Fish Physiol Biochem (2014) 40:1639–1650 DOI 10.1007/s10695-014-9954-3
Molecular cloning, characterization, and expression analysis of luteinizing hormone receptor gene in turbot (Scophthalmus maximus) Yudong Jia • Zhen Meng • Huaxin Niu Peng Hu • Jilin Lei
•
Received: 6 April 2014 / Accepted: 16 June 2014 / Published online: 26 June 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract The luteinizing hormone receptor (LHR) plays a crucial role in female reproduction. In the present study, full-length sequence coding for the LHR was obtained from female turbot (Scophthalmus maximus) by homology cloning and a strategy based on rapid amplification of cDNA end-polymerase chain reaction. The full-length LHR cDNA was 3,184 bp long and contained a 2,058-bp open reading frame which encoded a protein of 685 amino acids. Multiple sequence alignments of the turbot LHR manifested high homologies with the corresponding sequences of available teleosts and representative vertebrates, and significant homology with that of Hippoglossus hippoglossus. In addition, the turbot LHR showed typical
Yudong Jia and Zhen Meng have contributed equally to this work. Y. Jia Z. Meng P. Hu J. Lei (&) Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, No. 106 Nanjing Road, Qingdao 266071, People’s Republic of China e-mail: [email protected]; [email protected] Y. Jia Z. Meng P. Hu J. Lei Qingdao Key Laboratory for Marine Fish Breeding and Biotechnology, Qingdao 266071, People’s Republic of China H. Niu School of Animal Science and Technology, Inner Mongolia University for the Nationalities, Tongliao 028042, People’s Republic of China
characteristics of glycoprotein receptors, including a long N-terminal extracellular domain, seven transmembrane domains, and a short C-terminal intracellular domain. LHR mRNA was abundant in the ovary, but was deficient in extra-ovarian tissues. Furthermore, LHR mRNA gradually developed from previtellogenesis to migratory nucleus stage, with the highest values observed in migratory nucleus stage during reproductive cycle. However, LHR mRNA sharply decreased in atresia stage. These results suggested that LHR is a typical G protein-coupled receptor that is involved in the promotion of turbot ovarian development and may be related to the final maturation and ovulation of oocyte. These findings contribute to the understanding of the potential roles of LHR in controlling the fish reproductive cycle. Keywords Luteinizing hormone receptor mRNA expression Reproduction Turbot (Scophthalmus maximus)
Introduction The reproductive cycle is essentially regulated by the brain–pituitary–gonadal axis in vertebrates (Fortune 1994; Nocillado and Elizur 2008; Sower et al. 2009; Chaffin and Vandevoort 2013). Pituitary-derived gonadotropins are essential in the regulation of gametogenesis and in the production of steroid
123
1640
hormones in the gonads. Gonadotropins are heterodimeric glycoprotein hormones, and they act on gonadal tissue by binding their specific receptors, folliclestimulating hormone receptor (FSHR), and luteinizing hormone receptor (LHR). These receptors are primarily expressed on the surface of gonadal somatic cells and are involved in the regulation of gametogenesis via distinct intracellular signaling pathways (Menon and Menon 2012). The gonadotropin receptors (GtHRs) molecules have already been cloned, and their physiological roles in mammals, chicken, and some teleost fish have been clarified (Johnson et al. 1996; Akazome et al. 2002; Kobayashi et al. 2008; Mittelholzer et al. 2009; Liang et al. 2012; Ohkubo et al. 2013). Two classes of GtHRs namely type I (GtH-RI) and type II (GtH-RII) are found in fish gonads, and they correspond to the FSHR and LHR in mammals and chicken (Oba et al. 2001; Levavi-Sivan et al. 2010). Similar to evolved vertebrates, fish GtHRs belong to the superfamily of G protein-coupled receptors (GPCRs), which are complex transmembrane rhodopsin-like proteins characterized by seven hydrophobic helices inserted in the plasmalemma and by intracellular and extracellular domains of varying dimensions depending on the type of ligand. Ligand specificity of mammalian GtHRs is well defined and has no occurring cross-activation under physiological conditions (Tilly et al. 1992; Moyle et al. 1994; Bogerd 2007). However, molecular biological studies have demonstrated that GtH-RI (FSHR) is located on both the theca and granulosa cells and binds both FSH and LH, and GtH-RII (LHR) specifically binds LH and is only located on the granulosa cells in a number of teleost species (Oba et al. 1999a, b; Vischer and Bogerd 2003; Maugars and Schmitz 2006; Rocha et al. 2007; Kobayashi and Andersen 2008). Moreover, the two receptors display distinct expression profiles in repetitive and annual spawning fish during the reproductive cycle (Kumar et al. 2001a, b; Kwok et al. 2005; Kobayashi et al. 2008; Andersson et al. 2013). In several mammalian species and domestic hen, FSHR mRNA and protein levels have been reported to decrease with increasing follicular size, while LHR expression increases in the granulosa cells as follicles grow (Zhang et al. 1997; Bao and Garverick 1998; Hillier 2001). Therefore, knowledge of the molecular structure, function, and gene regulation of the GtHRs is imperative for a better understanding of
123
Fish Physiol Biochem (2014) 40:1639–1650
reproductive physiology which can be used to manipulate teleost reproduction. Turbot (Scophthalmus maximus) is a widely cultured marine fish of considerable commercial value in Europe and China. Much effort has been conducted on nutritional requirements, hormonal induction of spawning, and environmental conditions of female turbot during reproductive cycle (Jones 1974; Mcevoy 1989; Suquet et al. 1995; Bromley et al. 2000; Jia et al. 2014). Females can reach maturity at 3 years of age. Mature female turbot spawn multiple times during the reproductive season. The natural reproductive season occurs in spring and early summer, between April and August, but can be extended throughout the year by manipulating photoperiod and temperature in captivity (Girin and Devauchelle 1978). However, the captive turbot did not spawn naturally, and so eggs were hand-stripped from ripe fish and artificially fertilized. The maturation of oocytes was monitored by taking eggs from ovaries prior to the spawning period (Mcevoy, 1984). Ovulatory rhythms were determined based on the first ovulation date by using daily abdominal stripping at the start of the spawning season. This procedure was performed to ensure that fresh ovulated eggs were obtained and to prevent overripening. Due to their ovulatory cycles of 70–90 h, each female could spawn 8–12 times at 3–5 days intervals throughout the spawning season in artificial broodstock (Mugnier et al. 2000). The use of exogenous hormones is an effective way to induce reproductive maturation and produce large fertilized eggs in captivity. Hormonal manipulations of the reproductive function in cultured turbot mainly focus on the use of either the exogenous luteinizing hormone (LH) preparations that act directly at the level of the gonad or the synthetic agonists of gonadotropin-releasing hormone (GnRHa) that acts on the pituitary to induce the release of the endogenous LH, which in turn acts on the gonad to induce steroidogenesis and oocyte maturation. However, knowledge on the molecular mechanisms regulating the asynchronous development of multiple batches of oocytes in this species and information on the functional characterization of LHR in the ovary during reproductive cycle are limited. Therefore, the present study was conducted to clone and characterize LHR from the turbot ovarian tissue. In addition, the turbot LHR expression profiles were evaluated during the reproductive cycle.
