Tissue Antigens ISSN 0001-2815
BRIEF COMMUNICATION
Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis C. Imperiali, P. Alía-Ramos & A. Padró-Miquel Genètica Molecular-Laboratori Clínic, Hospital Universitari de Bellvitge, L’Hospitalet de Llobregat, Catalonia, Spain
Key words Behçet disease; high-resolution melting assay; HLA-B*51; method; real-time PCR Correspondence Ariadna Padró-Miquel Genètica Molecular-Laboratori Clínic, Hospital Universitari de Bellvitge Feixa Llarga s/n, 08907 L’Hospitalet de Llobregat Catalonia Spain Tel: +34 93 260 75 43 Fax: +34 93 260 75 46 e-mail: [email protected] Received 26 January 2015; revised 30 May 2015; accepted 9 June 2015
Abstract HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget.
doi: 10.1111/tan.12603
Rapid detection of HLA-B*51 by high-resolution melting curve analysis
Behçet disease (BD) is a rare disorder that causes multisystemic inflammation of the blood vessels (1, 2). The prevalence of BD is higher in Europe and Asia and very rare in Africa, South-America, and Australia (3). Many studies have focused on elucidating the etiology of BD, but it remains unclear. There is evidence of a relationship between the onset of this disease and a genetic susceptibility of the patient together with environmental factors (4). The strongest known genetic risk factor for BD is the major histocompatibility complex class I allele HLA-B*51. The meta-analysis written by de Menthon et al. showed that the risk of HLA-B*51 carriers for developing BD is increased by a factor of 5.90 (95% confidence interval: 4.87–7.16) (2). Several case–control studies have also confirmed this relationship. Ombrello et al. for example, recently reported an odds ratio (OR) of 3.0 (P = 1.3 × 10−55 , n = 2447) (5). HLA-B*51 contains almost 200 suballeles (HLA-B*51:01–HLA-B*51:189) (6), with HLA-B*51:01 being the most frequent. It is suggested that the common motifs of the HLA-B*51 family such as 63-Asn and 67-Phe of the protein are involved in the susceptibility to BD, regardless of the suballeles. (7–9). Genome-wide association studies together with candidate genes approach strategies have identified several susceptibility © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Tissue Antigens, 2015, 86, 139–142
loci that may also be implicated in the pathophysiology of BD. Other HLA alleles and single-nucleotide polymorphisms were identified as independently associated with BD (10). However, the HLA-B*51 allele remained the primary risk factor of BD (5, 11). Several methods like sequence-based typing (4), sequence-specific priming (12), conventional polymerase chain reaction (PCR), direct sequencing, or reverse sequence-specific oligonucleotide hybridization are available for the detection of HLA genotypes (13). Besides, high-resolution melting (HRM) is an easy, fast, and inexpensive molecular method to analyze genetic variations in double-stranded PCR amplicons. It is based on the fact that ds DNA dissociates at different temperatures depending on the specific nucleotide composition. The reaction contains ds DNA-intercalating dyes that fluoresce brightly when they are bound to double-stranded DNA. The amplified ds DNA is subjected to a slow temperature ramp resulting in the dissociation of the two strands at the specific melting temperature. Real-time PCR instrumentation with precise temperature ramp control and advanced data capture capabilities together with a software designed specifically for HRM analysis allow the accuracy and reproducibility of this technique. This relatively new method is useful to test for HLA alleles. The aim of this study was to design and develop an HRM assay to identify the presence or absence of HLA-B*51 allele. 139
C. Imperiali et al.
HLA-B*51 detection by HRM real-time PCR
Table 1 Primers for multiplex PCR amplification and product length
Primer sequence (5′ –3′ ) HLA-B*51 forward HLA-B*51 reverse Internal forward HFE Internal reverse HFE
GGGGAGCCCCGCTTCATT TTGTAGTAGCGGAGCGCGA TGGCAAGGGTAAACAGATCC CTCAGGCACTCCTCTCAACC
PCR product length 206 bp 390 bp
HFE, human hemochromatosis protein gene; PCR, polymerase chain reaction.
