PNP-08740; No of Pages 11 Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Progress in Neuro-Psychopharmacology & Biological Psychiatry journal homepage: www.elsevier.com/locate/pnp

3Q6

Michail Pavlidis ⁎, Antonia Theodoridi, Alexandra Tsalafouta

4

University of Crete, Department of Biology, P.O. Box 2208, GR-70013 Heraklion, Crete, Greece

5

a r t i c l e

6 7 8 9 10

Article history: Received 12 October 2014 Received in revised form 23 January 2015 Accepted 25 February 2015 Available online xxxx

11 12 13 14 15

Keywords: Brain-derived neurotrophic factor (bdnf) Cortisol Stress Zebrafish

O R O

i n f o

F

2

Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio

a b s t r a c t

E

D

P

The main objectives of this study were to investigate the dynamics of the cortisol stress response and the underlying molecular regulation in adult zebrafish exposed to acute and long-term stressors that differed in nature, duration and relative intensity. Fish showed a very rapid and prolonged increase in trunk cortisol concentrations, starting at around 15 min and returning to basal levels at around 2 h following exposure to acute stressors. In addition, acute stress affected significantly brain mRNA expression levels of several genes (corticotropin-releasing factor, crf; pro-opiomelanocortin, pomc; glucocorticoid receptor, gr; MR/GR ratio; prolactin, prl; hypocretin/orexin, hcrt; brain-derived neurotrophic factor, bdnf; c-fos). Exposure of fish to unpredictable relatively low-grade environmental and husbandry stressors (SP-1) did not affect the overall behaviour of fish, as well as trunk cortisol concentrations. Fish exposed to relatively higher-grade long-term stressors (SP-2) showed elevated cortisol levels as well as significant changes in most of gene transcripts. In particular, fish exposed to SP-2 showed statistically significant upregulation in brain gr, mr, prl and hcrt compared to SP-1 and control individuals. The highest mean values of bdnf transcripts were found in SP-2 exposed zebrafish and the lowest in control fish, while an approximately 5 to 6-fold upregulation was observed in c-fos mean relative mRNA levels of long-term stress-exposed fish, regardless of stressor intensity, compared to control zebrafish. In conclusion, we developed realistic acute and unpredictable long-term stress protocols, based on husbandry and environmental stressors and physical, chemical, mechanical and social stimuli that fish may experience either in nature or under intensive rearing conditions. © 2015 Published by Elsevier Inc.

E

C

T

Q51Q4

R

37 35 34 36

1. Introduction

39 40

The concept of stressors, the notion of coping and the distinction between eustress and distress were introduced several decades ago by Selye (Selye, 1936, 1946; Tache and Selye, 1985). With the conceptualisation of perception, cognition and appraisal, Sterling and Eyer (1988), McEwen (1998, 2000) and McEwen and Wingfield (2003) developed the concepts of allostasis, allostatic load, mediators of allostasis and coping strategies (Koolhaas et al., 1999). Romero et al. (2009), in a recent attempt to integrate homeostasis, allostasis and stress, proposed the reactive scope model, taking into consideration both the circadian and seasonal fluctuations of the concentration of a physiological mediator (e.g., blood cortisol) as well as a low and a high stable threshold below and above which homeostatic failure and homeostatic overload occur, respectively. The range between these two thresholds is termed reactive scope, which is the physiological range of the mediator. The acute stress response, described as the cascade of endocrine and metabolic changes following exposure of an individual to stimuli of

45 46 47 48 49 50 51 52 53 54

N C O

43 44

U

41 42

R

38

⁎ Corresponding author at: University of Crete, Department of Biology, GR-70013 Heraklion, Crete, Greece. E-mail address: [email protected] (M. Pavlidis).

high intensity and short duration, has been well investigated in various fish species. In general, there is a primary response involving the release in the circulation of catecholamines and cortisol, a secondary response comprising changes in several metabolic and physiological parameters (e.g., blood glucose, lactate, osmotic pressure, liver glycogen), and a tertiary one involving whole animal changes in the case where the individual is unable to acclimate or adapt (Barton, 2002; Barton and Iwama, 1991; Fanouraki et al., 2011; Tort et al., 2011; Wendelaar Bonga, 1997). However, the concept of chronic stress still causes serious constraints due to the absence of concrete operational definitions, validated protocols and reliable indicators for diagnosis. An appropriate methodology for investigating the effects of animal exposure to long-term stressors is lacking. Nevertheless, despite the important differences in form and context of the chronic-stress concept, there is a general agreement that the interactions between the intensity, duration, frequency, (un)predictability and (un)controllability of environmental stimuli, the genetic background and life history of a given vertebrate individual are essential for its welfare (Korte et al., 2007). Zebrafish, Danio rerio, is a vertebrate model in biomedical research and it has recently been proposed as a prominent model in the study of stress physiology and anxiety (Alsop and Vijayan, 2009; Egan et al., 2009; McGonnell and Fowke, 2006; Pavlidis et al., 2011, 2013).

http://dx.doi.org/10.1016/j.pnpbp.2015.02.014 0278-5846/© 2015 Published by Elsevier Inc.

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

16 17 18 19 20 Q7 21 Q8 22 23 24 25 26 27 28 29 30 31 32 33

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76

99

2.1. Experimental fish

100

110

Wild-type zebrafish (D. rerio) of Malaysian origin (Singapore import) were purchased through a Greek wholesaler. Fish were transferred to the installations of the Fish Physiology Laboratory at the Department of Biology, University of Crete, and placed in 250 L holding aquaria, equipped with biological filters (EHEIM external canister filter, EHEIM GmbH & Co. KG), facilities for temperature and photoperiod control, and air stones. Fish were maintained under a 12L:12D photoperiod regime and a water temperature of 25 to 26 °C. Oxygen and pH measurements were performed daily, and ammonia, nitrite and nitrate weekly. Fish were fed twice daily with commercial aliment (Tropical Fish Flakes, Prodac International S.r.l., Italy).

111

2.2. Experiment 1: acute stress response

112 113

123 124

To study the molecular and endocrine (cortisol) regulation of the acute stress response in zebrafish, 58 adult 1+ year-olds (mean body weight [b.w.] ± standard error of the mean [SEM]: 0.43 ± 0.02 g) were caught by net from the holding aquaria following a decrease of the water level to 25% of the initial volume, and placed in a 10 L bucket. Fish were chased for 5 min, exposed to air for 1 min and then transferred to 8 × 2.0 L beakers (6 fish per beaker, two beakers per sampling point). The fish were sampled at regular intervals (15, 30, 60 and 120 min post-stress) according to previous published data (Pavlidis et al., 2013; Ramsay et al., 2009). At each respective sampling point, fish were caught and placed in anaesthetic less than 1 min. Before the application of the stressor, 10 fish were caught and served as controls (0 h).

125

2.3. Experiment 2: long-term stress response

126

To develop useful long-term stress protocol based on ordinary husbandry parameters and to study its effect on molecular and endocrine factors involved in the regulation of the stress response in zebrafish, 128 adult 1+ year-olds (mean b.w. ± SEM: 0.55 ± 0.03 g) were used, at a female to male ratio of 1:2. Fish were transported from the holding 250 L glass aquaria to the experimental aquaria and the experiments started after a habituation period of one week. Εach experimental aquarium was equipped with an internal aquarium filter (RESUN Magi — 200) and tank heater (RESUN THERM 25/300 — RH 9000) for temperature control. Water temperature was set at 25 to