Fish Physiol Biochem (2014) 40:1639–1650
1641
Table 1 Primer sequences used in this study Primers
Primer sequence 50 -30
Purpose used
LHRF0
TGGCTGTAATGGTTATTCTGCT
cDNA fragment of LHR
LHRR0
GTTGGTGATGGTGTGGCAGCGT
cDNA fragment of LHR
Long primer Short primer
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC
RACE RACE
LHRGSP1
CACATGAGAAACCTGGAGATGG
50 -RACE
LHRGSP2
TACTACAACCACGCCACGGACT
30 -RACE
LHRF
GCTCCTCCTCAACATCCTGG
qRT-PCR
LHRR
TGCGGACAGTCAGATAGATGCT
qRT-PCR
b-actinF
TGAACCCCAAAGCCAACAGG
qRT-PCR
b-actinR
CAGAGGCATACAGGGACAGCAC
qRT-PCR
Materials and methods Fish and tissue sampling Sexually mature females were anesthetized with 100 mg/L tricaine methane sulfonate (MS-222, Sigma, St. Louis, MO). Tissues from the eye, stomach, intestine, gill, heart, spleen, kidney, brain, muscle, ovary, and liver were collected from each fish. The specimens were snap-frozen in liquid nitrogen or preserved in RNAstore Reagent (Tiangen Biotech, Beijing, China) and stored at -80 °C until RNA extraction. Ovaries were fixed in Bouin’s solution for hematoxylin and eosin (HE) staining in order to identify the oocyte developmental stages. LHR gene cloning Total RNA was extracted with Trizol reagent (Invitrogen) from ovary of turbot according to the manufacturer’s protocol. The quality and quantity of total RNA were analyzed on 1 % agarose gel electrophoresis and using a UV spectrophotometer. Approximately 200 ng of the total RNA was incubated with 1 unit of deoxyribonuclease I (Nippon Gene) at 37 °C for 15 min and then reverse-transcribed to the singlestranded cDNA using SMARTTM rapid amplification of cDNA end (RACE) cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions. According to the conserved sequences of the LHR gene from other teleost species, a pair of degenerate
primers, LHRF0 and LHRR0, was designed to the cloning of the corresponding partial fragment of LHR cDNA. Polymerase chain reaction (PCR) cycling conditions were as follows: denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 1 min for 32 cycles. Based on the obtained partial nucleotide sequence of LHR, two specific primers (LHRGSP1 and LHRGSP2) were designed for the amplification of the cDNA ends of the LHR gene using the SMARTTM RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) following the manufacturer’s instructions. LHRGSP1 and LHRGSP2 were used to amplify the 50 and 30 -ends, respectively. The universal primer (UPM) used for the 50 - and 30 -RACE comprised a mixture of long and short primers (from SMARTTM RACE cDNA Amplification Kit, Clontech). The above primers are listed in Table 1. Sequence analysis The translation initiation ATG and the primary structure of the LHR were deduced using the open reading frame (ORF) finder available at the NCBI (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Signal peptides, potential N-linked glycosylation sites, and potential phosphorylation sites were identified using SignalP 4.0 (http://www.cbs.dtu.dk/services/SignalP/), NetNGlyc 1.0 (http://www.cbs.dtu.dk/services/NetNGlyc/), and NetPhos 2.0 (http://www.cbs.dtu.dk/services/ NetPhos/), respectively. The structural features of LHR were analyzed using ProtParam (http://web. expasy.org/protparam/), PHD program (http://www.
123
1642
123
Fish Physiol Biochem (2014) 40:1639–1650
Fish Physiol Biochem (2014) 40:1639–1650 b Fig. 1 Nucleotide (upper line) and deduced amino acid (lower
line) sequences of the turbot LHR. The start codon (ATG) was boxed, and the stop codon (TGA) was marked with an asterisk. The signal peptide sequence and the polyA signal in 30 UTR are underlined. The position of the seven predicted transmembrane domain is showed as black box (369–391aa, 398–420 aa, 442–464 aa, 485–507 aa, 531–553 aa, 574–596 aa, 611–633 aa). Putative core b strands of LRRs regions are indicated with arrows. Cysteine residues are indicated by filled diamond, and two conserved cysteins (441C and 516C), predicted to form an intramolecular disulfide bond, are indicated by filled inverted triangle. Predicted consensus phosphorylation sites are indicated by filled triangle (protein kinase C) and filled square (casein kinase II). Potential N-glycosylation sits is indicated by filled circle
predictprotein.org), Smart (http://smart.embl-heidelberg. de/), and TMHMM Server 2.0 (http://www.cbs.dtu.dk/ services//TMHMM-2.0/). Multiple alignments of amino acid sequences were obtained by the software ClustalX1.81. A phylogenetic tree was constructed using MEGA4.0 by neighbor-joining (NJ) method. The leucine-rich repeat containing GPCR (LGR) sequence from the caenorhabditis elegans was used as the out-group. Reliability of the NJ tree was assessed by interior branch test, using 1,000 replications. The deduced amino acid sequences of vertebrate LHR were acquired from the Genbank database: Epinephelus coioides, HQ650770; Hippoglossus hippoglossus, EU502845; Salmo salar, AJ579790; Ctenopharyngodon idella, EF194761; Danio rerio, AY714133; Dicentrarchus labrax, AY642114; Sparus aurata, AY587261; Solea senegalensis, GQ472140; Oncorhynchus rhodurus, AB030005; Oncorhynchus mykiss, AF439404; Clarias gariepinus, AF324540; Xenopus laevis, AB602929; Gallus gallus, AB009283; Homo sapiens, S57793; Mouse, M81310.
Quantitative real-time PCR The relative expression of LHR mRNA in terms of tissue distribution and the different oocyte developmental stages was determined using quantitative realtime PCR (qRT-PCR), which was performed on an ABI StepOne Pluse Sequence Detection System (Applied Biosystems, USA) according to the manufacturer’s instructions. The primers LHRF/R and bactinF/R were used to amplifying the LHR and b-actin fragments, respectively (Table 1). A final volume of 20 ll, which contained 10 lL SYBRÒ Premix Ex
1643
TaqTM (Takara Bio., China), 0.8 lL of each primer (10 lM), 0.4 lL ROX Dye (509), 2 lL cDNA sample (25 ng/lL), and 6lL sterile distilled water, was used for amplification. Initial denaturation was conducted at 95 °C for 10 s, followed by 40 cycles at 95 °C for 5 s and at 60 °C for 30 s. A dissociation protocol was performed after thermocycling to determine the target specificity. Turbot b-actin was utilized as the endogenous control. All samples were amplified in triplicates. The LHR gene expression was normalized to bactin and expressed as a folded change relative to the expression level in the control according to the 2-DDCT method (Livak and Schmittgen 2001).
Statistical analysis The experiment was repeated at least thrice for each condition. Data were expressed as mean ± SEM and analyzed by ANOVA and Duncan’s multiple range tests using the SAS 8.0 software. P \ 0.05 was considered to be statistically different.
Results Cloning and characteristics of LHR gene from turbot The full-length cDNA sequence of the LHR was obtained by the 50 and 30 RACE method. The complete cDNA contained a 124-bp 50 -terminal untranslated region (UTR), 2,058-bp ORF (which encoded 685 amino acids), and 1,002-bp 30 -UTR. The 30 -UTR contained two canonical polyadenylylation signals (AATAAA), followed after an additional 11 bp by the poly (A) tail (Fig. 1). Structural analyses revealed that turbot LHR exhibited typical characteristics of a glycoprotein hormone receptor subfamily of GPCRs. The turbot LHR comprised a large extracellular domain with 368 amino acids including a putative signal peptide of 18 amino acids, followed by nine imperfect leucine-rich repeats (LRRs) that formed a flexible hinge region, and a seven transmembrane domain upstream of the short intracellular carboxyterminus (Fig. 1). The extracellular loops between TM II–III and TM IV–V contained a cysteine residue (Cys441 and Cys516) that were assumed to link the extracellular loops via a disulfide bridge (Fig. 1).
