Am. J. Hum. Genet. 51:508-515, 1992

Osteogensis Imperfecta Type I Is Commonly Due to Null Allele of Type I Collagen

a

COLIAI

Marcia C. Willing,* Charles J. Pruchno,t Mary Atkinson,$ and Peter H. Byerst Departments of *Pediatrics and Tinternal Medicine, University of for Inherited Diseases, University of Washington, Seattle

Iowa, Iowa

City; and tDepartments of Pathology and Medicine, and Center

Summary Dermal fibroblasts from most individuals with osteogenesis imperfecta (01) type I produce about half the normal amount of type I procollagen, as a result of decreased synthesis of one of its constituent chains, proal(I). To test the hypothesis that decreased synthesis of proa(I) chains results from mutations in the COLlAl gene, we used primer extension with nucleotide-specific chain termination to measure the contribution of individual COLlA1 alleles to the mRNA pool in fibroblasts from affected individuals. A polymorphic MnnI restriction endonuclease site in the 3'-untranslated region of COLlAl was used to distinguish the transcripts of the two alleles in heterozygous individuals. Twenty-three individuals from 21 unrelated families were studied. In each case there was marked diminution in steady-state mRNA levels from one COLlAl allele. Loss of an allele through deletion or rearrangement was not the cause of the diminished COLlA1 mRNA levels. Primer extension with nucleotide-specific chain termination allows identification of the mutant COLlAl allele in cell strains that are heterozygous for an expressed polymorphism. It is applicable to sporadic cases, to small families, and to large families in whom key individuals are uninformative at the polymorphic sites used in linkage analysis, making it a useful adjunct to the biochemical screening of collagenous proteins for 01.

Introduction

Osteogensis imperfecta (01) type I is characterized by autosomal dominant inheritance, bone fragility with little or no deformity, normal or near-normal stature, osteopenia, and blue sclerae. Progressive hearing loss is seen in about half the families, while dentinogenesis imperfecta is less common (Sillence et al. 1979). Unlike the lethal and deforming varieties of 01, which result from mutations that alter the structure of the type I collagen molecule, the 01 type I phenotype usually results from mutations that affect type I collagen production (Sykes et al. 1977; Barsh et al. 1982; Byers et al. 1983; Rowe et al. 1985; Wenstrup et al. 1990; Willing et al. 1990a). The mechanisms by which synReceived February 10, 1992; revision received April 14, 1992. Address for correspondence and reprints: Marcia C. Willing, M.D., Ph.D., Department of Pediatrics, Division of Medical Genetics 2JCP, University of Iowa, Iowa City, IA 52242. © 1992 by The American Society of Human Genetics. All rights reserved. 0002-9297/92/5103-0007$02.00

508

thesis is altered have been difficult to identify. We and others previously suggested that mutations that reduce expression of the COLlA1 gene would result in this phenotype (Barsh et al. 1982; Genovese and Rowe 1987; Willing et al. 1990a). Support for this hypothesis comes from several lines of evidence. Dermal fibroblasts from most affected individuals produce and efficiently secrete about half the usual amount of structurally normal type I procollagen (Barsh et al. 1982; Rowe et al. 1985; Wenstrup et al. 1990; Willing et al. 1990a, 1990b). Studies by Barsh et al. (1982) and Willing et al. (1990a, 1990b) indicate that the altered type I collagen production usually results from decreased synthesis of the proctl(I) chain of type I procollagen. In short-term labeling experiments using 01 fibroblasts, the proal(I):proa2(I) synthetic ratio was closer to 1:1 than to the 2:1 ratio seen in control cells (Barsh et al. 1982; Willing et al. 1990b). RNA steadystate measurements demonstrated that the decreased proal(I) production reflected a reduction in steadystate COLlA1 mRNA levels (Rowe et al. 1985; Geno-