HLA-B*51:05 on account of its prevalence in their geographical region should use allele-specific primers discriminating this subantigen. In addition, a primer pair was selected to operate as internal control for the amplification, especially when samples are negative for HLA-B*51 and specific primers do not anneal. All primers are listed in Table 1. Internal control primers anneal to the human hemochromatosis protein gene (HFE gene), in a non hot-spot locus. PCR and HRM curve analysis
Samples
Genomic DNA from 45 samples was extracted from ethylenediaminetetraacetic acid (EDTA)-anticoagulated peripheral blood using a commercial DNA purification kit (Maxwell 16 blood DNA prification kit, Promega, Madison, WI). From these samples, 25 had been genotyped for HLA-B*51 in a reference laboratory by sequence-specific oligonucleotide primed PCR: 8 resulted positive, and the remaining 17 were negative. Besides, to confirm primer specificity, we also tested 15 samples that were positive for HLA-B*57, and 5 that were positive for HLA-B*27. Additionally, we acquired 16 purified genomic DNA samples from the Cell Bank inventory of B-cell lines (International Histocompatibility Working Group): 7 positive samples with alleles HLA-B*51:01, *51:03, *51:06, and *51:09 and 9 negative samples with the following alleles: HLA-B*07, *15, *27, *35, *44, *45, *49, *52, *53, *57, and *78.
Primer design
Regarding the primer design (Table 1), HLA-B exon 2 sequences listed in the IMGT/HLA database (6) were analyzed in order to assure specificity for the HLA-B*51 amplification. It is important to highlight that HLA-B*51 and HLA-B*52 differ only in two amino acid substitutions at positions 63 and 67 of the protein, and primers should be carefully designed (14). HLA-B*51 forward primer anneals also to B*44:05 and B*78:01, with frequencies lower than 3% in Europe and Asia (15). HLA-B*51 reverse primer would also anneal to several subtypes of B*49, B*52, B*53, and B*57. However, the lack of specificity of both primers is never coincident, so when they were brought together in one reaction of PCR, specific amplification of HLA-B*51 was assured. The BLAST program (http://www.ncbi.nlm.nih.gov/tools/primer-blast) confirmed the primer specificity for the sequence of interest. These primers can specifically bind to almost all subtypes of HLA-B*51. However, there are some subtypes that are not recognized by these primers: none of them are found in European or Asiatic population, except for HLA-B*51:05 with a published frequency that in certain populations it is not negligible (15). Therefore, laboratories interested in amplifying 140
Real-time PCR was performed in 48-well reaction plates using GoTaq® qPCR Master Mix with BRYT Green® as intercalating dye (Promega). Multiplex PCR to amplify HLA-B*51 and internal control was optimized for several parameters, including primer concentration, number of PCR cycles, annealing temperature, and amount of DNA sample. Multiplex PCR was performed in a final volume of 10 μl. It consisted of 2× PCR Master Mix and 0.5 μM of forward and reverse HLA*B-51-specific primer and 0.3 μM of forward and reverse internal control primers (Invitrogen, Carlsbad, CA). A total of 15 ng of genomic DNA was added in each reaction. Final volume was adjusted with deionized water. PCR cycling parameters were as follows: initial denaturation at 95∘ C for 2 min, 35 cycles of denaturation at 95∘ C for 15 s, annealing at 67∘ C for 30 s, and the HRM analysis was performed following the amplifications by slow temperature increase from 65∘ C to 95∘ C at a ramp rate of 0.1∘ C. Normalized melting curves showed the fluorescence signal against the temperature, and derivative plots showed the melting temperature peaks. The melting curve yielded two peaks: one at 86∘ C that corresponded to the internal control amplification and another at 89∘ C corresponding to the specific amplification of HLA-B*51 (Figure 1). HRM analysis was performed using the Eco Real-Time PCR System (Illumina, San Diego, CA), and the complete run lasted 48 min. Method evaluation
We evaluated method accuracy (specificity, sensitivity, false positive, and false negative rate), repeatability, and method comparison according to recommendations by the Eurogentest Validation Group (16). All 61 samples and non-template controls were tested in duplicate in two different days. Genotyping calls were 100% concordant, and no discrepancies were observed: 15 samples resulted positive for HLA-B*51, whereas the remaining 46 resulted negative for HLA-B*51 (Figure 1). Hence, the method is 100% accurate, showing 100% sensitivity, 100% specificity, and 0% false positive and negative rate. To validate this method, we also performed a method in comparison with conventional PCR of all 61 samples to amplify HLA-B*51 using the same forward primer and a © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Tissue Antigens, 2015, 86, 139–142