123
1644
Fish Physiol Biochem (2014) 40:1639–1650
Fig. 2 Alignment of the amino acid sequence of the turbot LHR (SM-LHR) proteins from various species. Position with [70 % similarity is shaded in light grey, while completely conserved positions are shaded in black. Accessions number: Epinephelus coioides (EC) HQ650770, Gallus gallus (GG)
AB009283, Hippoglossus hippoglossus (HH) EU502845, Mouse (M) M81310, Salmo salar (SS) AJ579790, Xenopus laevis (XL) AB602929, Ctenopharyngodon idella (CI) EF194761, Danio rerio (Z) AY714133
Meanwhile, the N-terminal and C-terminal cysteinerich domains contained eleven and five conserved cysteines residues, respectively. The intracellular loops between TM II–III and TM V–VI, as well as the intracellular C-terminal domain, contained serine residues that may represent potential phosphorylation sites. Three sites within the TM domain were the
consensus sites for the protein kinase C (Ser554 and Ser562) and casein kinase II (Ser424) phosphorylation. The intracellular C-terminal domain consisted of 52 amino acids, including a potential phosphorylation site for protein kinase C at Ser666. According to the predication by the ProtParam program, turbot LHR had a molecular weight of
123
Fish Physiol Biochem (2014) 40:1639–1650
76.54 kDa and a theoretical pI of 7.22. The total number of negatively (Asp ? Glu) and positively (Arg ? Lys) charged residues was 57 and 57, respectively. The instability index of LHR was computed to be 37.72, so it was classified as a stable protein. Phylogenetic analysis and alignment Alignment of the turbot LHR amino acid sequence with other vertebrates showed that the turbot LHR had high homologies with those of other fish species, followed by mouse, chicken, and frog LHRs (Fig. 2). In addition, comparison with paralogous genes FSHR and thyroid-stimulating hormone receptor (TSHR) demonstrated that the turbot LHR protein was closely related to the Hippoglossus hippoglossus proteins in the phylogenetic tree which was constructed by the NJ method (Fig. 3). LHR expression in different tissues LHR expression in the tissues of turbot was analyzed using qRT-PCR. Different expression levels of the LHR mRNA transcript could be detected in all the analyzed tissues (Fig. 4). LHR mRNA was significantly most abundant in the ovary and then in the liver (Fig. 4, P \ 0.05). However, it was deficient in the eyes, intestine, brain, muscle, gill, spleen, stomach, and kidney with no statistically significant difference among these organs (Fig. 4, P [ 0.05). Ovarian developmental stages in females Five stages were observed in the ovarian development of the female turbot on the basis of oocyte morphology. The previtellogenesis stage was characterized by oocyte growth, enlargement of the nucleus (germinal vesicle), and appearance of multiple nucleoli at the periphery of the nucleus (Fig. 5a). The early vitellogenesis stage was characterized by the centralized appearance of spherical, eosinophilic, and vitellogenic yolk granules/globules in the oocyte cells (Fig. 5b). The late vitellogenesis stage was characterized by an increasing accumulation of vitellogenic granules in the oocytes and the start of the nucleic migration toward the periphery of the cell (Fig. 5c). The migratory nucleus stage, vitellogenesis reached its peak, the cell became larger and more hydrated, and
1645
the nucleus migrated toward the periphery of the cell and was in the process of dissolution (Fig. 5d). The oocytes shrunk or collapse during the atresia stage (Fig. 5e). LHR expression during the ovarian developmental stages LHR expression during the ovarian development stages was analyzed using qRT-PCR. LHR expression gradually developed from previtellogenesis to maturation stage, with the highest values observed during migratory nucleus stage (Fig. 6, P \ 0.05). However, LHR expression sharply decreased during the atresia stage (Fig. 6, P \ 0.05).
Discussion The development and maturation of ovarian oocytes are key physiological processes in female reproduction. Oogenesis is strictly regulated by numerous endocrine as well as paracrine factors, particularly the gonadotropins LH and FSH (Lubzens et al. 2010). Considered the most diverse group among vertebrates, fish have dissimilar modes of ovarian development and reproductive strategies. In addition, the physiological role of gonadotropins in teleost is highly controversial (Levavi-sivan et al. 2010). To obtain an in-depth understanding of the events that regulates oocyte final maturation and ovulation, molecular characterization, and quantification of the key gene, LHR was performed. In this study, the cDNA coding for the LHR was cloned from the turbot ovary tissue. Analysis of the nucleotide and deduced amino acid sequence of the turbot LHR reveal that this receptor was highly homologous to vertebrate LHRs and showed typical structural features of glycoprotein receptors. A relatively long extracellular domain with nine imperfect LRRs was followed by a rhodopsin-like seven transmembrane module. LRRs are usually involved in protein–protein interactions and composed of a-helical/b-strands units connected by a turn and arranged in a horseshoe-like configuration (Kobe and Kajava 2001). Moreover, the LRR domain of the LHR was flanked by conserved cysteine clusters, which were thought to be important for ligand binding and receptor expression at the cell surface (Zhang et al. 1996; Moyle et al. 2004; Bogerd 2007). Cys355 was
123
1646
part of a 10-amino acid sequence (residues 352–364, FNPCEDLLGF), located upstream of TM I. This amino acid sequence is important for receptor cell surface expression, as well as for ligand-mediated signaling and is invariably recognized by all members
123
Fish Physiol Biochem (2014) 40:1639–1650
of the glycoprotein hormone receptor family (consensus sequence: FNPCEDIMGY). Residues P354, E356, and D357 of the turbot LHR were found to be essential for signaling and were conserved in all glycoprotein hormone receptors. However, L361 and L 362 were
Fish Physiol Biochem (2014) 40:1639–1650 b Fig. 3 The neighbor-joining phylogenetic tree of vertebrates
based on the amino acid sequence of TSHR, FSHR, and LHR. Accession number: TSHR Danio rerio (NM_001145763.2), TSHR Homo sapiens (AY429111.1), TSHR Gallus gallus (NM_001193589.1), TSHR Macaca mulatta (NM_001195395.1), TSHR Clarias gariepinus (AY129556.1), FSHR Acanthopagrus schlegelii (ABU49599.1), FSHR Dicentrarchus labrax (AY642113.1), FSHR Epinephelus coioides (AEG65826.1), FSHR Hippoglossus hippoglossus (ACB13177.1), FSHR Cynoglossus semilaevis (ACD39387.2), FSHR Oncorhynchus mykiss (AF439405.1), FSHR Clarias gariepinus (AJ012647.2), FSHR Danio rerio (AAP33512.1), FSHR Xenopus laevis (NM_001256260.1), FSHR Gallus gallus (NM_205079.1), FSHR Human (M65085.1), FSHR Mus musculus (NM_013523.3), LHR Xenopus laevis (AB602929), LHR Gallus gallus (AB009283), LHR Homo sapiens (S57793), LHR Mouse (M81310), LHR Hippoglossus hippoglossus (EU502845), LHR Danio rerio (AY714133), LHR Ctenopharyngodon idella (EF194761), LHR Clarias gariepinus (AF324540), LHR Oncorhynchus rhodurus (AB030005), LHR Oncorhynchus mykiss (AF439404), LHR Solea senegalensis (GQ472140), LHR Salmo salar (AJ579790), LHR Sparus aurata (AY587261), LHR Dicentrarchus labrax (AY642114), LHR Epinephelus coioides (HQ650770). The LGR sequence from the caenorhabditis elegans (AF224743.1) was used as the out-group. Bootstrap values (in %) from 1,000 replicates are indicated for each tree node
less conserved and apparently had no significant functions in receptor expression or signal transduction (Alvarez et al. 1999). In the rat LHR, Cys109 and Cys134 are important residues for receptor cell surface expression and hormone binding (Zhang et al. 1996). The two cysteine residues, conserved in the LHRs, are
Fig. 4 Quantitative analyses of LHR mRNA expression in different tissues of turbot. The expression level was analyzed by 2-DDCT method, and the expression of LHR in eye was taken as reference for the expression in the other tissues. The b-actin gene was explored as an internal control. Values represent the mean ± SEM of three experiments for each condition. Bars with different superscripts differ (P \ 0.05, n = 3)
1647