Osteogenesis Imperfecta Type I vese and Rowe 1987). Demonstrated linkage of the 01 type I phenotype to the COLlAl locus argued that mutations in the COLlAl gene, rather than transacting loci, were the cause of the 01 type I phenotype (Sykes et al. 1986, 1990). In the present study, we used primer extension with nucleotide-specific chain termination (Daar and Maquat 1988; Driscoll et al. 1989) to quantitate the contribution of each COLlAl allele to the total cellular RNA pool of cells from individuals with 01 type I. We used a polymorphic Mn/I restriction site in the 3' untranslated region of the COLlAl gene (Westerhausen et al. 1990; Willing et al. 1990a) to distinguish the transcripts of the two COLlAl alleles in heterozygous individuals. Of 70 individuals with 01 type, 23 were heterozygous at the COLlAl polymorphic Mn/I site. In each instance, one COLlAl allele produced almost no detectable mRNA. Gene copy number and structure were normal in those examined, suggesting that either loss of an entire allele or large stuctural rearrangements rarely are responsible for the 01 type I phenotype. Instead, a variety of other mechanisms that result in decreased steady-state levels of COLlAl mRNA most likely account for the decreased type I procollagen production that is the hallmark of 01 type I cell strains. Material and Methods

Selection of Cell Strains for Inclusion in the Study Cultured cells from 70 01 type I individuals representing 52 families were included in the study. Typical of virtually all OI type I cell strains, these cells produced less than the normal amount of type I procollagen (Wenstrup et al. 1990). All participants met the Sillence clinical criteria for 01 type I (Sillence et al. 1979). Some were examined by one of the authors (P.H.B. or M.C.W.), while the remaining participants were examined by another medical geneticist, and their cells were provided for collagen analysis. Cells

from unaffected family members and from unrelated healthy individuals served as controls. Cell Culture and Electrophoretic Analysis of Collagenous Proteins

Cultured dermal fibroblasts, either derived from skin biopsies taken by one of the authors or received from referring physicians, were grown in DulbeccoVogt modified Eagle's medium (DME) that contained 10% FCS, 100 U of penicillin/ml, and 100 tg of strep-

509

tomycin/ml. [3H]proline-labeled procollagens were prepared, harvested, and analyzed by SDS-PAGE as described elsewhere (Bonadio and Byers 1985; Bonadio et al. 1985). Collagen a chains were prepared by partial proteolysis of [3H]proline-labeled procollagen with pepsin. Proa and a chains were detected after electrophoresis, by radioautofluorography using EN3HANCE (DuPont-New England Nuclear) as the fluor. PCR Amplification of Genomic DNA Genomic DNA isolated either from cultured dermal fibroblasts or from white blood cells served as the template for PCR amplification (Saiki et al. 1988). For

amplification reactions, 150 ng of each oligonucleotide primer and conditions specified in the Perkin Elmer Cetus DNA amplification kit (Perkin Elmer Cetus) were used, except that each deoxynucleotide triphosphate was used at a final concetration of 400 gM, and triton X100 (final vol 0.1%) was added to the reaction mix. COLlAl oligonucleotide primers were designed to amplify either a polymorphic MnlI site at the 3' end of COLlAl or a polymorphic RsaI site located in intron S of the COLlA1 gene. The sequence for these primers was derived from Willing et al. (1 990a) (Mn/I site) and from D'Alessio et al. (1988) (RsaI site). For amplification across the COLlAl polymorphic Mn/I site, the upstream primer was identical to sequences in exon 52-5' ACGTTGGTGCCCCAGACCAGGAAT 3'-and the downstream primer was complementary to sequences in the untranslated region-S' TTCTGCAGTCCATGTGAAATTGTCTCCCA 3'. Primers used to amplify across the COLlAl polymorphic RsaI site in intron S were 5' CAAGAGCATTCTCTTAACTGACCT 3' and 5' TCCTGGACTGGATCCCAGATTGGG 3' (for location, see Pruchno et al. 1991). The primers used to amplify across a polymorphic PvuII restriction site in exon 25 of COL1A2 (Kuivaniemi et al. 198 8) were 5' GGAAATATCGGCCCCGCTGGAAA 3' (exon 24) and 5' GTCCAGGGAATCCAATGTTGCCA 3' (exon 25). Restriction-Endonuclease Analysis of Amplified Genomic DNA Twenty- to forty-microliter aliquots of the total 100 gl of amplified genomic DNA were cleaved with the appropriate enzyme, according to the manufacturer's (New England Biolabs) specifications; the products were precipitated with ethanol, concentrated into a

Willing et al.