104 105 106 107 108 109

114 115 116 117 118 119 120 121 122

127 128 129 130 131 132 133 134 135

D

T

102 103

C

101

E

94 95

R

92 93

R

90 91

O

88 89

C

86 87

N

84 85

U

83

F

2. Materials and methods

81 82

O

98

79 80

26 °C and the photoperiod at 12L:12D. Water chemical parameters were monitored daily. Two protocols were designed and evaluated; both based on unpredictability and long-term duration, and differing in the nature and magnitude of the stressors applied. In both protocols three or four different types of low- or high-grade environmental and husbandry stressors were applied randomly on a daily basis for a total period of 12 days (Tables 1 & 2). Long-term stress protocol 1 (SP-1, Table 1) consisted of relatively low-grade environmental and husbandry stressors. SP-1 included optical (increase in light intensity from 2.57 to 5.14 μmol m−2 s−1 for 30 min; lights on for 15 min twice during the night; lights off for 15 min twice during the day; exposure to blue or red spectrum for 30 min; introduction of plastic plant for 30 min); mechanical (high water current 600 L h−1 for 30 min); chemical (increase of water pH by 0.3 with the addition of 15 mL NaOH for 30 min; decrease of pH by 0.3 with the addition of 2.5 mL HCl for 30 min; administration of food extract by pulverizing food and dissolving it in 3 mL water); and social (crowding through the reduction of the water level to 1/3 of the initial water level, resulting in 6 fish per L compared to the initial 2 fish per L; introduction of novel object, i.e., plastic fish) stimuli. Full spectrum lights (Phillips, TLD 36W) were used to approximate natural sunlight and transparent filters to produce the blue (maximum absorption spectrum 450–475 nm) and red (maximum absorption spectrum 620–750 nm) spectra. Two 10 L aquaria with 20 fish per aquarium were used. An undisturbed group of fish held under identical conditions of water quality and stocking density served as controls. To minimize the number of sacrificed animals, forty-eight fish were euthanized to obtain brain and trunk samples. Long-term stress protocol 2 (SP-2, Table 2) consisted of highergrade, compared to SP-1, environmental and husbandry stressors. SP2 included optical (lights off at day or lights on at night for 15 min three times), husbandry (chasing with a net for 5 min; restrained in the net for 5 min and exposed to air for 1.5 min) and social (crowding for 15 min through the decrease of the water level to 1/4 of the initial water volume, resulting in 8 fish per L compared to the initial 2 fish per L; isolation for 5 min in 80 mL beakers). Two 6 L aquaria with 12 fish in each were used. An undisturbed group of fish held under identical conditions of water quality and stocking density served as controls. To minimize the number of sacrificed animals, forty-eight fish were euthanized to obtain brain and trunk samples. Crowding as a stressor applied in both protocols was based on the notion of keeping the same number of fish in a smaller water volume. Before, during and after the application of the stressor, oxygen levels were monitored, and remained at adequate levels (5.1–5.8 mg L−1). Therefore, any stress response from the zebrafish was not due to poor water quality. In all experiments, fish were caught by net and immediately sacrificed by immersion in ice-cold water to avoid any possible increase in cortisol concentrations due to the use of anaesthetic as well as degradation of brain RNA. The head and caudal fin were then cut and trunks were weighed, frozen in 1.5-mL eppendorfs on dry ice, and stored at −80 °C for cortisol determination. Brains were dissected and samples from two fish of the same sex were pooled and placed in liquid nitrogen for mRNA expression studies. In chronic-stress experiments, half of the fish per tank were sampled one day following the end of the experiment and the rest were exposed to acute stressors (chasing for 5 min with a net and exposure on air for 1 min) and sampled at 15 min post-stress. Brain samples were collected only from non-acutely-stressed fish. All experiments were performed in accordance with relevant guidelines and regulations. The Animal House at the Dept. of Biology, University of Crete, is certified by the Veterinary Unit of the Region of Crete for the rearing (EC91-BIObr-09) and use of laboratory animals for scientific purposes (EL91-BIOexp-10). All procedures on fish used at this study were approved by the Departmental Animal Care Committee following the Three Rs principle, in accordance with Greek

P

96 97

Following exposure to acute stressors like net handling, air exposure and increase in water current (vortex speed), zebrafish show a rapid increase (15 to 30 min post-stress) in whole-body cortisol levels and water-born cortisol, as well as differences in the expression of several genes involved in the regulation of the Hypothalamic–Pituitary– Interrenal (HPI) axis (Barcellos et al., 2007; Fuzzen et al., 2010; Pavlidis et al., 2013; Ramsay et al., 2009). Concerning chronic stress, stocking density and water quality are the main factors studied so far (Pavlidis et al., 2013; Ramsay et al., 2006). However, there is a lack of validated, reliable and repeatable protocols for evaluating the effects of unpredictable long-term stressors on zebrafish, and fish in general. In rats, chronic mild stress protocols have been developed to study depression (Schweizer et al., 2009; Willner, 2005), but in fish species there are only three recent studies in adult zebrafish (Chakravarty et al., 2013; Piato et al., 2011) and in European sea bass, Dicentrarhus labrax (Tsalafouta et al., 2014). The objectives of this study were (a) to propose an unpredictable long-term stress protocol that can be used to elucidate the chronicstress response in fish, and (b) to investigate the dynamics of the cortisol stress response and the underlying molecular regulation in adult zebrafish exposed to acute and long-term husbandry stressors.

E

77 78

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

R O

2

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx Table 1 Design and implementation of the unpredictable long-term stress protocol 1 (SP-1).

t1:3

Day

Stressor

t1:4

1

Lights on at night (Sigurgeirsson et al., 2013)

t1:5 Q2 t1:6 t1:7 t1:8 t1:9 t1:10 t1:11 t1:12 t1:13 t1:14

2 3 4 5 6 7 8 9 10 11

Red spectrum Lights off at day ↑ light intensity Blue spectrum ↑ light intensity; lights off at day Blue spectrum Red spectrum; lights off at day ↑ light intensity Red spectrum Lights on at night

↑ water current (Pottinger and Calder, 1995; Von Krogh et al., 2010) ↑ pH Magalhães et al. (2012) ↓ pH ↑ pH Food extract

Plastic plant Crowding

Food extract ↓ pH

↑ water current

(PD 56/2013) and EU (Directive 63/2010) legislation on the care and use of experimental animals.

212 213 214 215

2.5. Cortisol determination

217

227 228

Trunk cortisol extraction was performed according to Pavlidis et al. (2011). Briefly, trunk samples were partially thawed on ice and homogenized in 5 × (w/v), ice-cold phosphate-buffered saline (pH 7.4). Cortisol was extracted from 2 × 250 μL of homogenate with 3 mL of diethyl ether. The extract was allowed to freeze by placing tubes in a deep freezer (− 80 °C), diethyl ether layer (water phase) was transferred into a new tube and evaporated by placement of tubes in a 45 °C water bath for 1 h and in room temperature for an additional 3 h. Samples were then reconstituted in 250 μL of immunoassay buffer and cortisol was quantified by the use of a commercial enzyme immunoassay kit (Cayman Chemical, MI, USA) previously evaluated (Pavlidis et al., 2011). All samples were tested in duplicate.

t2:1 t2:2

Table 2 Design and implementation of the unpredictable long-term stress protocol 2 (SP-2).

223 224 225 226

R

R

N C O

221 222

t2:3

Day

Stressor

t2:4 t2:5 t2:6 t2:7 t2:8 t2:9 t2:10 t2:11 t2:12 t2:13 t2:14

1 2 3 4 5 6 7 8 9 10 11

Lights off at day

t2:15

Lights on at night Lights off at day Lights on at night Lights off at day Lights off at day Lights on at night

230 231 232 233 234 235 236 237 238

2.7. Quantitative real-time PCR (qPCR)

239

The mRNA expression of genes encoding for gr, mr, crf, mc2r, bdnf, pomc, prl, avt, c-fos and orexin (Table 3) was determined in the brains of control and stressed fish with quantitative polymerase chain reaction (qPCR) assays using the KAPA SYBR® FAST qPCR Kit (Kapa Biosystems). Reactions were cycled and the resulting fluorescence was detected with CFX Connect Thermal Cycler (Bio-Rad) under the following cycling parameters: 95 °C for 3 min (HotStarTaq DNA Polymerase activation step), 94 °C for 15 s (denaturation step), 60 °C for 30 s (annealing step), 72 °C for 20 s (extension step), for 40 cycles (step 2-step 4), apart from the case of orexin where the annealing temperature used was 59 °C. A relative standard curve was constructed for each gene, using 4 serial dilutions (1:5) of a pool of all cDNA samples and the mRNA levels of each gene were normalized based on β-actin.

240

2.8. Statistical analysis

253

241 Q12 242 243 244 245 246 247 248 249 250 251 252

All statistical analyses were performed with SigmaPlot 11.0 (Jandel 254 Scientific). All data are presented as means ± standard error of the 255

U

219 220

E

216

218

R O

C

210 211

P

Ethological data were collected following the application of the stressors throughout the experiments by comparison to control group. The height in the tank as well as shoal cohesion were used as indexes of anxiety (Bencan et al., 2009; Levin et al., 2007; Piato et al., 2011). The position of the fish in the aquarium was scored (1 — only in the bottom third of the tank; 2 — preference for the upper two-thirds; 3 — only the upper third) for 30 min after the application of the stressor. Shoal cohesion was scored according to Piato et al. (2011) (1 — complete lack of group cohesion or fish interaction; 2 — loose or partial shoaling behaviour; 3 — normal distances and shoaling behaviour). Any changes in the amount of food consumed were also recorded.