localized in two adjacent b-strands and predicted to form a disulfide bridge. However, the amino acid residue on the similar position as Cys109 was not conserved in the turbot LHR, suggesting that a disulfide bond within this LRR is not strictly necessary to maintain the horseshoe-shaped conformation. Similar results were observed in other fish LHRs (Kobayashi et al. 2008). Furthermore, Cys441 and Cys516 were found to be located in the extracellular loops I and II of the transmembrane domain, which were believed to connect both loops via a disulfide bridge (Levavi-Sivan et al. 2010). The intracellular carboxyterminal domain contained two adjacent cysteine residues (Cys646 and Cys647) that were presumed to be palmitoylated, fixing this domain in the cell membrane. Moreover, three potential N-linked glycosylation sites and four phosphorylation sites were recognized in the N-terminal and carboxy-terminal regions of turbot LHRs, respectively. The NJ phylogenetic tree showed that turbot LHR had significant homology to that of H. hippoglossus. These results indicated the basic structure and characteristics of turbot LHR that were similar to other fish and mammalian species provided additional information on the evolution of the recognition site regarding the structure–function evolution of LHR. Studies have already established that LHR is mainly located on the surface of ovarian cells and involved in mediating ovarian steroidogenesis and ovulation. In addition, it may also affect the follicular development by a complex signal pathway in vertebrates. LHR is also observed in extragonadal tissues, including the reproductive tract, placenta, umbilical cord, and brain, and the putative roles in these tissues are likely related to the binding of LH and hCG (Ziecik et al. 1992; Pakarainen et al. 2007). In teleost, LHR is found in extragonadal tissues, such as the brain, gills, kidneys, and heart (Kwok et al. 2005; Maugars and Schmitz 2006; Rocha et al. 2009; Ohkubo et al. 2013). In the current study, turbot LHR was found to be expressed more abundantly in ovary and less abundant in other tissues, which is in agreement with similar reports in mammals and other fish species (Frazier et al. 1990; Oba et al. 1999a; Rao 2001; Kumar et al. 2001b; Vischer and Bogerd 2003). However, contrary to sea bass and African catfish, the extragonadal LHR expression was remarkable in head kidney and not in liver (Rocha et al. 2007; Vischer and bogerd 2003). The varying LHR expression in diverse extragonadal
123
1648
Fish Physiol Biochem (2014) 40:1639–1650
Fig. 5 Development and types of turbot oocyte in ovarian stage. a Previtellogenesis, arrow indicates nucleoli at the periphery of the germinal vesicle. b Early vitellogenesis, arrow indicates gradually accumulations of yolk granules in the central region of the oocyte. c Late vitellogenesis, arrow indicates the yolk granules almost fill the ooplasm, and the nucleus has not yet
begun to migrate peripherally. d Migratory nucleus, arrow indicates the oocytes, and the yolk granules have attained their maximum size just prior to spawning, and the nucleus is not evident. e Atresia, arrow indicates the oocytes have shrinkage or collapse
tissues may be caused by species-specific, and their significance should be deeply understood via presence of in vivo data on their functionalities. Thus, these results suggest that the turbot LHR is associated with ovarian development and may play a role in female turbot reproduction. The genesis and development of oocytes in teleost fish are a complex physiological event that requires the coordinated action of regulatory molecules that ensure the organization of genetic and nutritional bases for the development of new individuals. Numerous studies have demonstrated that the circulating endocrine and locally acting paracrine and autocrine factors
involve in regulating the various stages of oocyte growth and maturation (van den Hurk and Zhao 2005). Oocyte growth is triggered by gonadotropins, and the subsequent steroidogenic production of estradiol induces vitellogenesis, leading to a noticeable enlargement in oocyte size. Furthermore, gonadotropins involve in regulating the oocyte meiotic resumption and oocyte maturation. Meanwhile, complex hormonal communication between the developing oocyte and its surround follicular cells was observed (Canipari 2000; Magoffin 2005). Most teleost fish species are oviparous and have three main types of ovarian development based on the oocyte’s development (Wallace and Selman 1981; Nagahama and Yamashita 2008). Thus, reproductive strategies and regulation mechanism for oocyte development may differ among teleost fish species. Turbot is a serial spawner, producing multiple egg batches during a reproductive season. Histological observations of the turbot ovary presented here indicated that oocyte maturation undergoes vitellogenesis and similar to other fish species. Moreover, LHR expression was gradually developed from previtellogenic to migratory nucleus stages, and the highest value was observed during the oocyte migratory nucleus stage. Studies on the multiple and group-synchronous spawners Nile tilapia and zebrafish have indicated that LHR expression is mainly correlated with the different phases of follicle development and play a key role in final oocyte maturation and ovulation (Hirai et al. 2002; Kwok et al. 2005). Similar results were observed in European sea bass (Rocha et al. 2009). These results suggested that LHR was involved in the regulation of oocyte development and may stimulate the oocyte maturation and ovulation in turbot during its reproductive cycle.
Fig. 6 Quantitative analyses of LHR mRNA expression in ovarian stages of turbot. The expression level was analyzed by 2-DDCT method, and the expression of LHR in previtellogenesis (Prevtg) was taken as reference for the expression in the other stage. Evtg early vitellogenesis, Latvtg late vitellogenesis, Mignucle migratory nucleus, Atre atresia. Values represent the mean ± SEM of three experiments for each condition. Bars with different superscripts differ (P \ 0.05, n = 3)
123
Fish Physiol Biochem (2014) 40:1639–1650
In conclusion, full-length cDNAs coding for LHR was cloned from the turbot ovary. The cloning and structural characterizations of the LHR provided additional information regarding the conservation of GPCRs among vertebrate classes. Meanwhile, the distribution and expression profiles of LHR confirmed its involvement in oocyte growth, maturation, and final ovulation of turbot. These results strongly suggested that LHR had curial roles in regulating turbot ovarian and follicular development. In addition, FSHR that is another important GtHR should be further investigated. Further information is essential to determine the spatiotemporal expression patterns as well as ligand availability of LHR and FSHR, which will help in understanding the potential roles of GtHRs in the regulation of the fish reproductive cycle. Acknowledgments This study was supported by China Agriculture Research System (CRAS-50), National Natural Science Foundation of China (31302205), Natural Science Foundation of Shandong Province (ZR2012CQ024 and BS2013SW004), and the China Postdoctoral Science Foundation (No. 2012M511559 and 2013T60690). We thank Xinfu Liu and Chunren Gao (Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences) for help in the experiment.
References Akazome Y, Abe T, Mori T (2002) Differentiation of chicken gonad as an endocrine organ: expression of LH receptor, FSH receptor, cytochrome P450c17 and aromatase genes. Reproduction 123:721–728 Alvarez CA, Narayan P, Huang J, Puett D (1999) Characterization of a region of the lutropin receptor extracellular domain near transmembrane helix 1 that is important in ligand-mediated signaling. Endocrinology 140:1775–1782 Andersson E, Schulz RW, Male R, Bogerd J, Patin˜a D, Benedet S, Norberg B, Taranger GL (2013) Pituitary gonadotropin and ovarian gonadotropin receptor transcript levels: seasonal and photoperiod-induced changes in the reproductive physiology of female Atlantic salmon (Salmo salar). Gen Comp Endocrinol 191:247–258 Bao B, Garverick HA (1998) Expression of steroidogenic enzyme and gonadotropin receptor genes in bovine follicles during ovarian follicular waves: a review. J Anim Sci 76:1903–1921 Bogerd J (2007) Ligand-selective determinants in gonadotropin receptors. Mol Cell Endocrinol 260(262):144–152 Bromley PJ, Ravier C, Witthames PR (2000) The influence of feeding regime on sexual maturation, fecundity and atresia in first-time spawning turbot. J Fish Biol 56:264–278 Canipari R (2000) Oocyte-granulosa cell interactions. Hum Reprod Update 6:279–289 Chaffin CL, Vandevoort CA (2013) Follicle growth, ovulation, and luteal formation in primates and rodents: a comparative perspective. Exp Biol Med 238:539–548
