious dose-response model to measure the viral reduction achieved and a MCMV mouse transfusion transmission model, in which both potentially infectious forms of MCMV were evaluated. The riboflavin and UV light process demonstrated a modest 2.1-log reduction of cellfree MCMV using the infectious dose model. However, despite this modest reduction in viral infectivity of MCMV, the TT-MCMV mouse model showed no MCMV transmission in animals receiving riboflavin and UV light–treated products that were infected with either 106 PFUs of cellfree virus or 106 infected WBCs. In combination, these studies show that high levels of MCMV reduction were not required to prevent TT-MCMV in a model designed to mimic human TT-CMV. The hypothesis around needing only a modest level of CMV reduction to potentially eliminate most, if not all, TT-CMV is consistent with prior observations from cell washing,31,32 frozen blood,33,34 leukoreduction, and serologic testing35 of blood for CMV, all of which indicate that high levels of reduction are potentially not required to prevent CMV transmission in the transfusion setting. In summary, we evaluated MCMV both in an infectivity reduction study and in a mouse transfusion transmission study. With a modest reduction of MCMV, the riboflavin and UV light PRT process prevented MCMV transmission when challenged with a mouse transfusion model. Based on these data we postulate that the rate of CMV transmissions by transfusion of unscreened, leukoreduced products could be further reduced, if not eliminated, by treatment with the Mirasol PRT system. This, however, will be subject to further evaluation from ongoing hemovigilance studies. CONFLICT OF INTEREST SDK and SM are employees of Terumo BCT. NS, RB, JLN, SK, PG, and CDH have disclosed no conflict of interest. JR has previously served as a paid consultant to Terumo BCT.
862 TRANSFUSION Volume 55, April 2015
MIRASOL PRT INACTIVATION OF MURINE CMV
REFERENCES 1. de Jong MD, Galasso GJ, Gazzard B, et al. Summary of the II International Symposium on Cytomegalovirus. Antiviral Res 1998;39:141-62. 2. Galea G, Urbaniak SJ. Cytomegalovirus studies on blood donors in north-east Scotland and a review of UK data. Vox Sang 1993;64:24-30. 3. Dworsky ME, Welch K, Cassady G, et al. Occupational risk for primary cytomegalovirus infection among pediatric health-care workers. N Engl J Med 1983;309:950-3. 4. Furui Y, Satake M, Hoshi Y, et al. Cytomegalovirus (CMV) seroprevalence in Japanese blood donors and high detection frequency of CMV DNA in elderly donors. Transfusion 2013;53:2190-7. 5. Barbara JA, Tegtmeier GE. Cytomegalovirus and blood transfusion. Blood Rev 1987;1:207-11. 6. Tegtmeier GE. Posttransfusion cytomegalovirus infections. Arch Pathol Lab Med 1989;113:236-45. 7. Ziemann M, Krueger S, Maier AB, et al. High prevalence of cytomegalovirus DNA in plasma samples of blood donors in connection with seroconversion. Transfusion 2007;47: 1972-83. 8. Mazeron MC. Leukocyte depletion and infection by cytomegalovirus. Transfus Clin Biol 2000;7(Suppl 1):31s-35s. 9. Roback JD, Drew WL, Laycock ME, et al. CMV DNA is rarely detected in healthy blood donors using validated PCR assays. Transfusion 2003;43:314-21. 10. Ljungman P. Risk of cytomegalovirus transmission by blood products to immunocompromised patients and means for reduction. Br J Haematol 2004;125:107-16. 11. Roback JD, Su L, Zimring JC, et al. Transfusiontransmitted cytomegalovirus: lessons from a murine model. Transfus Med Rev 2007;21:26-36. 12. Nichols WG, Price TH, Gooley T, et al. Transfusiontransmitted cytomegalovirus infection after receipt of leukoreduced blood products. Blood 2003;101: 4195-200. 13. Shapiro MJ. To filter blood or universal leukoreduction: what is the answer? Crit Care 2004;8(Suppl 2):S27-30. 14. Bowden RA, Slichter SJ, Sayers M, et al. A comparison of filtered leukocyte-reduced and cytomegalovirus (CMV) seronegative blood products for the prevention of transfusion-associated CMV infection after marrow transplant. Blood 1995;86:3598-603. 15. Narvios AB, de Lima M, Shah H, et al. Transfusion of leukoreduced cellular blood components from cytomegalovirus-unscreened donors in allogeneic hematopoietic transplant recipients: analysis of 72 recipients. Bone Marrow Transplant 2005;36:499-501. 16. Schottstedt V, Blumel J, Burger R, et al. Human cytomegalovirus (HCMV)—revised. Transfus Med Hemother 2010; 37:365-75. 17. Jordan CT, Saakadze N, Newman JL, et al. Photochemical treatment of platelet concentrates with amotosalen Volume **, ** **
TRANSFUSION
5
KEIL ET AL.