C. Imperiali et al.
HLA-B*51 detection by HRM real-time PCR
Figure 1 Melt curve analysis of HLA-B*51 allele high-resolution melting (HRM). Black peaks correspond to two positive samples for HLA-B*51 (melting temperature at 86∘ C and 89∘ C), and gray peaks belong to two negative samples (melting temperature only at 86∘ C, corresponding to internal control amplification). Peaks are missing in the no-template control.
Conclusions
Figure 2 Photograph of ethidium bromide 1.5% agarose gel. Lanes 1 and 9: 50–700 base-pair DNA ladder, lanes 2, 3, and 4: positive samples for HLA-B*51; lanes 5, 6, and 7: negative samples for HLA-B*51, lane 8: non-template control.
Confirming a diagnosis of BD can be difficult because symptoms are wide ranging and are shared with other conditions. HLA-B*51 is the strongest risk factor of BD; therefore, development of efficient molecular techniques for the detection of this genotype in a patient who presents with symptoms suggestive of BD may be a reliable tool to classify the patient in a high or low risk of having the disease. HRM analysis is a powerful and affordable technique that exhibits high sensitivity and speed. In summary, we describe here a diagnostic assay which allows a rapid, easy, and inexpensive detection of HLA-B*51 for routine clinical testing.
Conflict of interest
The authors have declared no conflicting interests. new reverse primer that anneals to a region of the third exon (5′ -TCTTTGCCGTCGTAGGCGTA-3′ ). The PCR products were analyzed by electrophoresis and visualized on agarose gel. The presence of a 559 bp HLA-B*51-specific band along with 390 bp HFE internal control band, on the 1.5% agarose gel, was indicative of HLA-B* 51 positivity (Figure 2). No discrepancies were found between HRM and conventional PCR. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Tissue Antigens, 2015, 86, 139–142
References 1. International Team for the Revision of the International Criteria for Behçet’s Disease (ITR-ICBD). The International Criteria for Behçet’s Disease (ICBD): a collaborative study of 27 countries on the sensitivity and specificity of the new criteria. J Eur Acad Dermatol Venereol 2014: 28: 338–47.
141
HLA-B*51 detection by HRM real-time PCR
2. de Menthon M, Lavalley MP, Maldini C, Guillevin L, Mahr A. HLA-B51/B5 and the risk of Behçet’s disease: a systematic review and meta-analysis of case-control genetic association studies. Arthritis Rheum 2009: 61: 1287–96. 3. Graham R. HLA-B*51 the primary risk in Behçet disease. Proc Natl Acad Sci USA 2014: 111: 8706–7. 4. Mizuki N, Ota M, Katsuyama Y et al. Sequencing-based typing of HLA-B*51 alleles and the significant association of HLA-B*5101 and -B*5108 with Behçet’s disease in Greek patients. Tissue Antigens 2002: 59: 118–21. 5. Ombrello MJ, Kirino Y, de Bakker PI, Gül A, Kastner DL, Remmers EF. Behçet disease-associated MHC class I residues implicate antigen binding and regulation of cell-mediated cytotoxicity. Proc Natl Acad Sci USA 2014: 111: 8867–72. 6. IMGT/HLA Database (ImMunoGeneTics project/human major histocompatibility complex). Release 3.20.0, 2015-04-17: http://www.ebi.ac.uk/ipd/imgt/hla, Last accessed: 2015-05-30. 7. Sano K, Yabuki K, Imagawa Y et al. The absence of disease-specific polymorphisms within the HLA-B51 gene that is the susceptible locus for Behçet’s disease. Tissue Antigens 2001: 58: 77–82. 8. Demirseren DD, Ceylan GG, Akoglu G et al. HLA-B51 subtypes in Turkish patients with Behçet’s disease and their correlation with clinical manifestations. Genet Mol Res 2014: 13: 4788–96. 9. González-Escribano MF, Rodríguez MR, Walter K, Sánchez Román J, García-Lozano JR, Núñez-Roldán A. Association of HLA-B51 subtypes and Behcet’s disease in Spain. Tissue Antigens 1998: 52: 78–80.