1649 Fortune JE (1994) Ovarian follicular growth and development in mammals. Biol Reprod 50:225–232 Frazier AL, Robbins LS, Stork PJ, Sprengel R, Segaloff DL, Cone RD (1990) Isolation of TSH and LH/CG receptor cDNAs from human thyroid: regulation by tissue specific splicing. Mol Endocrinol 4:1264–1276 Girin M, Devauchelle N (1978) De´calage de la pe´riode de reproduction par raccourcissement des cycles photope´riodique et thermique chez des poissons marins. Ann Biol Anim Biochim Biophys 18:1059–1065 Hillier SG (2001) Gonadotropic control of ovarian follicular growth and development. Mol Cell Endocrinol 179:39–46 Hirai T, Oba Y, Nagahama Y (2002) Fish gonadotropin receptors: molecular characterization and expression during gametogenesis. Fish Sci Suppl 68:675–678 Jia YD, Meng Z, Liu XF, Lei JL (2014) Biochemical composition and quality of turbot (Scophthalmus maximus) eggs throughout the reproductive season. Fish Physiol Biochem. doi:10.1007/s10695-014-9908-9 Johnson AL, Bridgham JT, Wagner B (1996) Characterization of a chicken luteinizing hormone receptor (cLH-R) complementary deoxyribonucleic acid, and expression of cLHR messenger ribonucleic acid in the ovary. Biol Reprod 55:304–309 Jones BA (1974) Sexual maturity, fecundity and growth of the turbot Scophthalmus maximus L. J Mar Biol Ass UK 54:109–125 Kobayashi T, Andersen Ø (2008) The gonadotropin receptors FSH-R and LH-R of Atlantic halibut (Hippoglossus hippoglossus), 1: isolation of multiple transcripts encoding full-length and truncated variants of FSH-R. Gen Comp Endocrinol 156:584–594 Kobayashi T, Pakarinen P, Torgersen J, Huhtaniemi I, Andersen Ø (2008) The gonadotropin receptors FSH-R and LH-R of Atlantic halibut (Hippoglossus hippoglossus)-2. Differential follicle expression and asynchronous oogenesis. Gen Comp Endocrinol 156:595–602 Kobe B, Kajava AV (2001) The leucine-rich repeat as a protein recognition motif. Curr Opin Struct Biol 11:725–732 Kumar RS, Ijiri S, Trant JM (2001a) Molecular biology of channel catfish gonadotropin receptors: 1. Cloning of a functional luteinizing hormone receptor and preovulatory induction of gene expression. Biol Reprod 64:1010–1018 Kumar RS, Ijiri S, Tran JM (2001b) Molecular biology of the channel catfish gonadotropin receptors: 2. Complementary DNA cloning, functional expression, and seasonal gene expression of the follicle-stimulating hormone receptor. Biol Reprod 65:710–717 Kwok HF, So WK, Wang Y, Ge W (2005) Zebrafish gonadotropins and their receptors: I. Cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone receptors-evidence for their distinct functions in follicle development. Biol Reprod 72:1370–1381 Levavi-Sivan B, Bogerd J, Man˜ano´s EL, Go´mez A, Lareyre JJ (2010) Perspectives on fish gonadotropins and their receptors. Gen Comp Endocrinol 165:412–437 Liang H, Chen L, Liu Z, Zhou X (2012) Expression of functional follicle-stimulating hormone receptor and luteinizing hormone/chorionic gonadotrophin receptor in oviduct and uterus in prepubertal gilts. Live Sci 148:74–80
123
1650 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2-DDCT method. Methods 25:402–408 Lubzens E, Young G, Bobe J, Cerda` J (2010) Oogenesis in teleosts: how fish eggs are formed. Gen Comp Endocrinol 165:367–389 Magoffin DA (2005) Ovarian theca cell. Inter J Biochem Cell Biol 37:1344–1349 Maugars G, Schmitz M (2006) Molecular cloning and characterization of FSH and LH receptors in Atlantic salmon (Salmo salarL.). Gen Comp Endocrinol 149:108–117 Mcevoy LA (1984) Ovulatory rhythmes and over-ripening of eggs in cultivated turbot, Scophthalmus maximus L. J Fish Biol 24:437–448 McEvoy LA (1989) Reproduction of turbot (Scophthalmus maximus L.) in captivity. Cuard Aera Cienc Mar Semin Estud Galegos 3:9–28 Menon KMJ, Menon B (2012) Structure, function and regulation of gonadotropin receptors-a perspective. Mol Cell Endocrinol 356:88–97 Mittelholzer C, Andersson E, Taranger GL, Consten D, Hirai T, Senthilkumaran B, Nagahama Y, Norberg B (2009) Molecular characterization and quantification of the gonadotropin receptors FSH-R and LH-R from Atlantic cod (Gadus morhua). Gen Comp Endocrinol 160:47–58 Moyle WR, Campbell RK, Myers RV, Bernard MP, Han Y, Wang X (1994) Co-evolution of ligand-receptor pairs. Nature 368:251–255 Moyle WR, Xing Y, Lin W, Cao DH, Myers RV, Kerrigan JE, Bernard MP (2004) Model of glycoprotein hormone receptor ligand binding and signaling. J Biol Chem 279:44442–44459 Mugnier C, Guennoc M, Lebegue E, Fostier A, Breton B (2000) Induction and synchronisation of spawning in cultivated turbot (Scophthalmus maximus L.) broodstock by implantation of a sustained-release GnRH-a pellet. Aquaculture 181:241–255 Nagahama Y, Yamashita M (2008) Regulation of oocyte maturation in fish. Dev Growth Differ 50:S195–S219 Nocillado JN, Elizur A (2008) Neuroendocrine regulation of puberty in fish: insights from the Grey Mullet (Mugil cephalus) model. Mol Reprod Dev 75:355–361 Oba Y, Hirai T, Yoshiura Y, Yoshikuni M, Kawauchi H, Nagahama Y (1999a) Cloning, functional characterization, and expression of a gonadotropin receptor cDNA in the ovary and testis of Amago Salmon (Oncorhynchus rhodurus). Biochem Biophys Res Commun 263:584–590 Oba Y, Hirai T, Yoshiura Y, Yoshikuni M, Kawauchi H, Nagahama Y (1999b) The duality of fish gonadotropin receptors: cloning and functional characterization of a second gonadotropin receptor cDNA expressed in the ovary and testis of Amago Salmon (Oncorhynchus rhodurus). Biochem Biophys Res Commun 265:366–371 Oba Y, Hira T, Yoshiura Y, Kobayashi T, Nagahama Y (2001) Fish gonadotropin and thyrotropin receptors: the evolution of glycoprotein hormone receptors in vertebrates. Comp Biochem Physiol B 129:441–448
123
Fish Physiol Biochem (2014) 40:1639–1650 Ohkubo M, Yabu T, Yamashita M, Shimizu A (2013) Molecular cloning of two gonadotropin receptors in mummichog Fundulus heteroclitus and their gene expression during follicular development and maturation. Gen Comp Endocrinol 184:75–86 Pakarainen T, Ahtiainen P, Zhang FP, Rulli S, Poutanen M, Huhtaniemi I (2007) Extragonadal LH/hCG action-Not yet time to rewrite textbooks. Mol Cell Endocrinol 269:9–16 Rao CV (2001) An overview of the past, present, and future of nongonadal LH/hCG actions in reproductive biology and medicine. Semin Reprod Med 19:7–17 Rocha A, Go´mez A, Zanuy S, Cerda´-Reverter JM, Carrillo M (2007) Molecular characterization of two sea bass gonadotropin receptors: cDNA cloning, expression analysis, and functional activity. Mol Cell Endocrinol 272:63–76 Rocha A, Zanuy S, Carrillo M, Go´me A (2009) Seasonal changes in gonadal expression of gonadotropin receptors, steroidogenic acute regulatory protein and steroidogenic enzymes in the European sea bass. Gen Comp Endocrinol 162:265–275 Sower SA, Freamat M, Kavanaugh SI (2009) The origins of the vertebrate hypothalamic-pituitary-gonadal (HPG) and hypothalamic-pituitary-thyroid (HPT) endocrine systems: new insights from lampreys. Gen Comp Endocrinol 161:20–29 Suquet M, Billard R, Cosson J, Normant Y, Fauvel C (1995) Artificial insemination in turbot (Scophthalmus maximus): determination of the optimal sperm to egg ratio and time of gamete contact. Aquaculture 133:83–90 Tilly JL, Aihara T, Nishimori K, Jia XC, Billig H, Kowalski KI, Perlas EA, Hsueh AJ (1992) Expression of recombinant human follicle-stimulating hormone receptor: speciesspecific ligand binding, signal transduction, and identification of multiple ovarian messenger ribonucleic acid transcripts. Endocrinology 131:799–806 van den Hurk R, Zhao J (2005) Formation of mammalian oocytes and their growth, differentiation and maturation within ovarian follicles. Theriogenology 63:1717–1751 Vischer HF, Bogerd J (2003) Cloning and functional characterization of a gonadal luteinizing hormone receptor complementary DNA from the African Catfish (Clarias gariepinus). Biol Reprod 68:262–271 Wallace RA, Selman K (1981) Cellular and dynamic aspects of oocyte growth in teleosts. Am Zool 21:325–343 Zhang R, Buczko E, Dufau ML (1996) Requirement of cysteine residues in exons 1-6 of the extracellular domain of the luteinizing hormone receptor for gonadotropin binding. J Biol Chem 271:5755–5760 Zhang CQ, Shimada K, Saito N, Kansaku N (1997) Expression of messenger ribonucleic acids of luteinizing Hormone and follicle-stimulating hormone receptors in granulosa and theca layers of chicken preovulatory follicles. Gen Comp Endocrinol 105:402–409 Ziecik AJ, Derecka-Reszka K, Rzucidło SJ (1992) Extragonadal gonadotropin receptors, their distribution and function. Physiol Pharmacol 43:33–49