MIRASOL PRT INACTIVATION OF MURINE CMV
hydrochloride and ultraviolet A light inactivates free and latent cytomegalovirus in a murine transfusion model. Transfusion 2004;44:1159-65. 18. Roback JD, Conlan M, Drew WL, et al. The role of photochemical treatment with amotosalen and UV-A light in the prevention of transfusion-transmitted cytomegalovirus infections. Transfus Med Rev 2006;20:45-56. 19. Ruane PH, Edrich R, Gampp D, et al. Photochemical inactivation of selected viruses and bacteria in platelet concentrates using riboflavin and light. Transfusion 2004;44: 877-85. human plasma—a very robust method for virus inactivation. Validated virus safety of OCTAPLAS. Vox Sang 1998; 74(Suppl 1):207-12. 21. Mohr H, Lambrecht B, Selz A. Photodynamic virus inactivation of blood components. Immunol Invest 1995;24:7385.
major organ site of cytomegalovirus latency and recurrence. J Virol 1993;67:5360-6. 28. Committee for Proprietary Medicinal Products. Note for guidance on virus validation studies: the design, contribution and interpretation of studies validating the inactivation and removal of viruses. EMEA CPMP BWP 1996; 268/95. transmitted cytomegalovirus (CMV) infections in a murine model: characterization of CMV-infected donor mice. Transfusion 2006;46:889-95. 30. Roback JD, Josephson CD. New insights for preventing transfusion-transmitted cytomegalovirus and other white blood cell-associated viral infections. Transfusion 2013;53: 2112-16.
22. Ziemann M, Juhl D, Gorg S, et al. The impact of donor cytomegalovirus DNA on transfusion strategies for at-risk patients. Transfusion 2013;53:2183-9. 23. Reddy HL, Dayan AD, Cavagnaro J, et al. Toxicity testing of a novel riboflavin-based technology for pathogen reduction and white blood cell inactivation. Transfus Med Rev 2008;22:133-53. 24. Mundt JM, Rouse L, Van den Bossche J, et al. Chemical and biological mechanisms of pathogen reduction technologies. Photochem Photobiol 2014;90:957-64. 25. Cadet J, Decarroz C, Wang SY, et al. Mechanisms and products of photosensitized degradation of nucleic acids and related model compounds. Isr J Chem 1983;23: 420-9. 26. Feys HB, Van AB, Devreese K, et al. Oxygen removal during pathogen inactivation with riboflavin and UV light
TRANSFUSION
Sang 2014;106:307-15. 27. Balthesen M, Messerle M, Reddehase MJ. Lungs are a
29. Roback JD, Su L, Newman JL, et al. Transfusion-
20. Biesert L, Suhartono H. Solvent/detergent treatment of
6
preserves protein function in plasma for transfusion. Vox
Volume **, ** **
31. Meryman HT. Frozen red cells. Transfus Med Rev 1989;3: 121-7. 32. Brady M, Anderson J, Hawkins E, et al. Prevention of posttransfusion cytomegalovirus infection (PTCMV) in neonates by the use of frozen-washed red blood cells (FWRBC). Clin Res 1982;30:895A. 33. Meryman HT, Bross J, Lebovitz R. The preparation of leukocyte-poor red blood cells: a comparative study. Transfusion 1980;20:285-92. 34. Simon TL, Johnson JD, Koffler H, et al. Impact of previously frozen deglycerolized red blood cells on cytomegalovirus transmission to newborn infants. Plasma Ther Transfus Technol 1987;8:51-6. 35. Preiksaitis JK. The cytomegalovirus-“safe” blood product: is leukoreduction equivalent to antibody screening? Transfus Med Rev 2000;14:112-36.