D

205

Whole brain samples of zebrafish were disrupted and homogenized using the TissueRuptor (Qiagen, Hilden, Germany) for 20 s in 600 μL RLT plus buffer (RNeasy Plus Mini Kit Qiagen, Valencia, USA). Total RNA was isolated with the RNeasy Plus Mini Kit (Qiagen, Valencia, USA). RNA yield and purity were determined by measuring the absorbance at 260 and 280 nm using the Nanodrop® ND-1000 UV–Vis spectrophotometer (Peqlab, Erlangen, Germany), and its integrity was tested by electrophoresis in 1% agarose gels. Reverse transcription (RT) was carried out using 1 μg RNA with QuantiTect Reverse transcription kit (Qiagen).

E

2.4. Behavioural tests

229

2.6. RNA purification and cDNA synthesis

T

204

O

202

208 209

↑ water current Plastic fish Crowding

Note: Crowding was associated with a decrease in water volume followed by water renewal.

206 207

Plastic plant (Dahlbom et al., 2011) Crowding (Ramsay et al., 2006) Plastic plant

↑ pH Food extract

t1:15

203

Plastic fish (Dahlbom et al., 2011)

F

t1:1 t1:2

3

Chasing (Fanouraki et al., 2011) Restrain (Ramsay et al., 2009) Chasing & air exposure Restrain Air exposure (Fanouraki et al., 2011) Chasing Restrain Air exposure Restrain Air exposure

Crowding Crowding Isolation (Parker et al., 2012) Isolation Crowding Isolation Crowding Isolation

Note: Crowding was associated with a decrease in water volume followed by water renewal.

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

4

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

Table 3 Primers design.

t3:3

Gene name

Forward 5′–3′

Reverse 5′–3′

Reference

t3:4 t3:5 t3:6 t3:7 t3:8 t3:9 t3:10 t3:11 Q3 t3:12 t3:13 t3:14

Gr Mr Crf Mc2r Bdnf Pomc Prl Avt c-fos Hcrt β-Actin

ACAGCTTCTTCCAGCCTCAG CCCATTGAGGACCAAATCAC ACGGTGGCTCTGCTCGTTGC CTCCGTTCTCCCTTCATCTG GGCGAAGAGCGGACGAATATC GAATCCGCCGAAACGCTTCC GCTCGGTCTCTGCTGTTG TCGTCTGCCTGCTACATCCA TGAAACTGACCAGCTTGAGGAT TCTACGAGATGCTGTGCCGAG TGTCCCTGTATGCCTCTGGT

CCGGTGTTCTCCTGTTTGAT AGTAGAGCATTTGGGCGTTG GTCCGCGGCTGGCTGATTGA ATTGCCGGATCAATAACAGC AAGGAGACCATTCAGCAGGACAG GGGTCCTTCTTTCCAAGTGGGTTT GGTGTTGCGTTCTGGATGT TCCGGCTGGGATCTCTTG GTGTGCGGCGAGGATGAA CGTTTGCCAAGAGTGAGAATC AAGTCCAGACGGAGGATGG

Pavlidis et al. (2011) Alsop and Vijayan (2008) Pavlidis et al. (2011) Alsop and Vijayan (2008) Current paper Current paper Current paper Meghan et al. (2010) Current paper Novak et al. (2005) Alsop and Vijayan (2008)

3.1. Acute stress response

268 269

There was no statistically significant difference between the duplicate tanks; therefore, data are presented together within each different group. Acute stress resulted in a sharp statistically significant increase (F4,52 = 16.848, P b 0.001) in trunk cortisol (9.7 ± 1.4 ng g−1, n = 12) at 15 min post-stress to return to basal levels at 2 h post-stress (3.6 ± 0.3 ng g−1, n = 12; Fig. 1). There was a statistically significant effect of acute stress in the mRNA expression levels of most of the genes involved in the regulation of the Hypothalamus–Pituitary–Interrenal axis (Fig. 2). In particular, corticotropin-releasing factor (crf) mRNA expression levels showed a bimodal pattern of changes with an approximately 2-fold upregulation (F4,15 = 7.809, P = 0.004) at 15 and 60 min post-stress compared to control values (0 h). Pro-opiomelanocortin (pomc) mRNA transcripts displayed also a 2-fold upregulation (F4,15 = 6.344, P = 0.005), but at 30 min post-stress and glucocorticoid receptor (gr)

280 281 282

3.2. Chronic-stress response

305

There was no effect of stress protocol 1 (SP-1) on food consumption and feeding behaviour. Lights on at night, red spectrum, distribution of food extract, increase of water current and crowding resulted in a significant alteration of shoal cohesion, reaching of score of 2, and in an increase in locomotor activity. However, fish returned to their previous state in less than 10 min after the end of stress exposure. In addition, lights on at night, water current and crowding affected fish position, with most fish occupying the lower two thirds of the experimental aquarium, reaching a height score of 1. Zebrafish returned to their previous state (i.e., equal time exploring the three thirds of the tank) in less than 10 min after the end of stress exposure. There was no effect of stress protocol 2 (SP-2) on food consumption and feeding behaviour. All stressors distinctly altered shoal cohesion and position of the fish in the aquarium, and this change was evident even 30 min after the termination of the stimuli. In particular, fish occupied the bottom third of the tank (score 1) and exhibited a partial loss of their shoal cohesion (score 2). Control fish throughout the course of the experiment showed a preference for the upper two-thirds of the tank (score 2) while maintaining a stable shoal cohesion and normal distances (score 3). There was no statistically significant sex difference in mean cortisol concentrations; therefore, data from both males and females are presented together. In addition, there was not a statistically significant effect of unpredictable long-term stress protocol (SP-1) on mean trunk cortisol concentrations (3.4 ± 0.5 ng g−1, n = 12) compared to control zebrafish (2.0 ± 0.2 ng g−1, n = 12), while exposure of fish to

306

T

C

E

R

R

278 279

O

276 277

C

274 275

N

272 273

U

270 271

O

267

262 263

R O

3. Results

260 261

283 284

P

266

258 259

at 15 min post-stress (F4,15 = 5.770, P = 0.011). There was no statistically significant effect (F4,15 = 2.849, P = 0.082, power of performed test with alpha = 0.050:0.374) of stress on mineralocorticoid receptor (mr) mRNA transcripts, while there was a significant 2-fold upregulation (F4,15 = 6.241, P = 0.009) on the MR/GR ratio at 15 and 30 min post-stress (data not shown). Melanocortin 2 receptor (adrenocorticotropic hormone, mc2r) mRNA expression levels did not show any statistically important pattern of changes (F4,15 = 1.066, P = 0.410, power of performed test with alpha = 0.050:0.059), while there was a 2-fold upregulation (F4,15 = 6.463, P = 0.004) at 30 min post-stress on prolactin (prl) mRNA transcripts (Fig. 2). There was no statistically significant effect (F4,15 = 2.034, P = 0.145, power of performed test with alpha = 0.050:0.241) of acute stress on arginine vasotocin (avt) mRNA transcripts, while hypocretin/orexin showed a bimodal pattern of changes with an approximately 1.5 upregulation (F4,15 = 10.100, P = 0.002) at 15 and 60 min post-stress (Fig. 3). Brain-derived neurotrophic factor (bdnf) displayed a significant (approximately 3-fold, F4,15 = 6.370, P = 0.003) and prolonged upregulation from 15 to 60 min following exposure to acute stress. There was an enormous effect of stress (F4,15 = 39.976, P b 0.001) on immediate early gene (c-fos) mRNA transcripts with a 25 to 30-fold upregulation at 15 and 30 min post-stress (Fig. 3).

D

264 265

mean (SEM). Data were initially screened for normality and homogeneity and, if needed, they were log transformed. Statistical comparisons of cortisol concentration between the different time points of acutely-stressed individuals were made using one-way ANOVA. Gene expression analysis in all experiments was also performed by one-way ANOVA. Statistical comparisons of cortisol between the different sexes and chronic-stress-exposed fish, prior and after the application of additional acute stressors, were performed using three-way ANOVA. All pairwise multiple comparison procedures were performed by the Duncan's multiple range test. The significant level used was P b 0.05.