510 20 Rl volume, separated by electrophoresis in a 6% polyacrylamide urea gel, and identified by ethidium bromide staining. Primer Extension with Nucleotide-specific Chain Termination For primer extension at the polymorphic MnlI restriction site, primer 5' AGTCCATGTGAAATTGTCTCCCA 3', which was complementary to sequences immediately downstream of the polymorphic site, was used. For primer extension across the polymorphic

COL1A2 PvuII site in exon 25, primer 5' GCCAGGCTCTCCTCTTGCT 3' was used. Ten micrograms of each primer was separately end-labeled with [32P]yATP (Amersham) by using T4 polynucleotide kinase (United States Biochemical) according to the manufacturer's specifications. Endlabeled reaction products were separated on a 15% sequencing gel, identified by autoradiography, and eluted into 100 pl of water. One microliter of the appropriate end-labeled primer was precipitated with total fibroblast RNA that had been isolated by the procedure of Chomczynski and Sacchi (1987). After one phenol and one chloroform extraction, cDNA synthesis was carried out with 3 units of reverse transcriptase (United States Biochemical) per reaction in the presence of 1 mmol of each deoxynucleotide, except that dideoxyadenosine was substituted for identification of the COL1A1 MnlI site and dideoxythymidine was used to identify the COL1A2 PvuII site.

Reaction products were separated by electophoresis on a 15% sequencing gel, identified by autoradiography, and quantitated both by inspection and by direct measurement of 32[p] signal. Analysis of COL IA I Gene Structure and Allele Copy Number

Genomic DNA prepared from white blood cells or from cultured dermal fibroblasts was digested separately with EcoRI and/or HindI11 or BamHI (New England Biolabs) according to the manufacturer's specifications. Fragments were separated by gel electrophoresis in 0.8% agarose and transferred to nytran (Southern 1975). Filters were hybridized separately either with a full-length COLlAl cDNA or with Hf677, a partial COLlA1 cDNA fragment (Chu et al. 1982). To assess relative COLlA1 and COL1A2 allele copy number, filters of EcoRI and HindIII digests were hybridized with one of two sets of genomic probes, either a 5.7-kb HindIII COLlA1 genomic fragment and a 4.3-kb HindIII COL1A2 genomic fragment or a 5-kb BamHI COLlA1 genomic fragment and a 4.1-kb EcoRI COL1 A2 genomic fragment. For each Southern (1975) analysis, the hybridization probes identified a single COLlAl or COL1A2 fragment of similar size. Visual inspection and densitometric analysis of autoradiographs were used to assess allele copy number. All COLlAl genomic fragments were isolates of the cosmid clone CG103 (Barsh et al. 1984), while the COL1A2 genomic fragments were derived from the

Cells

Medium

procxl(II I)-\ proal(l)proa2(I)FC-

C I-

01

[3H]Proline-labeled proa chains produced by dermal fibroblasts from unrelated individuals with 01 type I1(01) and control Figure I (C). Dermal fibroblasts from affected individuals produce less type I procollagen than the control and have a procal(I):procal(III) ratio of 1:1, compared with the typical 3:1 ratio seen in normal cells.

Osteogenesis Imperfecta Type I cloned normal allele of a patient with a large COL1A2 genomic deletion (Willing et al. 1988). Hybridization probes were labeled with a [32P]dCTP and a[32P]dTTP (New England Nuclear) by random primer extension (Feinberg and Vogelstein 1984).

511 A

COL1Al: MnII (P )

(+)

Results Dermal Fibroblasts from O0 Type I Individuals Produce Decreased Amounts of Type I Collagen

We analyzed [3H] proline-labeled procollagens produced by dermal fibroblasts from each of 70 affected individuals and from unaffected controls, by SDSPAGE (fig. 1). Each 01 cell strain produced about half the expected amount of type I procollagen. For 68 of the 70 affected individuals, there was no evidence either of excessive posttranslational lysyl hydroxylation or hydroxylysyl glycosylation or of intracellular accumulation of abnormal molecules, as is typically seen in more severe forms of 01 (reviewed in Byers 1989; Wenstrup et al. 1990). In cell strains from two affected members of the same family, a small amount of a shortened (because of an exon-skipping mutation) proal(I) chain was retained within the cell layer (C. J. Pruchno and P. H. Byers, personal communication). These samples were included in the analysis. mRNA Is Derived Principally from One COL IAI Allele