Volume 55, April 2015 TRANSFUSION 863
BACKGROUND: Two studies were performed to test the effectiveness of riboflavin and ultraviolet (UV) light treatment (Mirasol PRT, Terumo BCT) against murine cytomegalovirus (MCMV). The first study utilized immune-compromised mice to measure the reduction of cell-free MCMV. A second study used a murine model to evaluate the ability of Mirasol PRT to prevent transfusion-transmitted (TT)-MCMV infection. STUDY DESIGN AND METHODS: Human plasma was inoculated with MCMV and then treated with Mirasol PRT. The viral titer was measured using an infectious dose 50% assay in nude mice. Mice were euthanized on Day 10 posttransfusion, and their spleens were tested for the presence of MCMV DNA using polymerase chain reaction (PCR). Mirasol PRT was also evaluated to determine its effectiveness in preventing TT-MCMV in platelets (PLTs) stored in PLT additive solution. PLTs were inoculated with either cellassociated MCMV or cell-free MCMV and then treated with Mirasol PRT. Mice were transfused with treated or untreated product and were euthanized 14 days posttransfusion. Blood and spleens were assayed for MCMV DNA by real-time-PCR. RESULTS: Using nude mice to titer MCMV, a modest 2.1-log reduction was observed in plasma products after Mirasol PRT treatment. TT-MCMV was not observed in the mouse transfusion model when either cell-free or cell-associated MCMV was treated with Mirasol PRT; MCMV transmission was uniformly observed in mice transfused with untreated PLTs. CONCLUSIONS: These results suggest that using riboflavin and UV light treatment may be able to reduce the occurrence of transmission of human CMV from infectious PLTs and plasma units.
858 TRANSFUSION Volume 55, April 2015
H
uman cytomegalovirus (CMV) is a doublestranded DNA virus in the herpes virus family. The virus is ubiquitous around the world with approximately 40% to 100% of adults infected.1 Studies from several years ago in both UK blood donors and US health care workers estimated yearly seroconversion rates in the seronegative population of 1% to 3%.2,3 A recent study of Japanese blood donors identified a similar annual seroconversion rate, which has held constant for the past 15 years.4 CMV infections in healthy individuals are typically asymptomatic, with some individuals experiencing either mild flulike symptoms or symptoms similar to mononucleosis. After resolution of the primary infection, CMV typically establishes a lifelong infection in the host. Transmission of the virus can occur through any close contact with bodily fluid, including blood. When CMV is transmitted via blood transfusion to an immunocompromised individual, this can be cause for high level of concern.5-11 The potential morbidity and mortality associated with transfusion-transmitted (TT)-CMV in these patients led to the introduction of serologic testing and the use of leukoreduction for specific at-risk patient groups.5,9,12,13 With the development of
ABBREVIATIONS: ID50 = infectious dose 50%; MCMV = murine cytomegalovirus; PFU(s) = plaque-forming unit(s); PRT(s) = pathogen reduction technology(-ies); TT = transfusion transmitted. From 1Terumo BCT, Lakewood, Colorado; 2Emory University, Atlanta, Georgia; 3Colorado State University, Fort Collins, Colorado; and 4New York Blood Center, New York, New York. Address reprint requests to: Shawn D. Keil, Terumo BCT, 10810 W. Collins Avenue, Lakewood, CO 80215; e-mail: [email protected]. The studies described in this article were funded by Terumo BCT. Received for publication January 13, 2014; revision received September 10, 2014, and accepted September 11, 2014. doi: 10.1111/trf.12945 © 2014 AABB TRANSFUSION **;**:**-**. 2015;55:858–863. Volume **, ** **
TRANSFUSION
1
KEIL ET AL.
MIRASOL PRT INACTIVATION OF MURINE CMV
leukoreduction filters, a further reduction in risk of CMV transmission has been observed. Studies by Bowden and colleagues14 and Narvios and colleagues15 demonstrated the potential of leukofiltration to reduce disease transmission of CMV to levels that were approximately comparable to those observed with CMV-seronegative blood. The available literature and clinical observations suggest that a method capable of achieving a residual white blood cell (WBC) count of fewer than 5 × 106 cells results in a product that is approximately equivalent to a seronegative unit in terms of CMV risk.11,16 This suggestion is further supported by the work of Jordan and colleagues17 who demonstrated in an in vivo mouse model of CMV transmission that a reduction in white cell as well as cell-free CMV is capable of preventing murine CMV (MCMV) transmission. Nonetheless, despite the use of serology and/or leukoreduction, some residual risk of CMV transmission remains. Pathogen reduction technologies (PRTs) have the potential to replace CMV serology and in conjunction with leukoreduction could reduce the risk of TT-CMV. PRT approaches have the ability to inactivate viruses in both their cell-free and cell-associated forms.18-21 Additionally they can inactivate WBCs, which may harbor or carry infectious agents in their latent forms. Examples are members of the herpesvirdae and retroviridae family of viruses. While much clinical focus on CMV centralizes around reducing WBC-associated viral loads through leukoreduction, a recent study discovered that CMV DNA (a