Molecular cloning, characterization, and expression analysis of luteinizing hormone receptor gene in turbot (Scophthalmus maximus) Yudong Jia • Zhen Meng • Huaxin Niu Peng Hu • Jilin Lei
•
Received: 6 April 2014 / Accepted: 16 June 2014 / Published online: 26 June 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract The luteinizing hormone receptor (LHR) plays a crucial role in female reproduction. In the present study, full-length sequence coding for the LHR was obtained from female turbot (Scophthalmus maximus) by homology cloning and a strategy based on rapid amplification of cDNA end-polymerase chain reaction. The full-length LHR cDNA was 3,184 bp long and contained a 2,058-bp open reading frame which encoded a protein of 685 amino acids. Multiple sequence alignments of the turbot LHR manifested high homologies with the corresponding sequences of available teleosts and representative vertebrates, and significant homology with that of Hippoglossus hippoglossus. In addition, the turbot LHR showed typical
Yudong Jia and Zhen Meng have contributed equally to this work. Y. Jia Z. Meng P. Hu J. Lei (&) Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, No. 106 Nanjing Road, Qingdao 266071, People’s Republic of China e-mail: [email protected]; [email protected] Y. Jia Z. Meng P. Hu J. Lei Qingdao Key Laboratory for Marine Fish Breeding and Biotechnology, Qingdao 266071, People’s Republic of China H. Niu School of Animal Science and Technology, Inner Mongolia University for the Nationalities, Tongliao 028042, People’s Republic of China
characteristics of glycoprotein receptors, including a long N-terminal extracellular domain, seven transmembrane domains, and a short C-terminal intracellular domain. LHR mRNA was abundant in the ovary, but was deficient in extra-ovarian tissues. Furthermore, LHR mRNA gradually developed from previtellogenesis to migratory nucleus stage, with the highest values observed in migratory nucleus stage during reproductive cycle. However, LHR mRNA sharply decreased in atresia stage. These results suggested that LHR is a typical G protein-coupled receptor that is involved in the promotion of turbot ovarian development and may be related to the final maturation and ovulation of oocyte. These findings contribute to the understanding of the potential roles of LHR in controlling the fish reproductive cycle. Keywords Luteinizing hormone receptor mRNA expression Reproduction Turbot (Scophthalmus maximus)
Introduction The reproductive cycle is essentially regulated by the brain–pituitary–gonadal axis in vertebrates (Fortune 1994; Nocillado and Elizur 2008; Sower et al. 2009; Chaffin and Vandevoort 2013). Pituitary-derived gonadotropins are essential in the regulation of gametogenesis and in the production of steroid
123
1640
hormones in the gonads. Gonadotropins are heterodimeric glycoprotein hormones, and they act on gonadal tissue by binding their specific receptors, folliclestimulating hormone receptor (FSHR), and luteinizing hormone receptor (LHR). These receptors are primarily expressed on the surface of gonadal somatic cells and are involved in the regulation of gametogenesis via distinct intracellular signaling pathways (Menon and Menon 2012). The gonadotropin receptors (GtHRs) molecules have already been cloned, and their physiological roles in mammals, chicken, and some teleost fish have been clarified (Johnson et al. 1996; Akazome et al. 2002; Kobayashi et al. 2008; Mittelholzer et al. 2009; Liang et al. 2012; Ohkubo et al. 2013). Two classes of GtHRs namely type I (GtH-RI) and type II (GtH-RII) are found in fish gonads, and they correspond to the FSHR and LHR in mammals and chicken (Oba et al. 2001; Levavi-Sivan et al. 2010). Similar to evolved vertebrates, fish GtHRs belong to the superfamily of G protein-coupled receptors (GPCRs), which are complex transmembrane rhodopsin-like proteins characterized by seven hydrophobic helices inserted in the plasmalemma and by intracellular and extracellular domains of varying dimensions depending on the type of ligand. Ligand specificity of mammalian GtHRs is well defined and has no occurring cross-activation under physiological conditions (Tilly et al. 1992; Moyle et al. 1994; Bogerd 2007). However, molecular biological studies have demonstrated that GtH-RI (FSHR) is located on both the theca and granulosa cells and binds both FSH and LH, and GtH-RII (LHR) specifically binds LH and is only located on the granulosa cells in a number of teleost species (Oba et al. 1999a, b; Vischer and Bogerd 2003; Maugars and Schmitz 2006; Rocha et al. 2007; Kobayashi and Andersen 2008). Moreover, the two receptors display distinct expression profiles in repetitive and annual spawning fish during the reproductive cycle (Kumar et al. 2001a, b; Kwok et al. 2005; Kobayashi et al. 2008; Andersson et al. 2013). In several mammalian species and domestic hen, FSHR mRNA and protein levels have been reported to decrease with increasing follicular size, while LHR expression increases in the granulosa cells as follicles grow (Zhang et al. 1997; Bao and Garverick 1998; Hillier 2001). Therefore, knowledge of the molecular structure, function, and gene regulation of the GtHRs is imperative for a better understanding of
123
Fish Physiol Biochem (2014) 40:1639–1650
reproductive physiology which can be used to manipulate teleost reproduction. Turbot (Scophthalmus maximus) is a widely cultured marine fish of considerable commercial value in Europe and China. Much effort has been conducted on nutritional requirements, hormonal induction of spawning, and environmental conditions of female turbot during reproductive cycle (Jones 1974; Mcevoy 1989; Suquet et al. 1995; Bromley et al. 2000; Jia et al. 2014). Females can reach maturity at 3 years of age. Mature female turbot spawn multiple times during the reproductive season. The natural reproductive season occurs in spring and early summer, between April and August, but can be extended throughout the year by manipulating photoperiod and temperature in captivity (Girin and Devauchelle 1978). However, the captive turbot did not spawn naturally, and so eggs were hand-stripped from ripe fish and artificially fertilized. The maturation of oocytes was monitored by taking eggs from ovaries prior to the spawning period (Mcevoy, 1984). Ovulatory rhythms were determined based on the first ovulation date by using daily abdominal stripping at the start of the spawning season. This procedure was performed to ensure that fresh ovulated eggs were obtained and to prevent overripening. Due to their ovulatory cycles of 70–90 h, each female could spawn 8–12 times at 3–5 days intervals throughout the spawning season in artificial broodstock (Mugnier et al. 2000). The use of exogenous hormones is an effective way to induce reproductive maturation and produce large fertilized eggs in captivity. Hormonal manipulations of the reproductive function in cultured turbot mainly focus on the use of either the exogenous luteinizing hormone (LH) preparations that act directly at the level of the gonad or the synthetic agonists of gonadotropin-releasing hormone (GnRHa) that acts on the pituitary to induce the release of the endogenous LH, which in turn acts on the gonad to induce steroidogenesis and oocyte maturation. However, knowledge on the molecular mechanisms regulating the asynchronous development of multiple batches of oocytes in this species and information on the functional characterization of LHR in the ovary during reproductive cycle are limited. Therefore, the present study was conducted to clone and characterize LHR from the turbot ovarian tissue. In addition, the turbot LHR expression profiles were evaluated during the reproductive cycle.