To examine the relative contribution of each COLlA1 allele to the total mRNA pool, we took advantage of a polymorphic MnlI restriction site in the 3' untranslated region of the COLlA1 gene. Twentythree of 70 01 type I cell strains were heterozygous at this polymorphic site. These 23 cell strains represented 21 unrelated families. RNA from each control cell strain (three unaffected members of three different 01 families and four unrelated individuals from two different Alport syndrome families) directed the synthesis of two different COLlA1 cDNA fragments, one representing the MnlI ( + ) allele (1 5-bp extension) and the other representing the MnlI ( - ) allele (24-bp extension) (fig. 2). Autoradiographic signals derived from the two cDNA fragments were of equal intensity (confirmed by measurement of radioactivity in each band) and indicated that the COLlA1 alleles contributed about equally to the total mRNA pool. In contrast, RNA from all 23 01 cell strains directed the synthesis primarily of one COLlA1 cDNA species. In some cases, extended periods of exposure to film were necessary to detect the product from the mutant allele

PrimerI i

ic

of

134

FCA

B EXON 52 MnU (+) 5' TGAACCCCCTAAAAGCCAAAAAATGGGAGACAATTTCACATOGAC A

--CCCTCTGTTAAAGTGTACCTG]*

A 5'

ICCTQGTTAAAGTGTACCTGI

TOAACCCCCAAAGCCAAAAAATGOAGACAATTTCACATGGAC

3' 5' 5'

3'

WIT (-)

Figure 2 Primer extension with nucleotide-specific chain termination at the COLlA1 MnnI polymorphic site. A, mRNA from control cells (C), which directs the synthesis of about equal quantities of cDNA derived from COLlAl MnlI (+) and (-) alleles. In contrast, mRNA from 01 cells (01) directs the synthesis of primarily one cDNA species. The individual represented in lane 1 has little steady-state mRNA derived from the MnlI (+) allele. Individuals represented in lanes 2 and 3 are from the same family. Both have little steady-state mRNA present from the MnlI ( - ) allele. B, Schematic of the primer extension reaction. The primer sequence is enclosed by boxes, while the asterisk (*) indicates the primer end that was labeled with 32 [P]yATP. The location of the polymorphic MnII site in exon 52 and the nucleotide sequence difference between an MnlI (+) and (-) allele is shown by the solid bar below the sequence. cDNA synthesis proceeds in the direction indicated by the arrows until terminations (A) are reached 15 nt upstream of the primer in the MnlI ( + ) allele and 24 nt away in the Mn1I ( - ) allele.

(fig. 2). In 10 cell strains the MnlI (+) mRNA was reduced, while in 13 the MnlI (-) mRNA was reduced. To be sure that primer extension did not identify a generalized alteration in collagen mRNA processing, we measured the contribution of the two COL1A2 alleles to the mRNA pool. Of the 23 COLlA1 MnlI heterozygotes, 8 were heterozygous for a polymorphic PvuII restriction site in exon 25 of the COL1A2 gene (Kuivaniemi et al. 1988; Constantinou et al. 1990). In each instance, equal amounts of PvuII ( + ) and PvuII (-) mRNA were present (fig. 3). Twenty-two of the 47 COLlA1 MnlI homozygotes were heterozygous at the COL1A2 PvuII site, and RNA from 18 of them was available for primer extension. In each case, equal quantities of mRNA from the PvuII ( + ) and ( - ) al-

Willing et al.

512 Table I

COL1A2: Pvull

A

COLIAI Allele Copy Number Determined by Heterozygosity for the Presence of Polymorphic Rsal and Mnil Sites or Southern Blot Analysis

ALLELE CoPY NUMBER, BY RsaI

Primer-

MnIl

A

B

A

B

A

B

+/+... ... + /-

10 6 2

2 7 2

14 4 0

12 6 3

2 0 0

0 0 0

-/- ...