surrogate marker for infectious virus) is identified most often in the plasma of window-phase or earlyseroconversion donors and less often within WBCs (presumably as latent virus).22 In the present studies we used mice to model both potentially infectious forms of CMV, WBC-associated virus and cell-free plasma viremia. The use of riboflavin and ultraviolet (UV) light for pathogen reduction is nontoxic and nonmutagenic, and riboflavin and UV light–treated components have been shown to be safe for transfusion recipients as well as for those handling blood products.23 Riboflavin molecules associate with nucleic acids in treated products. Exposure to UV light activates riboflavin, causing a chemical alteration to functional groups of the nucleic acids (primarily guanine bases), preventing DNA replication.24 As with other photosensitizer-based processes, such as methylene blue and psoralen, riboflavin and UV can also induce oxygen-mediated damage to pathogens, proteins, and cellular components.24-26 In this article we examine the log reduction of cell-free MCMV, treated with riboflavin and UV light, using an in vivo infectious dose viral reduction model. We also demonstrate that treatment of MCMV-infected platelet (PLT) products with riboflavin and UV light can prevent TT-MCMV using an in vivo mouse transfusion model. 2
TRANSFUSION
Volume **, ** **
The second study mimics previously published work evaluating a psoralen-based PRT process using the same in vivo mouse transfusion model.17 This TT-MCMV model has proven to be a powerful system for dissecting the biology of TT-CMV as well as developing improved methods to prevent its occurrence. The system can be used to perform experimental manipulations not possible in human subjects. It has been successfully used to study the kinetics and viral compartmentalization of recently infected blood donors, determine the minimum number of residual WBCs necessary for TT-CMV, demonstrate that monocytes are the WBC subset that is primarily responsible for TT-CMV, and also show that TT-CMV can be completely prevented by pathogen inactivation technologies.11
MATERIALS AND METHODS Mouse ID50 viral reduction model ID50 cell-free MCMV stock preparation MCMV Smith strain (ATCC #VR-1399) was prepared from the supernatant of infected C127 cells (ATCC #1616); stock virus was frozen at −80°C until needed. The stock viral titer was 2.8 × 106 plaque-forming units (PFUs)/mL.
ID50 cell-free MCMV mouse model A total of four type-matched human recovered plasma products were pooled and split into three 200-mL plasma products. Previous work has found the reduction of viruses in plasma to be equivalent to the reduction of virus observed in PLT units (data not shown); thus plasma was chosen for this study due to the convenience of obtaining plasma units versus PLT units. After transfer of the plasma products to standard Mirasol PRT illumination and storage bags, 10 mL of cell-free MCMV (4% vol/vol) and 35 mL of riboflavin was added to each of the 3 plasma units. The units were treated with the standard riboflavin and UV light process according to methods described previously.19 Pretreatment and posttreatment samples were serially diluted 10-fold in HEPES-buffered Dulbecco’s modified Eagle’s medium containing 1% bovine serum albumin. A total of five nude BALB/c mice (Charles River, Wilmington, MA) were inoculated with 200 μL of sample intraperitoneally at each serial dilution. Ten days after inoculation, recipient mice were euthanized and their spleens were recovered. For each mouse, approximately 10 mg of spleen was homogenized using a mixer mill and stainless-steel ball in a volume of 80 μL of phosphatebuffered saline (PBS). DNA was extracted from the spleen homogenates using a blood and tissue kit (DNeasy, Chatsworth, CA) and eluted into a volume of 200 μL. Extracted DNA was analyzed via conventional polymerase chain reaction (PCR) in 50-μL reactions. A 25-μL reaction volume was created for each sample of extracted DNA. The primers used to amplify the MCMV DNA target the immediate-early (IE1) gene of the virus: 5′-ATT Volume 55, April 2015 TRANSFUSION 859
MIRASOL PRT INACTIVATION OF MURINE CMV
KEIL ET AL.
GTTCATTGCCTGGGGAGTTT and 5′-ATCTGGTGCTCCTC AGATCAGCTAA.27 Amplification was conducted using 40 cycles of 95°C for 30 seconds, 58°C for 60 seconds, and 72°C for 60 seconds. PCR products were run on a 1.5% agarose gel and detected by staining with ethidium bromide. Mice were considered positive for MCMV if the 363-bp amplicon was observed in the tested sample. Mice were scored as either positive or negative for the presence of MCMV.
ID50 cell-free MCMV titer calculation and viral reduction The viral titer was calculated using the Spearman-Karber method and was expressed as infectious dose 50% per mL (ID50/mL). The following equation was used to calculate the viral titer (M):
M = xk + d [0.5 − (1 n) × (r )], where xk is the dose of highest dilution, r is the sum of negative responses, d is the spacing between dilutions, and n is the number of mice per dilution. The reduction factor (log reduction) was calculated by applying the following equation:
RF = log10 [( Volumepreillumination ) × (Concentration preillumination ) ( Volumetreated ) 28 × (Concentration treated )] In the above study the Volumepreillumination and Volumetreated are identical.