E

256 257

F

t3:1 t3:2

Fig. 1. Pattern of trunk cortisol concentrations (x ± S.E.M., n = 10 per sampling point or group) in zebrafish exposed to acute stressors. Different letters indicate significant differences between time points.

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

285 286 287 Q13 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304

307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

crf

pomc 2.0

b

1.5

a 200

1.0

100

0.5

0

mRNA relative levels

a

a

b 1000

500

0.0 15

30

60

2

a

a

0

15

0

gr

mr

a

a

1

0

0 60

O

1.0 0.5 0.0

15

30

60

120

Time (min)

D T

mRNA relative levels

C R

E

200

60

1.5

prl 3

0 120

b 2

10000

5000

a

a

a

a 1

0

Fold change

2

1

2.0

15000

400

30

100

E

3

Fold change

mRNA relative levels

600

15

200

0

mc2r

0

300

0

120

Time (min)

0

120

R O

a

400

P

a

mRNA relative levels

2

30

60

Fold change

b 1000

500

Fold change

mRNA relative levels

3

15

30

Time (min)

1500

0

1

0

120

Time (min)

500

a

a

F

0

3

Fold change

300

1500

b

Fold change

mRNA relative levels

400

5

0 0

Time (min)

15

30

60

120

R

Time (min)

334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350

an unpredictable long-term stress protocol (SP-2) resulted in a significant (P b 0.01) increase in mean trunk cortisol concentrations (6.8 ± 2.2 ng g− 1, n = 12) compared to both SP-1 and control fish (Fig. 4). In addition, the variability (coefficient of variation) in cortisol concentrations of the SP-2 group was 1.5 to 3.0-fold higher than in the SP-1 and control fish, respectively, resulting in groups of high (11.6 ± 3.4 ng g−1, n = 6) and low (2.0 ± 0.3 ng g−1, n = 6) cortisol response. Exposure of fish to a further acute stressor had a similar effect on all groups, with a substantial increase (average 10.8 to 17.8 ng g−1; P b 0.001) in trunk cortisol concentrations compared to the no-acutestress-exposed individuals (average 2.0 to 6.8 ng g−1; Fig. 4). There was no statistically significant effect of SP-1 and SP-2 protocols on crf (F2,9 = 0.952, P = 0.422, power of performed test with alpha = 0.050:0.050), mc2r (F2,9 = 1.392, P = 0.297, power of performed test with alpha = 0.050:0.094) mRNA relative expression levels, and MR/GR ratio (F2,9 = 0.434, P = 0.661, power of performed test with alpha = 0.050:0.050) (Figs. 5 & 6). Fish exposed to SP-2 showed statistically significant upregulation in brain pomc (F2,9 = 8.734, P = 0.01), gr (F2,9 = 14.773, P = 0.001), mr (F2,9 = 9.680, P = 0.006), prl (F2,9 =

U

332 333

N C O

Fig. 2. Relative expression (x ± S.E.M., n = 4 pools of two brains per sampling point) of corticotropin-releasing factor (crf), pro-opiomelanocortin (pomc), glucocorticoid receptor (gr), mineralocorticoid receptor (mr), melanocortin 2 receptor (mc2r) and prolactin (prl) mRNA zebrafish whole brain samples exposed to acute stressors. Different letters indicate significant differences between time points. Data are expressed in arbitrary units.

36.474, P b 0.001), and hypocretin/orexin (F2,9 = 6.819, P = 0.016) 351 compared to SP-1 and control individuals (Figs. 5 & 6). The highest 352 mean values of bdnf transcripts were found in SP-2 exposed zebrafish 353 (1.5- and 3.1-fold upregulation compared to SP-1 and controls, respec- 354 tively) and the lowest in control fish (F2,9 = 25.292, P b 0.001). An 355 approximately 5- to 6-fold upregulation was observed in c-fos mean rel- 356 ative mRNA levels of chronic-stress exposed fish, regardless of stressor 357 intensity, compared to control zebrafish (F2,9 = 5.300, P = 0.03; Fig. 6). 358 4. Discussion

359

The acute protocol applied in the present study, consisting of three different ordinary husbandry stressors (decreasing the holding tank's water level, chasing with a net for 5 min and air exposure for 1 min), has been tested in several fish species (Fanouraki et al., 2011), including zebrafish (Pavlidis et al., 2013), and has proven to be a reliable protocol to evoke the molecular, endocrine and physiological response following exposure of an individual to acute stressors. Zebrafish showed a very rapid and prolonged increase in cortisol concentrations, starting at

360

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

361 362 363 364 365 366 367

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

avt

hypocretin/orexin 0.5 0.4 0.3 0.2

500

0.1 0

0.0 15

30

60

3000

3

ab 2000

a 1000

1

0

120

0 0

15

a

1

10 0 60

120

500

a 0

0

0

D

Time (min)

b

R O

20

b

1000

P

2

mRNA relative levels

ab

30

120

15

30

20

10

a

Fold change

b

Fold change

mRNA relative levels

1500

3

b

15

60

c-fos

b

0

30

Time (min)

bdnf

30

2

a

Time (min)

40

b

F

0

4

b

Fold change

1000

mRNA relative levels

4000

Fold change

mRNA relative levels

1500

O

6

a 0

30

60

120

Time (min)

C

E

R

377

R

375 376

O

374

C

372 373

N

370 371

around 15 min, and returning to basal levels at around 2 h post-stress. This is in accordance with the previous published data on zebrafish (Fuzzen et al., 2010; Pavlidis et al., 2013; Ramsay et al., 2009); however, the observed peak at 15 min is faster than that reported in other fish species where cortisol concentrations reach a peak at around 30 min to 4 h post-stress (Fanouraki et al., 2011; Iwama et al., 1997; Tort et al., 2011). The rapid peak may reflect a faster cortisol response due to the higher water temperatures that zebrafish are reared in compared to those of cold freshwater or temperate marine fish species (Fuzzen et al., 2010).

U

368 369

T

E

Fig. 3. Relative expression (x ± S.E.M., n = 4 pools of two brains per sampling point) of arginine vasotocin (avt), hypocretin/orexin, brain-derived neurotrophic factor (bdnf) and c-fos mRNA zebrafish whole brain samples exposed to acute stressors. Different letters indicate significant differences between time points. Data are expressed in arbitrary units.

Fig. 4. Pattern of trunk cortisol concentrations (x ± S.E.M., n = 12 per sampling point or group) in zebrafish exposed to chronic stressors. SP-1: unpredictable long-term stress protocol of relatively low-grade stressors (Table 1); SP-2: unpredictable long-term stress protocol of higher-grade stressors (Table 2). Different letters indicate significant differences between groups, and asterisks between groups prior or after exposure to additional acute stress.

Exposure of fish to the SP-1, consisting of optical (increase in light intensity; change in lighting spectrum; lights off/on during day/night, respectively and introduction of plastic plant), mechanical (increase in water current), chemical (change in water pH; administration of food extract), and social (crowding; introduction of a novel object) stimuli for a period of approximately two weeks did not alter the overall behaviour of the fish, apart from a short period of 10 min after the end of stress exposure. In addition, there was no significant effect on the mean trunk cortisol concentrations of the group, or the mRNA expression of genes implicated in the regulation of the HPI axis, indicating the mild nature of the protocol applied. On the contrary, by keeping the unpredictability and differentiating the nature, duration and intensity of the stimuli, it was possible to evoke a chronic-stress response as based on behavioural, endocrine and molecular data. Fish in all cases did not show any signs of prolonged hyperactivity or habituation (i.e., desensitization) of the HPI axis, as there was a significant increase in cortisol in fish exposed to additional acute stressors in all groups regardless of the previous history (i.e., expose or not to chronic stressors). Piato et al. (2011) proposed an unpredictable chronic-stress (UCS) protocol for zebrafish for investigating the effects of stress on molecular, physiological and behavioural parameters. In the Piato et al. (2011) study, a statistically significant increase in cortisol concentrations in zebrafish exposed for either seven or fourteen days to the stress protocol compared to control fish was also observed. However, the intensity of the UCS protocol was severe, consisting of individual restraint (90 min in a 2 mL microcentrifuge tube, open in both ends to allow water flow), isolation (45 min alone in a 250 mL beaker), chasing (8 min with a net), crowding (10 animals for 50 min in a 250 mL beaker; 2 min in low water level), abrupt change in water temperature (5 °C increase or decrease in the holding temperature for 30 min), exposure for 50 min to a predator with no direct contact, tank change and water replacement. The present study followed a different approach in choosing environmental and husbandry challenges that fish may perceive during their life cycle, either in captivity or in nature. In addition, we tried to