1

2 3 4 01 I-C-

B

PNu (+) EXON 25 5' ATTGGCC AGCTOGAGCAAGAGGAGAGCCTGGC

5'

T. -

IT

TTCTCCTCTCGGACCG*

-TCGTTCTCCTCTCGGACCG ATTGGCCCCSCM IGAGCAAGAGGAGAGCCTGGC T-

3'

3'

3' 3'

PNll (-)

Primer extension with nucleotide-specific chain terFigure 3 mination at the COL1A2 PvuII polymorphic site. A, mRNA from control (C) and 01 cells, which directs the synthesis of equal quantities of cDNA derived from the COL1A2 PvuII ( + ) and ( ) alleles. 01 samples 1, 2, and 3 correspond to those represented in fig. 1. B, Schematic of the primer extension reaction. Symbols are as indicated in fig. 1, except that the solid bar indicates the PvuII polymorphic site in exon 25 of COL1A2. T = Termination of cDNA synthesis.

-/-

+/-

+/+

(+)

NOTE. -In columns A, the normal gene structure and/or copy number was determined by Southern blot. In columns B, Southern blot was not done. Four individuals had evidence of two copies of the COL1A1 gene, by three criteria (RsaI + / -, MnlI + / -, and blot); 26 had evidence of two copies, by two criteria (6 by Rsa + / and Mnl + / -; 14 by Rsa + / - and blot; and 6 by MnlI + / - and blot); 36 had evidence of two copies, by a single criterion (15 by RsaI + / - ; 7 by MnlI + / - ; and 14 by blot), and in four individuals gene copy number could not be confirmed. Of the four in whom gene copy number could not be confirmed, three came from families in which at least one other member was heterozygous at one marker. Two of the three were family members of MnlI heterzygotes who were studied by primer extension. Thus, only 1 individual of the 70 represented in this table could not be confirmed to have two copies of the COLlA1 gene.

-

observed (data not shown). Thus, while of the detectable COLlA1 mRNA within these cells was derived from one allele, the two COL1A2 alleles contributed equally to the total mRNA pool.

leles

were

most

COL IA I Allele Deletion Does Not Explain Decreased mRNA Levels

We documented the presence of two COLlA1 alleles in 69 of the 70 01 type I cell strains, using either Southern analysis of genomic DNA or restrictionendonuclease analysis of amplified COLlA1 sequences known to contain polymorphic restriction sites (table 1). Heterozygosity at the intragenic polymorphic MnlI or RsaI sites confirmed that two COLlA1 alleles were present (at least at that region of the gene) in 52 individuals (23 MnlI heterozygotes and 29 RsaI heterozygotes). Ten of the 52 were heterozygous for both polymorphic sites. Of the 23 MnlI heterozygotes, 16 had independent confirmation of the presence of two COLlA1 alleles, by Southern

analysis and/or by identification of heterozygosity at the intragenic COLlA1 polymorphic RsaI site (table 1). These data indicate that loss of an allele is not the explanation for the diminished contribution of one COLlA1 allele to the total mRNA pool in most 01 type I cell strains. Discussion

Although more than 70 mutations that result in lethal or deforming varieties of 01 have been identified (Byers et al. 1991; Kuivaniemi et al. 1991). The molecular basis of the mild dominantly inherited form of 01 has remained elusive. Structural alterations within or near the triple-helical coding domain of collagen chains appear to be rare causes of the phenotype (Nicholls and Pope 1984; Cohn et al. 1988; Starman et al. 1989). Studies by Barsh et al. (1982) suggested that decreased synthesis of type I collagen, characteristic of cells from individuals with 01 type I, reflects the diminished production of proal(I) chains. Rowe et al. (1985) and Genovese and Rowe (1987) implicated decreased production of proal (I) mRNA as the source of decreased proal (I) chain synthesis. Previous studies