142
C. Imperiali et al.
10. Bakir-Gungor B, Remmers EF, Meguro A et al. Identification of possible pathogenic pathways in Behçet’s disease using genome-wide association study data from two different populations. Eur J Hum Genet 2015: 23: 678–87. 11. Montes-Cano MA, Conde-Jaldón M, García-Lozano JR et al. HLA and non-HLA genes in Behçet’s disease: a multicentric study in the Spanish population. Arthritis Res Ther 2013: 15: R145. 12. Park Y, Kim YS, Kim SI, Kim H, Kim HS. Evaluation of sequence-specific priming and real-time polymerase chain reaction assays for detecting HLA-B*51 alleles confirmed by sequence-based typing. Tissue Antigens 2012: 80: 376–9. 13. Wang YS, Ma XL, Sun SH, Sun Y, Yu B. Development of an oligochip for genotyping human leukocyte antigen-B51 and its clinical application. Genet Test 2005: 9: 292–6. 14. Mizuki N, Ota M, Katsuyama Y et al. HLA-B*51 allele analysis by the PCR-SBT method and a strong association of HLA-B*5101 with Japanese patients with Behçet’s disease. Tissue Antigens 2001: 58: 181–4. 15. Gonzalez-Galarza FF, Christmas S, Middleton D, Jones AR. The Allele Frequency Net Database: a database and online repository for immune gene frequencies in worldwide populations. Nucleic Acid Res 2011: 39: D913–9. The Royal Liverpool and Broadgreen University Hospitals. http://www.allelefrequencies.net/hla6006a.asp. 16. Mattocks CJ, Morris MA, Matthijs G, A EuroGentest Validation Group et al. A standardized framework for the validation and verification of clinical molecular genetic tests. Eur J Hum Genet 2010: 18: 1276–88.
© 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Tissue Antigens, 2015, 86, 139–142
BRIEF COMMUNICATION
Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis C. Imperiali, P. Alía-Ramos & A. Padró-Miquel Genètica Molecular-Laboratori Clínic, Hospital Universitari de Bellvitge, L’Hospitalet de Llobregat, Catalonia, Spain
Key words Behçet disease; high-resolution melting assay; HLA-B*51; method; real-time PCR Correspondence Ariadna Padró-Miquel Genètica Molecular-Laboratori Clínic, Hospital Universitari de Bellvitge Feixa Llarga s/n, 08907 L’Hospitalet de Llobregat Catalonia Spain Tel: +34 93 260 75 43 Fax: +34 93 260 75 46 e-mail: [email protected] Received 26 January 2015; revised 30 May 2015; accepted 9 June 2015
Abstract HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget.
doi: 10.1111/tan.12603
Rapid detection of HLA-B*51 by high-resolution melting curve analysis
Behçet disease (BD) is a rare disorder that causes multisystemic inflammation of the blood vessels (1, 2). The prevalence of BD is higher in Europe and Asia and very rare in Africa, South-America, and Australia (3). Many studies have focused on elucidating the etiology of BD, but it remains unclear. There is evidence of a relationship between the onset of this disease and a genetic susceptibility of the patient together with environmental factors (4). The strongest known genetic risk factor for BD is the major histocompatibility complex class I allele HLA-B*51. The meta-analysis written by de Menthon et al. showed that the risk of HLA-B*51 carriers for developing BD is increased by a factor of 5.90 (95% confidence interval: 4.87–7.16) (2). Several case–control studies have also confirmed this relationship. Ombrello et al. for example, recently reported an odds ratio (OR) of 3.0 (P = 1.3 × 10−55 , n = 2447) (5). HLA-B*51 contains almost 200 suballeles (HLA-B*51:01–HLA-B*51:189) (6), with HLA-B*51:01 being the most frequent. It is suggested that the common motifs of the HLA-B*51 family such as 63-Asn and 67-Phe of the protein are involved in the susceptibility to BD, regardless of the suballeles. (7–9). Genome-wide association studies together with candidate genes approach strategies have identified several susceptibility © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Tissue Antigens, 2015, 86, 139–142