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

378 Q14 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 Q15 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411

7

414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430

N C O

412 413

Fig. 5. Relative expression (x ± S.E.M., n = 4 pools of two brains per sampling point) of crf, pomc, gr, mr, mc2r and prl mRNA zebrafish whole brain samples under control and long-term stress conditions (SP-1 and SP-2). Different letters indicate significant differences between groups. Data are expressed in arbitrary units.

differentiate between the duration and the relative perceived intensity of the applied stressors. It was shown that zebrafish are tolerant to ordinary environmental and husbandry stimuli of relatively lowergrade stimuli, and that even under relatively higher grades, a high variability in cortisol concentrations is observed with the clear presence of high (HR) and low (LR) responding individuals. Whether this difference is consistent over time and shows a high degree of heritability, as in the case of rainbow trout, Oncorhynchus mykiss (Pottinger and Carrick, 1999; Pottinger et al., 1992a), requires further studies. When stimulated by an environmental stressor, neurons in the hypothalamus secrete corticotropin-releasing factor (CRF) and arginine vasotocin (AVT). CRF is a neurotransmitter that regulates the release of adrenocorticotropic hormone (ACTH) from the adenohypophysis, which in turn binds to melanocortin 2 receptor (MC2R) on the interrenal cells of the head kidney and stimulates the production and release of cortisol (Wendelaar Bonga, 1997). Through the cleavage of proopiomelanocortin (POMC), ACTH derives a polypeptide precursor that also gives rise to melanocyte-stimulating hormone (MSH), βendorphin and β-lipotropin. During the HPI axis activation, glucocorticoid

U

Q1

R

R

E

C

T

E

D

P

R O

O

F

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

and mineralocorticoid receptors are the mediators of transcriptional effects of cortisol on the peripheral tissues. In our study, mRNA transcripts of genes involved in the regulation of the stress response also showed significant changes in fish exposed to either acute or chronic stressors. The temporal pattern of changes in crf, pomc, gr and avt mRNA transcripts observed in fish exposed to acute stressors is similar to those reported in another study on zebrafish exposed to a vortex stressor (Fuzzen et al., 2009). The expression of brain crf increased rapidly (around 15 min) in accordance with the sharp increase in the preoptic area of crf levels reported by Fuzzen et al. (2009). However, there was a delayed decrease (120 min compared to 20 min) to levels similar to control values. Transcripts of pomc peaked at 30 min post-stress, showing a faster response than the one reported (60 min) for pituitary mRNA levels (Fuzzen et al., 2009). In teleosts, MC2R genes are primarily expressed in the interrenal tissue of the head kidney, the liver and the gonad, and to a lesser extent in the hypothalamus and pituitary, skin and spleen (Agulleiro et al., 2013; Klovins et al., 2004; Metz et al., 2005), which suggests a role for MC2R in the regulation of the HPI axis. There are few published studies

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

431 432 433 434 435 436 437 438 Q16 439 440 Q17 Q18 441 442 443 444 Q19 445 446 447 448 449

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

D

P

R O

O

F

8

T

E

Fig. 6. Relative expression (x ± S.E.M., n = 4 pools of two brains per sampling point) of avt, hypocretin/orexin, bdnf and c-fos mRNA zebrafish whole brain samples under control and chronic-stress conditions (SP-1 and SP-2). Different letters indicate significant differences between groups. Data are expressed in arbitrary units.

450

C

on the role of MC2R in the brain of vertebrates, as in mammals and birds this receptor does not seem to be expressed in the brain (Agulleiro et al., 452 2013). In the present study, mc2r brain expression levels did not show 453 any significant change along with the cortisol levels. Nor was any signif454 icant alteration in kidney mRNA levels of mc2r found during transporta455 tion stress in zebrafish (Dhanasiri et al., 2013) or exposure to repetitive 456 physical stressors (once or three times per week, for a period of 33 days, 457 draining and brushing of the holding tanks for 2 min) in one-year-old 458 immature European sea bass (Agulleiro et al., 2013). However, when 459 Q20 zebrafish were exposed to a vortex stressor, a peak in interrenal tissue 460 Q21 mRNA levels was observed at 10 min post-stress (Fuzzen et al., 2009). 461 Adult rainbow trout exposed to acute stressors (netting and chasing 462 the fish for 5 min) showed a rapid increase of plasma ACTH and cortisol 463 levels at 1 h, followed by a delayed upregulation in MC2R mRNA levels 464 at 4 h post-stressor (Aluru and Bernier, 2007). Whether the pre-existing 465 MC2R protein is adequate to regulate the HPI axis during acute stress or 466 new protein has been synthesised later than 2 h post stress, similar to 467 the observation in rainbow trout, needs to be confirmed in future 468 studies. 469 The effect of cortisol at the molecular, cellular and physiological 470 levels is mediated by the glucocorticoid receptor(s) (GR), which are 471 important mediators of the stress response involved in both short and 472 long-term adaptation and acclimation following exposure of an individ473 ual to adverse stimuli. Disturbances of GR signalling are linked to 474 impairment of learning and memory processes and with several brain 475 disorders (Coste et al., 2005; Holsboer, 2000; O'Connor et al., 2000). 476 Zebrafish contain only a single gene-encoding GR, while in several 477 other teleosts studied so far, two GR isoforms have been found, namely 478 GR1 and GR2 (Alsop and Vijayan, 2008; Bury et al., 2003; Schaaf et al., 479 2009; Stolte et al., 2008; Terova et al., 2005; Vazzana et al., 2010). The 480 zebrafish GR clusters in the GR2 clade of teleost corticoid receptors 481 (Schaaf et al., 2008; Stolte et al., 2006). We show a rapid (15 min) up482 regulation as well as a fast return to basal levels (30 min) in GR

U

N

C

O

R

R

E

451

transcripts following exposure of zebrafish to acute stressors. The same pattern was observed in fish exposed to high-intensity unpredictable chronic stress. These results are in agreement with a recent study in rainbow trout, where after short-term (1 day) cortisol implantation, GR2 expression levels were upregulated in the brain and head kidney tissues but downregulated in other tissues (Teles et al., 2013). In the same study and at day 5, when cortisol levels resembled chronic stress, there was also an upregulation in gills and skin GR2 transcripts. However, in several other studies, a downregulation of GR(s) was reported (Piato et al., 2011; Shrimpton and Randall, 1994; Terova et al., 2005). In a recent study of European sea bass larvae, GR1 transcripts showed a downregulation at 2 h, while GR2 transcripts an upregulation at 0.5 h post-stress (Tsalafouta et al., 2014). In rainbow trout exposed to acute netting stress, plasma cortisol concentrations and GR2 transcripts in peripheral blood leucocytes had significantly increased 2 h after stress (Yada et al., 2011). Similarly, in long-term cortisol-treated rainbow trout, there was an upregulation in hepatic GR mRNA, despite a drop in GR protein content in the liver (Vijayan et al., 2003). On the contrary, in the study of Yada et al. (2011), gr1 transcripts in peripheral blood leucocytes had decreased significantly at 24 h, and the same was observed for GR1 and GR2 splenic mRNA levels at 8 h and 24 h after stress. Therefore, it seems that GR response following exposure of an individual fish to stressors is time- and tissue-specific. It may also be assumed that there is a differential expression of GR according to the intensity and severity of the stimuli. The mineralocorticoid receptor (MR) in several vertebrates is mainly activated by mineralocorticoids (aldosterone and its precursor deoxycorticosterone) and to a lesser extent by corticosterone and cortisol. However, as teleosts lack aldosterone, cortisol is the main ligand of MR. In this study there was no effect of acute stress on MR transcripts while there was a significant upregulation in high intensity chronicallystressed fish. MR expression levels were upregulated in the brain and head kidney tissues of rainbow trout following short-term (1 day)

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

U

N C O

R

R

E

C

concentrations of acutely-stressed fish, as well as a reflection of the intensity of chronic stress on brain mRNA levels, indicating the utility of bdnf as an indicator for stimuli specificity and intensity. A similar overexpression of brain bdnf mRNA levels was reported in adult zebrafish exposed to severe unpredictable stress for 15 days (Chakravarty et al., 2013). In actinopterygian fish, the pallium in the forebrain seems to be homologous to the hippocampus, amygdala and neocortex of tetrapods. Therefore, the results here may be explained by the fact that the gene expression study was run on whole brain homogenates. The immediate early gene c-fos is considered a powerful indirect marker of neuronal activation, as well as a useful tool for mapping brain regions following exposure of an animal to stress (Figueiredo et al., 2002; Herman, 1999; Kovacs, 1998). In general, over expression of c-fos mRNA is a marker of recent neuron activity. This study found a significant upregulation of brain c-fos 15 to 30 min after the application of acute stressors and following exposure of zebrafish to chronic stress, regardless of stimuli intensity, which is in accordance with several studies conducted on rats, where there was a significant upregulation of c-fos transcripts in several brain areas following exposure to emotional or restraint stress (de Medeiros et al., 2005; Figueiredo et al., 2002; Sudakov et al., 2001), and indicative of the utility of c-fos as a marker of chronic stress, even of a mild nature.