TT-MCMV mouse model Cell-associated MCMV stock preparation To prepare the cell-associated MCMV infected murine WBCs, 25 BALB/cByJ mice (The Jackson Laboratories, Bar Harbor, ME) were infected by intraperitoneal injection with 1 × 106 PFUs Smith strain (MCMV) and rested for 14 days. The MCMV-infected mice were then euthanized to collect peripheral blood, which was uniformly positive for MCMV by viral PCR. Whole blood was harvested from the donor mice into approximately 1/10 volume of ACD-A anticoagulant. After pooling, the blood was centrifuged at 400 × g for 5 minutes, and the plasma was decanted. Red blood cells (RBCs) were lysed using lysing buffer (PharM Lyse, BD Biosciences, San Jose, CA) according to manufacturer’s instructions. The WBCs that remained were separated from the RBC lysate through centrifugation at 400 × g for 5 minutes. To remove any remaining serum and free virus, harvested WBCs were washed three times using PBS. The harvested WBCs were counted using a hemocytometer.
Cell-free MCMV stock preparation Cell-free MCMV was prepared by growing Smith strain MCMV (ATCC #VR-1399) in 3T3 cells (ATCC #CRL-1658) 860 TRANSFUSION Volume 55, April 2015
and harvesting the supernatant; stock virus was frozen at −80°C until needed. The stock viral titer was approximately 107 PFUs/mL.
Mirasol treatment of TT-MCMV products PLT products were collected using an automated blood collection system (Trima, Terumo BCT, Lakewood, CO) with a targeted product volume of 125 mL at 2.3 × 109 cell/L concentration. Products were rested for 2 hours postcollection and then were evaluated for acceptable cell quality before they were shipped overnight to Atlanta, Georgia. However, due to the difficulty of obtaining large quantities of infected mouse WBCs, all riboflavin and UV light treatments used for the evaluation of Mirasol against TT-MCMV were done using a 250 μL treatment volume in a 48-well plate. A single layer of the bag material made from the standard Mirasol treatment bag was placed on top of the 48-well plate before treatment to ensure the same light attenuation as in the standard riboflavin and UV light PRT process. A quartz glass lid was placed on top to keep the bag material in place during illumination. Each 48-well plate was treated with a predetermined energy dose. This energy dose was established by equivalent reduction of encephalomyocarditis virus in the 48-plate set-up compared to the standard riboflavin and UV light process at 6.24 J/mL (data not shown). Wells of the 48-well plate contained 80 μL of hyperconcentrated PLT product, 25 μL of riboflavin, 47 μL of SSP+ (Macopharma, Mouvaux, France), and 98 μL of viral inoculum. The final product had a 32% plasma carryover. Previous studies performed with the cell-associated TT-MCMV model found one viral genome per 510 donor WBCs. Thus, if one extrapolates this value to the 1 × 106 WBCs dosed in this experiment a total of 1961 infected WBCs were transfused into each mouse.17 A total of three replicate PLT units were evaluated for both cell-associated and cell-free MCMV.
Animals Cohorts of BALB/cByJ recipient mice (n = 10 per condition; The Jackson Laboratories) were injected via tail vein infusion. The volume of all transfusions was 200 μL. All recipient mice were euthanized 14 days after transfusion. Blood and spleens were collected and assayed for MCMV DNA by real-time PCR.
PCR amplification of TT-MCMV DNA DNA was isolated from mouse spleens and whole blood (EZNA kit, Omega Bio-Tek, Doraville, GA) and quantitated (PicoGreen dsDNA quantitation kit; Molecular Probes, Eugene, OR). MCMV DNA was amplified by PCR in a 96-well plate (iCycler, Bio-Rad Laboratories, Hercules, CA). Each 15-μL reaction contained 7.5 μL of SYBR Green master mix (Applied Biosystems, Foster City, CA), Primers IE1.1983 and IE1.2345, and 40 ng of DNA. Samples were Volume **, ** **
TRANSFUSION
3
KEIL ET AL.