Fish Physiol Biochem (2014) 40:1639–1650
1641
Table 1 Primer sequences used in this study Primers
Primer sequence 50 -30
Purpose used
LHRF0
TGGCTGTAATGGTTATTCTGCT
cDNA fragment of LHR
LHRR0
GTTGGTGATGGTGTGGCAGCGT
cDNA fragment of LHR
Long primer Short primer
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC
RACE RACE
LHRGSP1
CACATGAGAAACCTGGAGATGG
50 -RACE
LHRGSP2
TACTACAACCACGCCACGGACT
30 -RACE
LHRF
GCTCCTCCTCAACATCCTGG
qRT-PCR
LHRR
TGCGGACAGTCAGATAGATGCT
qRT-PCR
b-actinF
TGAACCCCAAAGCCAACAGG
qRT-PCR
b-actinR
CAGAGGCATACAGGGACAGCAC
qRT-PCR
Materials and methods Fish and tissue sampling Sexually mature females were anesthetized with 100 mg/L tricaine methane sulfonate (MS-222, Sigma, St. Louis, MO). Tissues from the eye, stomach, intestine, gill, heart, spleen, kidney, brain, muscle, ovary, and liver were collected from each fish. The specimens were snap-frozen in liquid nitrogen or preserved in RNAstore Reagent (Tiangen Biotech, Beijing, China) and stored at -80 °C until RNA extraction. Ovaries were fixed in Bouin’s solution for hematoxylin and eosin (HE) staining in order to identify the oocyte developmental stages. LHR gene cloning Total RNA was extracted with Trizol reagent (Invitrogen) from ovary of turbot according to the manufacturer’s protocol. The quality and quantity of total RNA were analyzed on 1 % agarose gel electrophoresis and using a UV spectrophotometer. Approximately 200 ng of the total RNA was incubated with 1 unit of deoxyribonuclease I (Nippon Gene) at 37 °C for 15 min and then reverse-transcribed to the singlestranded cDNA using SMARTTM rapid amplification of cDNA end (RACE) cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions. According to the conserved sequences of the LHR gene from other teleost species, a pair of degenerate
primers, LHRF0 and LHRR0, was designed to the cloning of the corresponding partial fragment of LHR cDNA. Polymerase chain reaction (PCR) cycling conditions were as follows: denaturation at 94 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 1 min for 32 cycles. Based on the obtained partial nucleotide sequence of LHR, two specific primers (LHRGSP1 and LHRGSP2) were designed for the amplification of the cDNA ends of the LHR gene using the SMARTTM RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) following the manufacturer’s instructions. LHRGSP1 and LHRGSP2 were used to amplify the 50 and 30 -ends, respectively. The universal primer (UPM) used for the 50 - and 30 -RACE comprised a mixture of long and short primers (from SMARTTM RACE cDNA Amplification Kit, Clontech). The above primers are listed in Table 1. Sequence analysis The translation initiation ATG and the primary structure of the LHR were deduced using the open reading frame (ORF) finder available at the NCBI (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Signal peptides, potential N-linked glycosylation sites, and potential phosphorylation sites were identified using SignalP 4.0 (http://www.cbs.dtu.dk/services/SignalP/), NetNGlyc 1.0 (http://www.cbs.dtu.dk/services/NetNGlyc/), and NetPhos 2.0 (http://www.cbs.dtu.dk/services/ NetPhos/), respectively. The structural features of LHR were analyzed using ProtParam (http://web. expasy.org/protparam/), PHD program (http://www.
123
1642
123
Fish Physiol Biochem (2014) 40:1639–1650
Fish Physiol Biochem (2014) 40:1639–1650 b Fig. 1 Nucleotide (upper line) and deduced amino acid (lower
line) sequences of the turbot LHR. The start codon (ATG) was boxed, and the stop codon (TGA) was marked with an asterisk. The signal peptide sequence and the polyA signal in 30 UTR are underlined. The position of the seven predicted transmembrane domain is showed as black box (369–391aa, 398–420 aa, 442–464 aa, 485–507 aa, 531–553 aa, 574–596 aa, 611–633 aa). Putative core b strands of LRRs regions are indicated with arrows. Cysteine residues are indicated by filled diamond, and two conserved cysteins (441C and 516C), predicted to form an intramolecular disulfide bond, are indicated by filled inverted triangle. Predicted consensus phosphorylation sites are indicated by filled triangle (protein kinase C) and filled square (casein kinase II). Potential N-glycosylation sits is indicated by filled circle
predictprotein.org), Smart (http://smart.embl-heidelberg. de/), and TMHMM Server 2.0 (http://www.cbs.dtu.dk/ services//TMHMM-2.0/). Multiple alignments of amino acid sequences were obtained by the software ClustalX1.81. A phylogenetic tree was constructed using MEGA4.0 by neighbor-joining (NJ) method. The leucine-rich repeat containing GPCR (LGR) sequence from the caenorhabditis elegans was used as the out-group. Reliability of the NJ tree was assessed by interior branch test, using 1,000 replications. The deduced amino acid sequences of vertebrate LHR were acquired from the Genbank database: Epinephelus coioides, HQ650770; Hippoglossus hippoglossus, EU502845; Salmo salar, AJ579790; Ctenopharyngodon idella, EF194761; Danio rerio, AY714133; Dicentrarchus labrax, AY642114; Sparus aurata, AY587261; Solea senegalensis, GQ472140; Oncorhynchus rhodurus, AB030005; Oncorhynchus mykiss, AF439404; Clarias gariepinus, AF324540; Xenopus laevis, AB602929; Gallus gallus, AB009283; Homo sapiens, S57793; Mouse, M81310.
Quantitative real-time PCR The relative expression of LHR mRNA in terms of tissue distribution and the different oocyte developmental stages was determined using quantitative realtime PCR (qRT-PCR), which was performed on an ABI StepOne Pluse Sequence Detection System (Applied Biosystems, USA) according to the manufacturer’s instructions. The primers LHRF/R and bactinF/R were used to amplifying the LHR and b-actin fragments, respectively (Table 1). A final volume of 20 ll, which contained 10 lL SYBRÒ Premix Ex
1643
TaqTM (Takara Bio., China), 0.8 lL of each primer (10 lM), 0.4 lL ROX Dye (509), 2 lL cDNA sample (25 ng/lL), and 6lL sterile distilled water, was used for amplification. Initial denaturation was conducted at 95 °C for 10 s, followed by 40 cycles at 95 °C for 5 s and at 60 °C for 30 s. A dissociation protocol was performed after thermocycling to determine the target specificity. Turbot b-actin was utilized as the endogenous control. All samples were amplified in triplicates. The LHR gene expression was normalized to bactin and expressed as a folded change relative to the expression level in the control according to the 2-DDCT method (Livak and Schmittgen 2001).
Statistical analysis The experiment was repeated at least thrice for each condition. Data were expressed as mean ± SEM and analyzed by ANOVA and Duncan’s multiple range tests using the SAS 8.0 software. P \ 0.05 was considered to be statistically different.
Results Cloning and characteristics of LHR gene from turbot The full-length cDNA sequence of the LHR was obtained by the 50 and 30 RACE method. The complete cDNA contained a 124-bp 50 -terminal untranslated region (UTR), 2,058-bp ORF (which encoded 685 amino acids), and 1,002-bp 30 -UTR. The 30 -UTR contained two canonical polyadenylylation signals (AATAAA), followed after an additional 11 bp by the poly (A) tail (Fig. 1). Structural analyses revealed that turbot LHR exhibited typical characteristics of a glycoprotein hormone receptor subfamily of GPCRs. The turbot LHR comprised a large extracellular domain with 368 amino acids including a putative signal peptide of 18 amino acids, followed by nine imperfect leucine-rich repeats (LRRs) that formed a flexible hinge region, and a seven transmembrane domain upstream of the short intracellular carboxyterminus (Fig. 1). The extracellular loops between TM II–III and TM IV–V contained a cysteine residue (Cys441 and Cys516) that were assumed to link the extracellular loops via a disulfide bridge (Fig. 1).