582 583

5. Conclusion

604

O

R O

P

584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603

605

Acknowledgements

625

The research received partial funding from the European Union Seventh Framework Programme (FP7/2010–2014) under grant agreement n° [265957]. We would like to thank Mr. G. Skouradakis for his valuable assistance in fish husbandry.

626

References

630

Agulleiro MJ, Sánchez E, Leal E, Cortés R, Fernández-Durán B, Guillot R, et al. Molecular characterization and functional regulation of melanocortin 2 receptor (MC2R) in the sea bass. A putative role in the adaptation to stress. PLoS ONE 2013;8(5): e65450. http://dx.doi.org/10.1371/journal.pone.0065450. Alsop D, Vijayan MM. Development of the corticosteroid stress axis and receptor expression in zebrafish. Am J Physiol Regul Integr Comp Physiol 2008;294(3): R711–9. Alsop D, Vijayan MM. Molecular programming of the corticosteroid stress axis during zebrafish development. Comp Biochem Physiol 2009;153A:49–54. Aluru SL, Bernier NG. Molecular characterization, tissue-specific expression, and regulation of melanocortin 2 receptor in rainbow trout. Endocrinology 2007;149:4577–88. Auperin B, Baroiller JF, Ricordel MJ, Fostier A, Prunet P. Effect of confinement stress on circulating levels of growth hormone and two prolactins in freshwater-adapted tilapia (Oreochromis niloticus). Gen Comp Endocrinol 1997;108(1):35–44.

631 632 633 634 635 636 637 638 639 640 641 642 643 644

D

In conclusion, we developed realistic acute and unpredictable longterm stress protocols, based on husbandry and environmental stressors and physical, chemical, mechanical and social stimuli that fish may experience either in nature or under intensive rearing conditions. The developed protocols provide useful information about the cortisol pattern of changes and the molecular correlates of the effects of stressors of different nature, duration and relative intensity. Changes in gene transcripts related to the HPI axis were in accordance with the classical adaptive mechanism following exposure to stressors, involving rapid hypothalamic neuronal release of CRF, production of ACTH, activation of MC2 receptor, cortisol synthesis in the interrenal tissue and feedback regulation. Zebrafish are tolerant to ordinary environmental and husbandry stimuli of relatively lower intensity as indicated by behavioural, hormonal (cortisol) and molecular data. The significant overexpression of bdnf and c-fos in zebrafish exposed to the relatively low-grade protocol (SP-1) may indicate either a protective mechanism even under mild stimuli or the necessary allostatic load to avoid hypostimulation. Fish exposed to relatively higher-grade long-term stressors showed elevated cortisol levels as well as significant changes in most of gene transcripts, resembling an anxiety status.

E

T

slow-release cortisol implantation, and in gills and skin at 5 days after the implantation (Teles et al., 2013). In European sea bass larvae and 518 immature juvenile fish, there was no effect of acute or mild chronic 519 stress, respectively, on MR transcripts (Tsalafouta et al., 2014). 520 In lower vertebrates, prolactin (PRL) plays a major role in osmoreg521 ulation. PRL and cortisol are well established as important hormones for 522 freshwater and sea water, respectively, adaptation in euryhaline teleost 523 species. In addition, PRL has an intrinsic role in the activation of the HPA 524 and HPI axes (Lovejoy, 2005). An hour or 24-hour confinement test in 525 tilapia (Oreochromis niloticus) resulted in a significant rise in plasma 526 cortisol concentrations and in the levels of two tilapia PRL forms 527 (Auperin et al., 1997). On the contrary, chronic confinement of rainbow 528 trout, accompanied by a deterioration of water quality, led to a signifi529 cant elevation of plasma cortisol and decrease of PRL concentrations 530 (Pottinger et al., 1992b). Surprisingly there are no data on the effect of 531 stress on whole-body prolactin concentrations or PRL mRNA transcripts 532 in zebrafish. This study showed that both acute and high-intensity 533 chronic stress result in an upregulation of PRL transcripts, providing 534 evidence for the significance of PRL in the regulation of stress response 535 in fresh water teleosts. 536 Several neuropeptides are also important mediators of the allostatic 537 load and stress response in vertebrates. Arginine vasotocin acts syner538 gistically with corticotrophin-releasing hormone (CRH) to promote 539 ACTH release (Lamberts et al., 1984). No significant effect of acute stress 540 on avt transcripts was found in this study; similar results were obtained 541 Q22 by Fuzzen et al. (2009) in vortex-stressed adult zebrafish. In addition, 542 there was no effect of unpredictable chronic stress on avt mRNA levels, 543 indicating that brain AVT is stressor-specific and associated with social 544 (dominant–subordinate) behaviour rather than physical, chemical and 545 Q23 husbandry stressors (Fuzzen et al., 2009; Larson et al., 2006; Pavlidis 546 et al., 2011). The hypocretin/orexin (HCRT) system plays an important 547 role in the regulation of food intake, energy homeostasis thermoregula548 tion, coupling metabolic state with behavioural state, arousal, consoli549 dation of waking, mood, addiction and sleep control physiology. 550 Recently it has been shown that HCRT plays an important role under 551 high-arousal conditions, including stress and need for action (Berridge 552 et al., 2010; Johnson et al., 2012). In zebrafish larvae, the overexpression 553 of HCRT, by promoting wakefulness and inhibiting rest, induced an 554 insomnia-like phenotype (Prober et al., 2006). The present study 555 showed an overexpression of HCRT mRNA in zebrafish exposed to 556 both acute and chronic stress of high intensity. Therefore brain HCRT 557 may be a useful stress indicator to define the allostatic load in zebrafish. 558 HCRT function in the stress response may be exerted through the 559 aminergic and cholinergic systems (Kaslin et al., 2004) or through CRF 560 action on hypocretin neurons (Johnson et al., 2012). 561 Brain-derived neurotropic factor (BDNF), a peptide important in 562 depression, drug addiction and ageing, also plays a critical role in stress 563 resistance and chronic resilience (Taliaz et al., 2011). GR controls ex564 pression of the bdnf gene in the brain (Goujon et al., 1997; Morsink 565 Q11 et al., 2006; Schulkin et al., 1998; Schulte-Herbrüggen et al., 2006) and 566 bdnf regulates CRH homeostasis (Jeanneteau et al., 2012). Chronic 567 immobilization stress causes over expression of bdnf mRNA in the rat pi568 neal gland (Dagnino-Ubiabre et al., 2006). Similarly, acutely-stressed 569 rats (forced swimming in 4 °C water for 10 min) displayed a rapid up570 regulation of hippocampal BDNF mRNA, with a maximum expression 571 occurring after 15 min of stress (Shi et al., 2010). However, chronic 572 mild repeated stress resulted in a decrease in bdnf mRNA and protein 573 levels (Shi et al., 2010). On the contrary, rats exposed to several unpre574 dictable mild stressors for a period of four weeks showed increased 575 hippocampal BDNF expression in the young (but not adult) in relation 576 to prolonged high corticosterone secretion (Taliaz et al., 2011). In addi577 tion, it is evident that there is a stress-induced structural plasticity on 578 the same behavioural stress, with important differences in bdnf expres579 sion between the rat hippocampus and amygdala (Lakshminarasimhan 580 and Chattarji, 2012). This study found a significant upregulation in bdnf 581 transcripts concomitant in duration with the increase in trunk cortisol