MIRASOL PRT INACTIVATION OF MURINE CMV
TABLE 1. MCMV-positive mice as measured by qualitative PCR* Plasma Unit 1 Untreated Treated 5/5 3/5 5/5 1/5 2/5 0/5 1/5 0/5 0/5 1/5
Tenfold serial dilution scheme 100 10−1 10−2 10−3 10−4 10−5 10−6
Plasma Unit 2 Untreated Treated 4/5 1/5 4/5 1/5 2/5 0/5 0/5 0/5 0/5 0/5
Plasma Unit 3 Untreated Treated 5/5 1/5 5/5 0/5 2/5 0/5 0/5 0/5 0/5 0/5
* Infectious dose response of immune-compromised mice inoculated with 0.2 mL of either untreated or riboflavin and UV light–treated sample as measured by qualitative PCR targeting the IE1 gene of CMV.
TABLE 2. Viral titer and log reduction of cell-free MCMV treated with riboflavin and UV light as measured by an immune-compromised in vivo infectious dose-response assay (ID50) Viral titer (log ID50/mL) Plasma Unit 1 2 3 Mean SD
Pretreatment 4.0 3.4 3.6 3.7 0.3
Posttreatment 2.0 1.4 1.4 1.6 0.3
Log reduction 2.0 2.0 2.2 2.1 0.1
assayed in quadruplicate. Amplification conditions were as follows: 95°C × 10 minutes, followed by 50 cycles of 95°C × 15 seconds, 62°C × 15 seconds, and 72°C × 60 seconds. The PCR assay used in this study can routinely detect 1 to 5 MCMV genome-equivalents per reaction.29
RESULTS Mouse ID50 viral reduction model The mouse ID50 study evaluated the log reduction of MCMV after treatment with riboflavin and UV light using immune-compromised mice to titer the virus. Groups of five mice per dilution received untreated or treated virus samples that were serially diluted. After 10 days, mice spleens were analyzed for the presence of MCMV DNA. Mice with detectable quantities of MCMV DNA in their spleen homogenate, as measured by qualitative PCR, were considered to be infected with virus (Table 1). The Spearman-Karber method was used to calculate each sample’s viral titer. The mean viral titer of the pretreatment samples was 3.7 ± 0.3 log ID50/mL and the mean viral titer for the posttreatment samples was 1.6 ± 0.3 log ID50/mL. The calculated reduction for cell-free MCMV using an immune-compromised mouse dose-response model was 2.1 ± 0.1 log (Table 2).
TT-MCMV mouse model In the cell-associated MCMV group, mice were inoculated with 1 × 106 MCMV-infected WBCs/0.2 mL. The PLT units were either untreated or treated with the riboflavin and 4
TRANSFUSION
Volume **, ** **
TABLE 3. MCMV detection in mice 2 weeks posttransfusion*
PLT Unit Untreated Unit 1 Unit 2 Unit 3 Treated Unit 1 Unit 2 Unit 3
Cell-free MCMV Spleen Blood
Cell-associated/latent MCMV Spleen Blood
10/10 10/10 8/10
10/10 10/10 8/10
8/10 9/10 8/10
8/10 9/10 8/10
0/10 0/10 0/10
0/10 0/10 0/10
0/10 0/10 0/10
0/10 0/10 0/10
* MCMV was prepared either as cell-free virus or as WBCassociated virus. For cell-associated transmission studies, MCMV-infected WBCs were added to PLT units at a concentration of 1 × 106 WBCs/200 μL of PLTs. Cell-free MCMV was added to PLT units at a final concentration of 1 × 106 PFUs/ 200 μL of PLTs. Each experimental configuration (cell-associated or cell-free MCMV, untreated or Mirasol treated) was then transfused by tail vein into a cohort of 10 BALB/cByJ mice. The mice were rested for 14 days and then euthanized to harvest spleen and WBC samples. Each sample was subjected to sensitive nested PCR amplification of MCMV DNA.
UV light process. A total of 80% to 90% of the mice that received untreated PLT product were positive for the presence of MCMV in both their circulating WBCs and their spleen 14 days after inoculation, as measured by PCR. Comparatively, all of the mice that were inoculated with riboflavin and UV light–treated samples were negative for the presence of CMV (Table 3). The effectiveness of the riboflavin and UV light PRT system against cell-free MCMV was also evaluated. The mice that received untreated samples were again highly susceptible to TT-MCMV, with 80% to 100% of the mice testing positive for the presence of MCMV in their circulating WBCs and in their spleen 14 days after inoculation. All of the mice that were inoculated with riboflavin and UV light–treated samples were negative for MCMV (Table 3).
DISCUSSION Despite the use of seronegative and/or leukoreduced products, there remains a residual risk of human TT-CMV. Volume 55, April 2015 TRANSFUSION 861
KEIL ET AL.