Osteogenesis Imperfecta Type I

demonstrated linkage of the 01 type I phenotype to polymorphic sites in COLlAl and COL1A2 in different families (Tsipouras et al. 1984; Falk et al. 1986; Sykes et al. 1986, 1990; Wallis et al. 1986). In those studies the Sillence (1979) criteria were used to classify families, but no information on the synthesis and secretion of type I collagen was included, making it difficult to determine whether families had a homogeneous biochemical phenotype. Our studies have now made it clear that in most 01 type I cell strains the defect lies in one COLlAl allele. While we were able to identify the mutant COLlAl allele in all 23 cell strains heterozygous for the MnlI polymorphic site, we have so far identified the causative mutation in only one family. In that family, a father and son have a point mutation (A to G) in the obligatory splice site at the 3' end of intron 16 of the COLlAl gene, which results in the skipping of exon 17 in the mRNA. The shortened proal(I) chain that results is present in very small quantities, presumably because the abnormal mRNA represents only 10% of the total COLlAl mRNA (C. J. Pruchno and P. H. Byers, personal communication). The mechanisms by which COLlAl mutations effect a reduction in proa(I) chain synthesis are likely to be heterogeneous. Deletion of an allele, promoter or enhancer mutations, production of an unstable mRNA that is degraded in the nucleus, or aberrant mRNA transport from the nucleus to the cytoplasm could lead to decreased COLlA1 mRNA from one allele. Direct support for inferring that a block at the level of transcription is a mechanism for effecting a decrease in type I collagen production comes from work on Mov-13 mice that have a Moloney murine leukemia proviral insertion in the first intron of one COLlAl allele (Bonadio et al. 1990). Our data suggest that large deletions that result in functional loss of one allele are uncommon causes of the phenotype. Furthermore, analysis of the COLlAl promoter region by base mismatch chemical cleavage (Cotton et al. 1988) and by denaturing gradient gel electrophoresis (Myers et al. 1985; Sheffield et al. 1989) has detected only one potentially relevant mismatch (M. C. Willing and P. H. Byers, unpublished observations). Other COLlAl mutations that might not result in decreased mRNA from one allele but that could result in reduced proa(I) chain synthesis include premature termination of translation or mutations in COLlA1 that prevent assembly of heterotrimers. We previously identified a family in which affected mem-

513 bers have a 5-bp deletion in one COLlAl allele, which creates a translational frameshift and leads to an unstable elongated proal (I) chain (Willing et al. 1990a). In cells from those affected family members the steady-state levels of mRNA from the mutant COLlAl allele appear to be near normal. The observed reduction in type I procollagen production reflects destruction, at the protein level, of an unstable proal (I) chain that, because of its carboxyl-terminal extension, does not participate in heterotrimer assembly. Of the mutations that could lead to decreased production of type I procollagen, those that result in marked diminution of steady-state mRNA from one COLlAl allele seem to be the common molecular causes of OI type I. Primer extension with nucleotide-specific chain termination is an efficient and simple means to distinguish between COLlAl and COL1A2 as the candidate collagen gene responsible for OI type I, when the COLlAl alleles can be distinguished and the relative expression of two alleles differs. In this circumstance it identifies the mutant allele in each cell strain examined that is heterozygous for the expressed polymorphism. The technique is applicable to sporadic cases, to small families, and to large families in which the key individuals are uninformative for the available polymorphic markers used in segregation analysis. For this reason, it is likely to be a helpful adjunct to the biochemical screening of collagenous proteins for diagnosis of 01. It also has the potential to be useful for those families seeking prenatal diagnosis, in whom segregation analysis does not permit exclusion of either COLlAl or COL1A2 or in whom the parent is the first affected family member with 01. The two drawbacks of the technique are the requirement of heterozygosity for an expressed polymorphism and access to tissue in which the mutant gene is expressed. The first problem will become less relevant as additional polymorphisms are identified. From an etiologic standpoint, the primer extension assay should help to group OI type I cell strains into likely mutation categories and provide a rational approach to screening for mutations. It is clear that, in designing screening strategies, any attempt at mutation identification must take into account the small amount of detectable mRNA from the mutant allele. Approaches based on direct or indirect mRNA analysis, which have proved useful in detecting mutations in deforming varieties of 01 (Pruchno et al. 1991), are likely to be less helpful in identifying the etiology of 01 type I.