loci that may also be implicated in the pathophysiology of BD. Other HLA alleles and single-nucleotide polymorphisms were identified as independently associated with BD (10). However, the HLA-B*51 allele remained the primary risk factor of BD (5, 11). Several methods like sequence-based typing (4), sequence-specific priming (12), conventional polymerase chain reaction (PCR), direct sequencing, or reverse sequence-specific oligonucleotide hybridization are available for the detection of HLA genotypes (13). Besides, high-resolution melting (HRM) is an easy, fast, and inexpensive molecular method to analyze genetic variations in double-stranded PCR amplicons. It is based on the fact that ds DNA dissociates at different temperatures depending on the specific nucleotide composition. The reaction contains ds DNA-intercalating dyes that fluoresce brightly when they are bound to double-stranded DNA. The amplified ds DNA is subjected to a slow temperature ramp resulting in the dissociation of the two strands at the specific melting temperature. Real-time PCR instrumentation with precise temperature ramp control and advanced data capture capabilities together with a software designed specifically for HRM analysis allow the accuracy and reproducibility of this technique. This relatively new method is useful to test for HLA alleles. The aim of this study was to design and develop an HRM assay to identify the presence or absence of HLA-B*51 allele. 139
C. Imperiali et al.
HLA-B*51 detection by HRM real-time PCR
Table 1 Primers for multiplex PCR amplification and product length
Primer sequence (5′ –3′ ) HLA-B*51 forward HLA-B*51 reverse Internal forward HFE Internal reverse HFE
GGGGAGCCCCGCTTCATT TTGTAGTAGCGGAGCGCGA TGGCAAGGGTAAACAGATCC CTCAGGCACTCCTCTCAACC
PCR product length 206 bp 390 bp
HFE, human hemochromatosis protein gene; PCR, polymerase chain reaction.
HLA-B*51:05 on account of its prevalence in their geographical region should use allele-specific primers discriminating this subantigen. In addition, a primer pair was selected to operate as internal control for the amplification, especially when samples are negative for HLA-B*51 and specific primers do not anneal. All primers are listed in Table 1. Internal control primers anneal to the human hemochromatosis protein gene (HFE gene), in a non hot-spot locus. PCR and HRM curve analysis
Samples
Genomic DNA from 45 samples was extracted from ethylenediaminetetraacetic acid (EDTA)-anticoagulated peripheral blood using a commercial DNA purification kit (Maxwell 16 blood DNA prification kit, Promega, Madison, WI). From these samples, 25 had been genotyped for HLA-B*51 in a reference laboratory by sequence-specific oligonucleotide primed PCR: 8 resulted positive, and the remaining 17 were negative. Besides, to confirm primer specificity, we also tested 15 samples that were positive for HLA-B*57, and 5 that were positive for HLA-B*27. Additionally, we acquired 16 purified genomic DNA samples from the Cell Bank inventory of B-cell lines (International Histocompatibility Working Group): 7 positive samples with alleles HLA-B*51:01, *51:03, *51:06, and *51:09 and 9 negative samples with the following alleles: HLA-B*07, *15, *27, *35, *44, *45, *49, *52, *53, *57, and *78.