Some of the remaining risk may originate from donations collected from donors in the early viremic or periseroconversion period. This period represents a time of potentially high risk of CMV transmission since plasma contains CMV DNA (which may represent infectious virus), neutralizing anti-CMV are not yet present, and the free virus cannot be eliminated by leukoreduction.30 The few cases of breakthrough CMV infections in patients who received leukoreduced units may represent infections caused either by the rare infected monocytes not removed by leukoreduction or possibly by plasma-free virus that cannot be removed by WBC filters. At present, there is not enough evidence to differentiate between these possibilities.30 One potential way to lower the remaining transfusion risk could be through the routine use of a pathogen reduction process. Our studies used both an in vivo infectious dose-response model to measure the viral reduction achieved and a MCMV mouse transfusion transmission model, in which both potentially infectious forms of MCMV were evaluated. The riboflavin and UV light process demonstrated a modest 2.1-log reduction of cellfree MCMV using the infectious dose model. However, despite this modest reduction in viral infectivity of MCMV, the TT-MCMV mouse model showed no MCMV transmission in animals receiving riboflavin and UV light–treated products that were infected with either 106 PFUs of cellfree virus or 106 infected WBCs. In combination, these studies show that high levels of MCMV reduction were not required to prevent TT-MCMV in a model designed to mimic human TT-CMV. The hypothesis around needing only a modest level of CMV reduction to potentially eliminate most, if not all, TT-CMV is consistent with prior observations from cell washing,31,32 frozen blood,33,34 leukoreduction, and serologic testing35 of blood for CMV, all of which indicate that high levels of reduction are potentially not required to prevent CMV transmission in the transfusion setting. In summary, we evaluated MCMV both in an infectivity reduction study and in a mouse transfusion transmission study. With a modest reduction of MCMV, the riboflavin and UV light PRT process prevented MCMV transmission when challenged with a mouse transfusion model. Based on these data we postulate that the rate of CMV transmissions by transfusion of unscreened, leukoreduced products could be further reduced, if not eliminated, by treatment with the Mirasol PRT system. This, however, will be subject to further evaluation from ongoing hemovigilance studies. CONFLICT OF INTEREST SDK and SM are employees of Terumo BCT. NS, RB, JLN, SK, PG, and CDH have disclosed no conflict of interest. JR has previously served as a paid consultant to Terumo BCT.
862 TRANSFUSION Volume 55, April 2015
MIRASOL PRT INACTIVATION OF MURINE CMV
REFERENCES 1. de Jong MD, Galasso GJ, Gazzard B, et al. Summary of the II International Symposium on Cytomegalovirus. Antiviral Res 1998;39:141-62. 2. Galea G, Urbaniak SJ. Cytomegalovirus studies on blood donors in north-east Scotland and a review of UK data. Vox Sang 1993;64:24-30. 3. Dworsky ME, Welch K, Cassady G, et al. Occupational risk for primary cytomegalovirus infection among pediatric health-care workers. N Engl J Med 1983;309:950-3. 4. Furui Y, Satake M, Hoshi Y, et al. Cytomegalovirus (CMV) seroprevalence in Japanese blood donors and high detection frequency of CMV DNA in elderly donors. Transfusion 2013;53:2190-7. 5. Barbara JA, Tegtmeier GE. Cytomegalovirus and blood transfusion. Blood Rev 1987;1:207-11. 6. Tegtmeier GE. Posttransfusion cytomegalovirus infections. Arch Pathol Lab Med 1989;113:236-45. 7. Ziemann M, Krueger S, Maier AB, et al. High prevalence of cytomegalovirus DNA in plasma samples of blood donors in connection with seroconversion. Transfusion 2007;47: 1972-83. 8. Mazeron MC. Leukocyte depletion and infection by cytomegalovirus. Transfus Clin Biol 2000;7(Suppl 1):31s-35s. 9. Roback JD, Drew WL, Laycock ME, et al. CMV DNA is rarely detected in healthy blood donors using validated PCR assays. Transfusion 2003;43:314-21. 10. Ljungman P. Risk of cytomegalovirus transmission by blood products to immunocompromised patients and means for reduction. Br J Haematol 2004;125:107-16. 11. Roback JD, Su L, Zimring JC, et al. Transfusiontransmitted cytomegalovirus: lessons from a murine model. Transfus Med Rev 2007;21:26-36. 12. Nichols WG, Price TH, Gooley T, et al. Transfusiontransmitted cytomegalovirus infection after receipt of leukoreduced blood products. Blood 2003;101: 4195-200. 13. Shapiro MJ. To filter blood or universal leukoreduction: what is the answer? Crit Care 2004;8(Suppl 2):S27-30. 14. Bowden RA, Slichter SJ, Sayers M, et al. A comparison of filtered leukocyte-reduced and cytomegalovirus (CMV) seronegative blood products for the prevention of transfusion-associated CMV infection after marrow transplant. Blood 1995;86:3598-603. 15. Narvios AB, de Lima M, Shah H, et al. Transfusion of leukoreduced cellular blood components from cytomegalovirus-unscreened donors in allogeneic hematopoietic transplant recipients: analysis of 72 recipients. Bone Marrow Transplant 2005;36:499-501. 16. Schottstedt V, Blumel J, Burger R, et al. Human cytomegalovirus (HCMV)—revised. Transfus Med Hemother 2010; 37:365-75. 17. Jordan CT, Saakadze N, Newman JL, et al. Photochemical treatment of platelet concentrates with amotosalen Volume **, ** **
TRANSFUSION
5
KEIL ET AL.