F

516 517

9

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624

627 628 629

D

P

R O

O

F

McEwen BS. Protective and damaging effects of stress mediators. N Engl J Med 1998;338: 171–9. McEwen BS. Allostasis and allostatic load: implications for neuropsychopharmacology. Neuropsychopharmacology 2000;22(2):108–24. McEwen BS, Wingfield JC. The concept of allostasis in biology and biomedicine. Horm Behav 2003;43(1):2–15. McGonnell JM, Fowke RC. Fishing for gene function — endocrine modeling in the zebrafish. J Endocrinol 2006;189:425–39. Metz JR, Geven EJW, van den Burg EH, Flik G. ACTH, α-MSH and control of cortisol release: cloning, sequencing and functional expression of the melanocortin-2 and melanocortin-5 receptor in Cyprinus carpio. Am J Physiol 2005;289:R814–26. Morsink MC, Steenbergen PJ, Vos JB, Karst H, Joëls M, De Kloet ER, et al. Acute activation of hippocampal glucocorticoid receptors results in different waves of gene expression throughout time. J Neuroendocrinol 2006;18(4):239–52. Novak CM, Jiang X, Wang C, Teske JA, Kotz CM, Levine JA. Caloric restriction and physical activity in zebrafish (Danio rerio). Neurosci Lett 2005;383(1–2):99–104. O'Connor TM, O'Halloran DJ, Shanahan F. The stress response and the hypothalamic– pituitary–adrenal axis: from molecule to melancholia. Q J Med 2000;93:323–33. Parker MO, Millington ME, Combe FJ, Brennan CH. Housing conditions differentially affect physiological and behavioural stress responses of zebrafish, as well as the response to anxiolytics. PLoS ONE 2012;7(4):e34992. Pavlidis M, Sundvik M, Chen Yu-Chia, Panula P. Adaptive changes in zebrafish brain in dominant–subordinate behavioural context. Behav Brain Res 2011;225(2):529–37. Pavlidis M, Digka N, Theodoridi A, Campo A, Barsakis K, Skouradakis G, et al. Husbandry of zebrafish, Danio rerio, and the cortisol stress response. Zebrafish 2013;10(4):524–31. Piato AL, Capiotti KM, Tamborski AR, Oses JP, Barcellos LJ, Bogo MR, et al. Unpredictable chronic stress model in zebrafish (Danio rerio): behavioral and physiological responses. Prog Neuropsychopharmacol Biol Psychiatry 2011;35:561–7. Pottinger TG, Calder GM. Physiological stress in fish during toxicological procedures — a potentially confounding factor. Environ Toxicol Water 1995;10:135–46. Pottinger TG, Carrick TR. Modification of the plasma cortisol response to stress in rainbow trout by selective breeding. Gen Comp Endocrinol 1999;116:122–32. Pottinger TG, Pickering AD, Hurley MA. Consistency in the stress response of individuals of two strains of rainbow trout, Oncorhynchus mykiss. Aquaculture 1992a;103: 275–89. Pottinger TG, Prunet P, Pickering AD. The effects of confinement stress on circulating prolactin levels in rainbow trout (Oncorhynchus mykiss) in fresh water. Gen Comp Endocrinol 1992b;88(3):454–60. Prober DA, Rihel J, Onah AA, Sung RJ, Schier AF. Hypocretin/orexin overexpression induces an insomnia-like phenotype in zebrafish. J Neurosci 2006;26(51):13400–10. Ramsay JM, Feist GW, Varga ZM, Westerfield M, Kent ML, Schreck CB. Whole-body cortisol is an indicator of crowding stress in adult zebrafish, Danio rerio. Aquaculture 2006;258:565–74. Ramsay JM, Feist GW, Varga ZM, Westerfield M, Kent ML, Schreck CB. Whole-body cortisol response of zebrafish to acute net handling stress. Aquaculture 2009;297: 157–62. Romero LM, Dickens MJ, Cyr NE. The reactive scope model — a new model integrating homeostasis, allostasis and stress. Horm Behav 2009;55:375–89. Schaaf MJM, Champagne D, van Laanen IHC, van Wijk DCWA, Meijer AH, Meijer OC, et al. Discovery of a functional glucocorticoid receptor b-isoform in zebrafish. Endocrinology 2008;149(4):1591–9. Schaaf MJM, Chatzopoulou A, Spaink HP. The zebrafish as a model system for glucocorticoid receptor research. Comp Biochem Physiol A Mol Integr Physiol 2009;153(1): 75–82. Schulkin J, Gold PW, McEwen BS. Induction of corticotropin-releasing hormone gene expression by glucocorticoids: implication for understanding the states of fear and anxiety and allostatic load. Psychoneuroendocrinology 1998;23(3):219–43. Schulte-Herbrüggen O, Chourbaji S, Ridder S, Brandwein C, Gass P, Hörtnagl H, et al. Stress-resistant mice overexpressing glucocorticoid receptors display enhanced BDNF in the amygdala and hippocampus with unchanged NGF and serotonergic function. Psychoneuroendocrinology 2006;31(10):1266–77. Schweizer MC, Henniger MS, Sillaber I. Chronic mild stress (CMS) in mice: of anhedonia, ‘anomalous anxiolysis’ and activity. PLoS ONE 2009;4:e4326. Selye H. A syndrome produced by diverse nocuous agents. Nature 1936;138:32. Selye H. The general adaptation syndrome and the diseases of adaptation. J Clin Endocrinol 1946;6(2):117–230. Shi SS, Shao SH, Yuan BP, Pan F, Li ZL. Acute stress and chronic stress change brain-derived neurotrophic factor (BDNF) and tyrosine kinase-coupled receptor (TrkB) expression in both young and aged rat hippocampus. Yonsei Med J 2010;51(5):661–71. Shrimpton JM, Randall DJ. Downregulation of corticosteroid receptors in gills of coho salmon due to stress and cortisol treatment. Am J Physiol 1994;267:R432–8. Sigurgeirsson B, Porsteinsson H, Sigmundsdóttir S, Lieder R, Sveinsdóttir HS, Sigurjónsson OE, et al. Sleep-wake dynamics under extended light and extended dark conditions in adult zebrafish. Behav Brain Res 2013;256:377–90. Sterling P, Eyer J. Allostasis: a new paradigm to explain arousal pathology. In: Fisher S, Reason J, editors. Handbook of life stress, cognition and health. New York: John Wiley & Sons; 1988. p. 629–49. Stolte EH, van Kemenade BM, Savelkoul HF, Flik G. Evolution of glucocorticoid receptors with different glucocorticoid sensitivity. J Endocrinol 2006;190(1):17–28. Stolte EH, de Mazon AF, Leon-Koosterziel KM, Jesiak M, Bury NR, Sturm A, et al. Corticosteroid receptors involved in stress regulation in common carp, Cyprinus carpio. J Endocrinol 2008;198(2):403–17. Sudakov KV, Umryukhin PE, Koplik EV, Anokhin KV. Expression of the c-fos gene during emotional stress in rats: the clocking effect of delta sleep-inducing peptide. Neurosci Behav Physiol 2001;31(6):635–40. Tache J, Selye H. On stress and coping mechanisms. Issues Ment Health Nurs 1985;7:3–24.