Primer design
Regarding the primer design (Table 1), HLA-B exon 2 sequences listed in the IMGT/HLA database (6) were analyzed in order to assure specificity for the HLA-B*51 amplification. It is important to highlight that HLA-B*51 and HLA-B*52 differ only in two amino acid substitutions at positions 63 and 67 of the protein, and primers should be carefully designed (14). HLA-B*51 forward primer anneals also to B*44:05 and B*78:01, with frequencies lower than 3% in Europe and Asia (15). HLA-B*51 reverse primer would also anneal to several subtypes of B*49, B*52, B*53, and B*57. However, the lack of specificity of both primers is never coincident, so when they were brought together in one reaction of PCR, specific amplification of HLA-B*51 was assured. The BLAST program (http://www.ncbi.nlm.nih.gov/tools/primer-blast) confirmed the primer specificity for the sequence of interest. These primers can specifically bind to almost all subtypes of HLA-B*51. However, there are some subtypes that are not recognized by these primers: none of them are found in European or Asiatic population, except for HLA-B*51:05 with a published frequency that in certain populations it is not negligible (15). Therefore, laboratories interested in amplifying 140
Real-time PCR was performed in 48-well reaction plates using GoTaq® qPCR Master Mix with BRYT Green® as intercalating dye (Promega). Multiplex PCR to amplify HLA-B*51 and internal control was optimized for several parameters, including primer concentration, number of PCR cycles, annealing temperature, and amount of DNA sample. Multiplex PCR was performed in a final volume of 10 μl. It consisted of 2× PCR Master Mix and 0.5 μM of forward and reverse HLA*B-51-specific primer and 0.3 μM of forward and reverse internal control primers (Invitrogen, Carlsbad, CA). A total of 15 ng of genomic DNA was added in each reaction. Final volume was adjusted with deionized water. PCR cycling parameters were as follows: initial denaturation at 95∘ C for 2 min, 35 cycles of denaturation at 95∘ C for 15 s, annealing at 67∘ C for 30 s, and the HRM analysis was performed following the amplifications by slow temperature increase from 65∘ C to 95∘ C at a ramp rate of 0.1∘ C. Normalized melting curves showed the fluorescence signal against the temperature, and derivative plots showed the melting temperature peaks. The melting curve yielded two peaks: one at 86∘ C that corresponded to the internal control amplification and another at 89∘ C corresponding to the specific amplification of HLA-B*51 (Figure 1). HRM analysis was performed using the Eco Real-Time PCR System (Illumina, San Diego, CA), and the complete run lasted 48 min. Method evaluation
We evaluated method accuracy (specificity, sensitivity, false positive, and false negative rate), repeatability, and method comparison according to recommendations by the Eurogentest Validation Group (16). All 61 samples and non-template controls were tested in duplicate in two different days. Genotyping calls were 100% concordant, and no discrepancies were observed: 15 samples resulted positive for HLA-B*51, whereas the remaining 46 resulted negative for HLA-B*51 (Figure 1). Hence, the method is 100% accurate, showing 100% sensitivity, 100% specificity, and 0% false positive and negative rate. To validate this method, we also performed a method in comparison with conventional PCR of all 61 samples to amplify HLA-B*51 using the same forward primer and a © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Tissue Antigens, 2015, 86, 139–142
C. Imperiali et al.
HLA-B*51 detection by HRM real-time PCR
Figure 1 Melt curve analysis of HLA-B*51 allele high-resolution melting (HRM). Black peaks correspond to two positive samples for HLA-B*51 (melting temperature at 86∘ C and 89∘ C), and gray peaks belong to two negative samples (melting temperature only at 86∘ C, corresponding to internal control amplification). Peaks are missing in the no-template control.
Conclusions
Figure 2 Photograph of ethidium bromide 1.5% agarose gel. Lanes 1 and 9: 50–700 base-pair DNA ladder, lanes 2, 3, and 4: positive samples for HLA-B*51; lanes 5, 6, and 7: negative samples for HLA-B*51, lane 8: non-template control.
Confirming a diagnosis of BD can be difficult because symptoms are wide ranging and are shared with other conditions. HLA-B*51 is the strongest risk factor of BD; therefore, development of efficient molecular techniques for the detection of this genotype in a patient who presents with symptoms suggestive of BD may be a reliable tool to classify the patient in a high or low risk of having the disease. HRM analysis is a powerful and affordable technique that exhibits high sensitivity and speed. In summary, we describe here a diagnostic assay which allows a rapid, easy, and inexpensive detection of HLA-B*51 for routine clinical testing.
Conflict of interest
The authors have declared no conflicting interests. new reverse primer that anneals to a region of the third exon (5′ -TCTTTGCCGTCGTAGGCGTA-3′ ). The PCR products were analyzed by electrophoresis and visualized on agarose gel. The presence of a 559 bp HLA-B*51-specific band along with 390 bp HFE internal control band, on the 1.5% agarose gel, was indicative of HLA-B* 51 positivity (Figure 2). No discrepancies were found between HRM and conventional PCR. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Tissue Antigens, 2015, 86, 139–142
References 1. International Team for the Revision of the International Criteria for Behçet’s Disease (ITR-ICBD). The International Criteria for Behçet’s Disease (ICBD): a collaborative study of 27 countries on the sensitivity and specificity of the new criteria. J Eur Acad Dermatol Venereol 2014: 28: 338–47.