514

Acknowledgments We thank Laura Suesserman, Kathleen Braun, and Sachi Shridharani for their excellent technical assistance; Dr. Francesco Ramirez for providing us with the full-length COLlAl cDNA probe; and the numerous physicians for the patient referrals that made this study possible. This work was supported in part by March of Dimes Birth Defects Foundation grant 5-819, by an Arthritis Investigator Award from the Arthritis Foundation, and by National Institutes of Health grants AR 21557, AR 41223, and DK 07467.

References Barsh GS, David KE, Byers PH (1982) Type I osteogenesis imperfecta: a nonfunctional allele for proal(I) chains of type I procollagen. Proc Natl Acad Sci USA 79:38383842 Barsh GS, Roush L, Gelinas RE (1984) DNA and chromatin structure of the human al(I) collagen gene. J Biol Chem 259:14906-14913 BonadioJ, Byers P (1985) Subtle structural alterations in the chains of type I collagen.produce osteogenesis imperfecta type II. Nature 316:363-366 Bonadio J, Holbrook K, Gelinas R, Jacob J, Byers P (1985) Altered triple helical structure of type I procollagen is associated with prolonged survival in lethal perinatal osteogenesis imperfecta. J Biol Chem 260:1734-1742 BonadioJ, Saunders T, Tsai E, Goldstein S, Morris-Wiman, J, Brinkley L, Dolan D, et al (1990) Transgenic mouse model of the mild dominant form of osteogenesis imperfecta. Proc Natl Acad Sci USA 87:7145-7149 Byers PH (1989) Disorders of collagen biosynthesis and structure. In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds) The metabolic basis of inherited disease. McGrawHill, New York, pp 2805-2842 Byers PH, Shapiro JR, Rowe DW, David KE, Holbrook KA (1983) Abnormal a2-chain in type I collagen from a patient with a form of osteogenesis imperfecta. J Clin Invest 71:689-697 Byers PH, Wallis GA, Willing MC (1991) Osteogenesis imperfecta: translation of mutation to phenotype. J Med Genet 28:433-442 Chomczynski P, Sacchi N (1987) Single-step method for RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal Biochem 162:156-159 Chu M-L, Myers JC, Bernard MP, Ding J-F, Ramirez F (1982) Cloning and characterization of five overlapping cDNAs specific for the human proal(I) collagen chain. Nucleic Acids Res 10:5925-5934 Cohn DH, Apone S, Eyre DR, Starman BJ, Andreassen P, Charbonneau H, Nicholls AC, et al (1988) Substitution of cysteine for glycine within the carboxyl-terminal telopeptide of the a(I) chain of type I collagen produces mild osteogenesis imperfecta. J Biol Chem 263:14605-14607

Willing et al. Constantinou CD, Spotila LD, ZhuangJ, Sereda L, Hanning C, Prockop D (1990) PvuII polymorphism at the COL1A2 locus. Nucleic Acids Res 18:5577 Cotton RGH, Rodrigues NR, Campbell RD (1988) Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations. Proc Natl Acad Sci USA 85:4397-4401 Daar IO, Maquat LE (1988) Premature translation mediates triosephosphate isomerase mRNA degradation. Mol Cell Biol 8:802-813 D'Alessio M, Bernard M, Pretorious P, de Wet W, Ramirez F (1988) Complete nucleotide sequence of the region encompassing the first twenty-five exons of the human proal(1) collagen gene (COLlAl). Gene 67:105-115 Driscoll DM, Wynne JK, Wallis SC, Scott J (1989) An in vitro system for the editing of apolipoprotein B mRNA. Cell 58:519-525 Falk CT, Schwartz RC, Ramirez F, Tsipouras P (1986) Use of molecular haplotypes specific for the human proa2(I) collagen gene in linkage analysis of the mild autosomal dominant forms of osteogenesis imperfecta. Am J Hum Genet 38:269-279 Feinberg A, Vogelstein B (1984) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 137:266-267 Genovese C, Rowe (1987) Analysis of cytoplasmic and nuclear messenger RNA in fibroblasts from patients with type I osteogenesis imperfecta. Methods Enzymol 145: 223-235 Kuivaniemi H, Tromp G, Chu M-L, Prockop D (1988) Structure of a full-length cDNA clone for the preproa2(I) chain of human type I procollagen. Biochem J 252:633640 Kuivaniemi H, Tromp G, Prockop DJ (1991) Mutations in collagen genes: causes of rare and some common diseases in man. FASEB J 5:2052-2060 Myers R, Lumelsky N, Lerman L, Maniatis T (1985) Detection of single base substitutions in total genomic DNA. Nature 313:495-497 Nicholls AC, Pope FM (1984) An abnormal collagen a chain containing cysteine in autosomal dominant osteogenesis imperfecta. Br Med J 288:112-113 Pruchno CJ, Cohn DH, Wallis GA, Willing MC, Starman BJ, Zhang X, Byers PH (1991) Osteogenesis imperfecta due to recurrent point mutations at CpG dinucleotides in the COLlA1 gene of type I collagen. Hum Genet 87:3340 Rowe D, Shapiro J, Poirier M, Schlesinger S (1985) Diminished type I collagen synthesis and reduced alpha 1(I) collagen messenger RNA in cultured fibroblasts from patients with dominantly inherited (type I) osteogenesis imperfecta. J Clin Invest 76:604-611 Saiki RK, Gelfand DH, Stoffel S, Scharf R, Higuchi R, Horn GT, Mullis KB, et al (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491