MIRASOL PRT INACTIVATION OF MURINE CMV
hydrochloride and ultraviolet A light inactivates free and latent cytomegalovirus in a murine transfusion model. Transfusion 2004;44:1159-65. 18. Roback JD, Conlan M, Drew WL, et al. The role of photochemical treatment with amotosalen and UV-A light in the prevention of transfusion-transmitted cytomegalovirus infections. Transfus Med Rev 2006;20:45-56. 19. Ruane PH, Edrich R, Gampp D, et al. Photochemical inactivation of selected viruses and bacteria in platelet concentrates using riboflavin and light. Transfusion 2004;44: 877-85. human plasma—a very robust method for virus inactivation. Validated virus safety of OCTAPLAS. Vox Sang 1998; 74(Suppl 1):207-12. 21. Mohr H, Lambrecht B, Selz A. Photodynamic virus inactivation of blood components. Immunol Invest 1995;24:7385.
major organ site of cytomegalovirus latency and recurrence. J Virol 1993;67:5360-6. 28. Committee for Proprietary Medicinal Products. Note for guidance on virus validation studies: the design, contribution and interpretation of studies validating the inactivation and removal of viruses. EMEA CPMP BWP 1996; 268/95. transmitted cytomegalovirus (CMV) infections in a murine model: characterization of CMV-infected donor mice. Transfusion 2006;46:889-95. 30. Roback JD, Josephson CD. New insights for preventing transfusion-transmitted cytomegalovirus and other white blood cell-associated viral infections. Transfusion 2013;53: 2112-16.
22. Ziemann M, Juhl D, Gorg S, et al. The impact of donor cytomegalovirus DNA on transfusion strategies for at-risk patients. Transfusion 2013;53:2183-9. 23. Reddy HL, Dayan AD, Cavagnaro J, et al. Toxicity testing of a novel riboflavin-based technology for pathogen reduction and white blood cell inactivation. Transfus Med Rev 2008;22:133-53. 24. Mundt JM, Rouse L, Van den Bossche J, et al. Chemical and biological mechanisms of pathogen reduction technologies. Photochem Photobiol 2014;90:957-64. 25. Cadet J, Decarroz C, Wang SY, et al. Mechanisms and products of photosensitized degradation of nucleic acids and related model compounds. Isr J Chem 1983;23: 420-9. 26. Feys HB, Van AB, Devreese K, et al. Oxygen removal during pathogen inactivation with riboflavin and UV light
TRANSFUSION
Sang 2014;106:307-15. 27. Balthesen M, Messerle M, Reddehase MJ. Lungs are a
29. Roback JD, Su L, Newman JL, et al. Transfusion-
20. Biesert L, Suhartono H. Solvent/detergent treatment of
6
preserves protein function in plasma for transfusion. Vox
Volume **, ** **
31. Meryman HT. Frozen red cells. Transfus Med Rev 1989;3: 121-7. 32. Brady M, Anderson J, Hawkins E, et al. Prevention of posttransfusion cytomegalovirus infection (PTCMV) in neonates by the use of frozen-washed red blood cells (FWRBC). Clin Res 1982;30:895A. 33. Meryman HT, Bross J, Lebovitz R. The preparation of leukocyte-poor red blood cells: a comparative study. Transfusion 1980;20:285-92. 34. Simon TL, Johnson JD, Koffler H, et al. Impact of previously frozen deglycerolized red blood cells on cytomegalovirus transmission to newborn infants. Plasma Ther Transfus Technol 1987;8:51-6. 35. Preiksaitis JK. The cytomegalovirus-“safe” blood product: is leukoreduction equivalent to antibody screening? Transfus Med Rev 2000;14:112-36.
Volume 55, April 2015 TRANSFUSION 863