141
HLA-B*51 detection by HRM real-time PCR
2. de Menthon M, Lavalley MP, Maldini C, Guillevin L, Mahr A. HLA-B51/B5 and the risk of Behçet’s disease: a systematic review and meta-analysis of case-control genetic association studies. Arthritis Rheum 2009: 61: 1287–96. 3. Graham R. HLA-B*51 the primary risk in Behçet disease. Proc Natl Acad Sci USA 2014: 111: 8706–7. 4. Mizuki N, Ota M, Katsuyama Y et al. Sequencing-based typing of HLA-B*51 alleles and the significant association of HLA-B*5101 and -B*5108 with Behçet’s disease in Greek patients. Tissue Antigens 2002: 59: 118–21. 5. Ombrello MJ, Kirino Y, de Bakker PI, Gül A, Kastner DL, Remmers EF. Behçet disease-associated MHC class I residues implicate antigen binding and regulation of cell-mediated cytotoxicity. Proc Natl Acad Sci USA 2014: 111: 8867–72. 6. IMGT/HLA Database (ImMunoGeneTics project/human major histocompatibility complex). Release 3.20.0, 2015-04-17: http://www.ebi.ac.uk/ipd/imgt/hla, Last accessed: 2015-05-30. 7. Sano K, Yabuki K, Imagawa Y et al. The absence of disease-specific polymorphisms within the HLA-B51 gene that is the susceptible locus for Behçet’s disease. Tissue Antigens 2001: 58: 77–82. 8. Demirseren DD, Ceylan GG, Akoglu G et al. HLA-B51 subtypes in Turkish patients with Behçet’s disease and their correlation with clinical manifestations. Genet Mol Res 2014: 13: 4788–96. 9. González-Escribano MF, Rodríguez MR, Walter K, Sánchez Román J, García-Lozano JR, Núñez-Roldán A. Association of HLA-B51 subtypes and Behcet’s disease in Spain. Tissue Antigens 1998: 52: 78–80.
142
C. Imperiali et al.
10. Bakir-Gungor B, Remmers EF, Meguro A et al. Identification of possible pathogenic pathways in Behçet’s disease using genome-wide association study data from two different populations. Eur J Hum Genet 2015: 23: 678–87. 11. Montes-Cano MA, Conde-Jaldón M, García-Lozano JR et al. HLA and non-HLA genes in Behçet’s disease: a multicentric study in the Spanish population. Arthritis Res Ther 2013: 15: R145. 12. Park Y, Kim YS, Kim SI, Kim H, Kim HS. Evaluation of sequence-specific priming and real-time polymerase chain reaction assays for detecting HLA-B*51 alleles confirmed by sequence-based typing. Tissue Antigens 2012: 80: 376–9. 13. Wang YS, Ma XL, Sun SH, Sun Y, Yu B. Development of an oligochip for genotyping human leukocyte antigen-B51 and its clinical application. Genet Test 2005: 9: 292–6. 14. Mizuki N, Ota M, Katsuyama Y et al. HLA-B*51 allele analysis by the PCR-SBT method and a strong association of HLA-B*5101 with Japanese patients with Behçet’s disease. Tissue Antigens 2001: 58: 181–4. 15. Gonzalez-Galarza FF, Christmas S, Middleton D, Jones AR. The Allele Frequency Net Database: a database and online repository for immune gene frequencies in worldwide populations. Nucleic Acid Res 2011: 39: D913–9. The Royal Liverpool and Broadgreen University Hospitals. http://www.allelefrequencies.net/hla6006a.asp. 16. Mattocks CJ, Morris MA, Matthijs G, A EuroGentest Validation Group et al. A standardized framework for the validation and verification of clinical molecular genetic tests. Eur J Hum Genet 2010: 18: 1276–88.
© 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd Tissue Antigens, 2015, 86, 139–142