Osteogenesis Imperfecta Type I Sheffield VC, Cox DR, Lerman LS, Myers RM (1989) Attachment of a 40 base-pair G + C rich sequence (GCclamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proc Natl Acad Sci USA 86:232-236 Sillence D, Senn A, Danks D (1979) Genetic heterogeneity in osteogenesis imperfecta. J Med Genet 16:101-116 Southern E (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503-517 Starman BJ, Ayre D, Charbonneau H, Harrylock M, Weis MA, Weiss L, Graham JM Jr, et al (1989) Osteogenesis imperfecta: the position of substitution for glycine by cysteine in the triple helical domain of the proal(I) chains of type I collagen determines the clinical phenotype. J Clin Invest 84:1206-1214 Sykes B, Francis M, Phil D, Smith R (1977) Altered relation of two collagen types in osteogenesis imperfecta. N Engl J Med 296:1200-1203 Sykes B, Ogilvie D, Wordsworth P, Wallis G, Mathew C, Beighton P, Nicholls A, et al (1990) Consistent linkage of dominantly inherited osteogenesis imperfecta to the type I collagen loci: COLlA1 and COL1A2. Am J Hum Genet 46:293-307 Sykes B, Wadsworth P, Ogilvie D, Anderson J, Jones N (1986) Osteogenesis imperfecta is linked to both type I collagen structural genes. Lancet 2:69-72 Tsipouras P, Borresen A-L, Dickson LA, Berg K, Prockop

515 DJ, Ramirez F (1984) Molecular heterogeneity in the mild autosomal dominant forms of osteogenesis imperfecta. Am J Hum Genet 36:1172-1179 Wallis G, Beighton P, Mathew CG (1986) Mutations linked to proa2(I) collagen gene are responsible for several cases of osteogenesis imperfecta type I. J Med Genet 23:411416 Wenstrup RJ, Willing MC, Starman BJ, Byers PH (1990) Distinct biochemical phenotypes predict clinical severity in nonlethal variants of osteogenesis imperfecta. Am J Hum Genet 46:975-982 Westerhausen Al, Constantinou CD, Prockop DJ (1990) A sequence polymorphism in the 3' nontranslated region of the proal chain of type I collagen. Nucleic Acids Res 18: 4968 Willing MC, Cohn DH, Byers PH (1990a) Frameshift mutation near the 3' end of the COLlA1 gene of type I collagen predicts an elongated proal(I) chain and results in osteogenesis imperfecta type I. J Clin Invest 85:282-290 Willing MC, Cohn DH, Starman B, Holbrook KA, Greenberg C, Byers PH (1988) Heterozygosity for a large deletion in the a2(I) collagen gene has a dramatic effect on type I collagen secretion and produces perinatal lethal osteogenesis imperfecta. J Biol Chem 263:8398-8404 Willing MC, Pruchno CJ, Byers PH (199Gb) Molecular heterogeneity in osteogenesis imperfecta type I. Paper presented at the Fourth International Symposium on Osteogenesis Imperfecta, Pavia, Italy, September 9-12