N

C

O

R

R

E

C

T

Barcellos LJG, Ritter F, Kreutz LC, Quevedo RM, Silva LB, Bedin AC, et al. Whole-body cortisol increases after direct and visual contact with a predator in zebrafish, Danio rerio. Aquaculture 2007;272:774–8. Barton BA. Stress in fishes: a diversity of responses with particular reference to changes in circulating corticosteroids. Comp Biol 2002;42:517–25. Barton BA, Iwama GK. Physiological changes in fish from stress in aquaculture with emphasis on the response and effects of corticosteroids. Annu Rev Fish Dis 1991;1:3–26. Bencan Z, Sledge D, Levin ED. Buspirone, chlordiazepoxide and diazepam effects in a zebrafish model of anxiety. Pharmacol Biochem Behav 2009;94(1):75–80. Berridge CW, España RA, Vittoz NM. Hypocretin/orexin in arousal and stress. Brain Res 2010;1314:91–102. Bury NR, Sturm A, Le Rouzic P, Lethimonier C, Ducouret B, Guiguen Y, et al. Evidence for two distinct functional glucocorticoid receptors in teleost fish. J Mol Endocrinol 2003;31(1):141–56. Chakravarty S, Reddy BR, Sudhakar SR, Saxena S, Das T, Meghah V, et al. Chronic unpredictable stress (CUS)-induced anxiety and related mood disorders in a zebrafish model: altered brain proteome profile implicates mitochondrial dysfunction. PLoS ONE 2013;8(5):e63302. Coste SC, Murray SE, Stenzel-Poore M. Gene targeted animals with alterations in corticotrophin pathways: new insights into allostatic control. In: Steckler T, Kalin NH, Reul JMHM, editors. Handbook of stress and the brain part 2: stress: integrative and clinical aspects. Elsevier B.V; 2005. p. 51–74. Dagnino-Ubiabre A, Zepeda-Carreño R, Díaz-Véliz G, Mora S, Aboitiz F. Chronic immobilization stress induced upregulation of BDNF mRNA and integrin α5 expression in the rat pineal gland. Brain Res 2006;1086(1):27–34. Dahlbom SJ, Lagman D, Lundstedt-Enkel K, Sundstrom LF, Winberg S. Boldness predicts social status in zebrafish (Danio rerio). PLoS ONE 2011;6(8):e23565. de Medeiros MA, Carlos Reis L, Eugênio Mello L. Stress-induced c-Fos expression is differentially modulated by dexamethasone, diazepam and imipramine. Neuropsychopharmacology 2005;30(7):1246–56. Dhanasiri AKS, Fernandes JMO, Kiron V. Acclimation of zebrafish to transport stress. Zebrafish 2013;10(1):87–98. Egan RJ, Bergner CL, Hart PC, Cachat JM, Canavello PR, Elegante MF, et al. Understanding behavioral and physiological phenotypes of stress and anxiety in zebrafish. Behav Brain Res 2009;205:38–44. Fanouraki E, Mylonas CC, Papandroulakis N, Pavlidis M. Species specificity in the magnitude and duration of the acute stress response in Mediterranean marine fish in culture. Gen Comp Endocrinol 2011;173:313–22. Figueiredo HF, Dolgas CM, Herman JP. Stress activation of cortex and hippocampus is modulated by sex and stage estrus. Endocrinology 2002;143(7):2534–40. Fuzzen ML, Van der Kraak G, Bernier NJ. Stirring up new ideas about the regulation of the hypothalamic–pituitary–interrenal axis in zebrafish (Danio rerio). Zebrafish 2010; 7(4):349–58. Goujon E, Layé S, Parnet P, Dantzer R. Regulation of cytokine gene expression in the central nervous system by glucocorticoids: mechanisms and functional consequences. Psychoneuroendocrinology 1997;22(S1):875–80. Herman JP. Neurocircuit control of the hypothalamo-pituitary-adrenocortical axis during stress. Curr Opin Endocrinol Diabetes 1999;6:3–9. Holsboer F. The corticosteroid receptor hypothesis of depression. Neuropsychopharmacology 2000;23:447–501. Iwama GK, Pickering AD, Sumpter JP, Schreck CB. Fish stress and health in aquaculture. UK: Cambridge University Press; 1997. Jeanneteau FD, Lambert WM, Ismaili N, Bath KG, Lee FS, Garabedian MJ, et al. BDNF and glucocorticoids regulate corticotrophin-releasing hormone (CRH) homeostasis in the hypothalamus. PNAS 2012;109(4):1305–10. Johnson PL, Molosh A, Truitt WA, Fitz SD, Shekhar A. Orexin, stress and anxiety/panic states. Prog Brain Res 2012;198:133–61. Kaslin J, Nystedt JM, Ö stergård M, Peitsaro N, Panula P. The orexin/hypocretin system in zebrafish is connected to the aminergic and cholinergic systems. J Neurosci 2004; 24(11):2678–89. Klovins J, Haitina T, Fridmanis D, Kilianova Z, Kapa I, Fredriksson R, et al. The melanocortin system in Fugu: determination of POMC/AGRP/MCR gene repertoire and synteny, as well as pharmacology and anatomical distribution of the MCRs. Mol Biol Evol 2004; 21:563–79. Koolhaas JM, Korte SM, De Boer SF, Van Der Vegt BJ, Van Reenen CG, Hopster H, et al. Coping styles in animals: current status in behavior and stress-physiology. Neurosci Biobehav Rev 1999;23:925–35. Korte SM, Olivier B, Koolhaas JM. A new animal welfare concept based on allostasis. Physiol Behav 2007;92:422–8. Kovacs KJ. c-Fos as transcription factor: a stressful (re)view from a functional map. Neurochem Int 1998;33:287–97. Lakshminarasimhan H, Chattarji S. Stress leads to contrasting effects on the levels of brain derived neurotrophic factor in the hippocampus and amygdala. PLoS ONE 2012;7(1): e30481. Lamberts SW, Verleun T, Oosterom R, de Jong F, Hackeng WH. Corticotropin releasing factor (ovine) and vasopressin exert a synergistic effect on adrenocorticophin release in man. J Clin Endocrinol Metab 1984;58:298–303. Larson ET, O'Malley DM, Melloni Jr RH. Aggression and vasotocin are associated with dominant-subordinate relationships in zebrafish. Behav Brain Res 2006;167(1):94–102. Levin ED, Bencan Z, Cerutti DT. Anxiolytic effects of nicotine in zebrafish. Physiol Behav 2007;90(1):54–8. Lovejoy DA. Neuroendocrinology: an integrated approach. West Sussex, England: John Wiley & Sons Ltd; 2005. Magalhães DdP, Buss DF, da Cunha RA, Linde-Arias AR, Baptista DF. Analysis of individual versus group behavior of zebrafish: a model using pH sublethal effects. Bull Environ Contam Toxicol 2012;88:1009–13.

U

645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

E

10

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816

M. Pavlidis et al. / Progress in Neuro-Psychopharmacology & Biological Psychiatry xxx (2015) xxx–xxx

817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833

Taliaz D, Loya A, Gersner R, Haramati S, Chen A, Zangen A. Resilience to chronic stress is mediated by hippocampal brain-derived neurotrophic factor. J Neurosci 2011; 31(12):4475–83. Teles M, Tridico R, Callol A, Fierro-Castro C, Tort L. Differential expression of the corticosteroid receptors GR1, GR2 and MR in rainbow trout organs with slow release cortisol implants. Comp Biochem Physiol A Mol Integr Physiol 2013;164(3):506–11. Terova G, Gornati R, Rimoldi S, Bernardini G, Saroglia M. Quantification of a glucocorticoid receptor in sea bass (Dicentrarchus labrax, L.) reared at high stocking density. Gene 2005;357:144–51. Tort L, Pavlidis MA, Woo NYS. Stress and welfare in sparid fishes. Sparidae. WileyBlackwell; 2011. p. 75–94. Tsalafouta A, Papandroulakis N, Gorissen M, Katharios P, Flik G, Pavlidis M. Ontogenesis of the HPI axis and molecular regulation of the cortisol stress response during early development in Dicentrarchus labrax. Sci Rep 2014;4:5525. http://dx.doi.org/10. 1038/srep05525. Vazzana M, Vizzini A, Sanfratello MA, Celi M, Salerno G, Parrinello N. Differential expression of two glucocorticoid receptors in seabass (teleost fish) head kidney after

11

exogeneous cortisol inoculation. Comp Biochem Physiol A Mol Integr Physiol 2010; 157:49–54. Vijayan MM, Raptis S, Sathiyaa R. Cortisol treatment affects glucocorticoid receptor and glucocorticoid-responsive genes in the liver of rainbow trout. Gen Comp Endocrinol 2003;132(2):256–63. Von Krogh K, Sorensen C, Nilsson G, Overli O. Forebrain cell proliferation, behaviour, and physiology of zebrafish, Danio rerio, kept in enriched or barren environments. Physiol Behav 2010;101:32–9. Wendelaar Bonga SE. The stress response in fish. Physiol Rev 1997;77:591–625. Willner P. Chronic mild stress (CMS) revisited: Consistency and behavioural– neurobiological concordance in the effects of CMS. Neuropsychobiology 2005;52: 90–110. Yada T, Azuma T, Hyodo S, Hirano T, Grau EG, Schreck CB. Differential expression of corticosteroid receptor genes in rainbow trout (Oncorhynchus mykiss) immune system in response to acute stress. Can J Fish Aquat Sci 2011;64(10):1382–9.

U

N C O

R

R

E

C

T

E

D

P

R O

O

F

849

Please cite this article as: Pavlidis M, et al, Neuroendocrine regulation of the stress response in adult zebrafish, Danio rerio, Prog NeuroPsychopharmacol Biol Psychiatry (2015), http://dx.doi.org/10.1016/j.pnpbp.2015.02.014

834 835 836 837 838 839 840 841 842 843 844 845 846 847 848