123
1644
Fish Physiol Biochem (2014) 40:1639–1650
Fig. 2 Alignment of the amino acid sequence of the turbot LHR (SM-LHR) proteins from various species. Position with [70 % similarity is shaded in light grey, while completely conserved positions are shaded in black. Accessions number: Epinephelus coioides (EC) HQ650770, Gallus gallus (GG)
AB009283, Hippoglossus hippoglossus (HH) EU502845, Mouse (M) M81310, Salmo salar (SS) AJ579790, Xenopus laevis (XL) AB602929, Ctenopharyngodon idella (CI) EF194761, Danio rerio (Z) AY714133
Meanwhile, the N-terminal and C-terminal cysteinerich domains contained eleven and five conserved cysteines residues, respectively. The intracellular loops between TM II–III and TM V–VI, as well as the intracellular C-terminal domain, contained serine residues that may represent potential phosphorylation sites. Three sites within the TM domain were the
consensus sites for the protein kinase C (Ser554 and Ser562) and casein kinase II (Ser424) phosphorylation. The intracellular C-terminal domain consisted of 52 amino acids, including a potential phosphorylation site for protein kinase C at Ser666. According to the predication by the ProtParam program, turbot LHR had a molecular weight of
123
Fish Physiol Biochem (2014) 40:1639–1650
76.54 kDa and a theoretical pI of 7.22. The total number of negatively (Asp ? Glu) and positively (Arg ? Lys) charged residues was 57 and 57, respectively. The instability index of LHR was computed to be 37.72, so it was classified as a stable protein. Phylogenetic analysis and alignment Alignment of the turbot LHR amino acid sequence with other vertebrates showed that the turbot LHR had high homologies with those of other fish species, followed by mouse, chicken, and frog LHRs (Fig. 2). In addition, comparison with paralogous genes FSHR and thyroid-stimulating hormone receptor (TSHR) demonstrated that the turbot LHR protein was closely related to the Hippoglossus hippoglossus proteins in the phylogenetic tree which was constructed by the NJ method (Fig. 3). LHR expression in different tissues LHR expression in the tissues of turbot was analyzed using qRT-PCR. Different expression levels of the LHR mRNA transcript could be detected in all the analyzed tissues (Fig. 4). LHR mRNA was significantly most abundant in the ovary and then in the liver (Fig. 4, P \ 0.05). However, it was deficient in the eyes, intestine, brain, muscle, gill, spleen, stomach, and kidney with no statistically significant difference among these organs (Fig. 4, P [ 0.05). Ovarian developmental stages in females Five stages were observed in the ovarian development of the female turbot on the basis of oocyte morphology. The previtellogenesis stage was characterized by oocyte growth, enlargement of the nucleus (germinal vesicle), and appearance of multiple nucleoli at the periphery of the nucleus (Fig. 5a). The early vitellogenesis stage was characterized by the centralized appearance of spherical, eosinophilic, and vitellogenic yolk granules/globules in the oocyte cells (Fig. 5b). The late vitellogenesis stage was characterized by an increasing accumulation of vitellogenic granules in the oocytes and the start of the nucleic migration toward the periphery of the cell (Fig. 5c). The migratory nucleus stage, vitellogenesis reached its peak, the cell became larger and more hydrated, and
1645
the nucleus migrated toward the periphery of the cell and was in the process of dissolution (Fig. 5d). The oocytes shrunk or collapse during the atresia stage (Fig. 5e). LHR expression during the ovarian developmental stages LHR expression during the ovarian development stages was analyzed using qRT-PCR. LHR expression gradually developed from previtellogenesis to maturation stage, with the highest values observed during migratory nucleus stage (Fig. 6, P \ 0.05). However, LHR expression sharply decreased during the atresia stage (Fig. 6, P \ 0.05).
Discussion The development and maturation of ovarian oocytes are key physiological processes in female reproduction. Oogenesis is strictly regulated by numerous endocrine as well as paracrine factors, particularly the gonadotropins LH and FSH (Lubzens et al. 2010). Considered the most diverse group among vertebrates, fish have dissimilar modes of ovarian development and reproductive strategies. In addition, the physiological role of gonadotropins in teleost is highly controversial (Levavi-sivan et al. 2010). To obtain an in-depth understanding of the events that regulates oocyte final maturation and ovulation, molecular characterization, and quantification of the key gene, LHR was performed. In this study, the cDNA coding for the LHR was cloned from the turbot ovary tissue. Analysis of the nucleotide and deduced amino acid sequence of the turbot LHR reveal that this receptor was highly homologous to vertebrate LHRs and showed typical structural features of glycoprotein receptors. A relatively long extracellular domain with nine imperfect LRRs was followed by a rhodopsin-like seven transmembrane module. LRRs are usually involved in protein–protein interactions and composed of a-helical/b-strands units connected by a turn and arranged in a horseshoe-like configuration (Kobe and Kajava 2001). Moreover, the LRR domain of the LHR was flanked by conserved cysteine clusters, which were thought to be important for ligand binding and receptor expression at the cell surface (Zhang et al. 1996; Moyle et al. 2004; Bogerd 2007). Cys355 was
123
1646
part of a 10-amino acid sequence (residues 352–364, FNPCEDLLGF), located upstream of TM I. This amino acid sequence is important for receptor cell surface expression, as well as for ligand-mediated signaling and is invariably recognized by all members
123
Fish Physiol Biochem (2014) 40:1639–1650
of the glycoprotein hormone receptor family (consensus sequence: FNPCEDIMGY). Residues P354, E356, and D357 of the turbot LHR were found to be essential for signaling and were conserved in all glycoprotein hormone receptors. However, L361 and L 362 were
Fish Physiol Biochem (2014) 40:1639–1650 b Fig. 3 The neighbor-joining phylogenetic tree of vertebrates
based on the amino acid sequence of TSHR, FSHR, and LHR. Accession number: TSHR Danio rerio (NM_001145763.2), TSHR Homo sapiens (AY429111.1), TSHR Gallus gallus (NM_001193589.1), TSHR Macaca mulatta (NM_001195395.1), TSHR Clarias gariepinus (AY129556.1), FSHR Acanthopagrus schlegelii (ABU49599.1), FSHR Dicentrarchus labrax (AY642113.1), FSHR Epinephelus coioides (AEG65826.1), FSHR Hippoglossus hippoglossus (ACB13177.1), FSHR Cynoglossus semilaevis (ACD39387.2), FSHR Oncorhynchus mykiss (AF439405.1), FSHR Clarias gariepinus (AJ012647.2), FSHR Danio rerio (AAP33512.1), FSHR Xenopus laevis (NM_001256260.1), FSHR Gallus gallus (NM_205079.1), FSHR Human (M65085.1), FSHR Mus musculus (NM_013523.3), LHR Xenopus laevis (AB602929), LHR Gallus gallus (AB009283), LHR Homo sapiens (S57793), LHR Mouse (M81310), LHR Hippoglossus hippoglossus (EU502845), LHR Danio rerio (AY714133), LHR Ctenopharyngodon idella (EF194761), LHR Clarias gariepinus (AF324540), LHR Oncorhynchus rhodurus (AB030005), LHR Oncorhynchus mykiss (AF439404), LHR Solea senegalensis (GQ472140), LHR Salmo salar (AJ579790), LHR Sparus aurata (AY587261), LHR Dicentrarchus labrax (AY642114), LHR Epinephelus coioides (HQ650770). The LGR sequence from the caenorhabditis elegans (AF224743.1) was used as the out-group. Bootstrap values (in %) from 1,000 replicates are indicated for each tree node
less conserved and apparently had no significant functions in receptor expression or signal transduction (Alvarez et al. 1999). In the rat LHR, Cys109 and Cys134 are important residues for receptor cell surface expression and hormone binding (Zhang et al. 1996). The two cysteine residues, conserved in the LHRs, are
Fig. 4 Quantitative analyses of LHR mRNA expression in different tissues of turbot. The expression level was analyzed by 2-DDCT method, and the expression of LHR in eye was taken as reference for the expression in the other tissues. The b-actin gene was explored as an internal control. Values represent the mean ± SEM of three experiments for each condition. Bars with different superscripts differ (P \ 0.05, n = 3)
1647
localized in two adjacent b-strands and predicted to form a disulfide bridge. However, the amino acid residue on the similar position as Cys109 was not conserved in the turbot LHR, suggesting that a disulfide bond within this LRR is not strictly necessary to maintain the horseshoe-shaped conformation. Similar results were observed in other fish LHRs (Kobayashi et al. 2008). Furthermore, Cys441 and Cys516 were found to be located in the extracellular loops I and II of the transmembrane domain, which were believed to connect both loops via a disulfide bridge (Levavi-Sivan et al. 2010). The intracellular carboxyterminal domain contained two adjacent cysteine residues (Cys646 and Cys647) that were presumed to be palmitoylated, fixing this domain in the cell membrane. Moreover, three potential N-linked glycosylation sites and four phosphorylation sites were recognized in the N-terminal and carboxy-terminal regions of turbot LHRs, respectively. The NJ phylogenetic tree showed that turbot LHR had significant homology to that of H. hippoglossus. These results indicated the basic structure and characteristics of turbot LHR that were similar to other fish and mammalian species provided additional information on the evolution of the recognition site regarding the structure–function evolution of LHR. Studies have already established that LHR is mainly located on the surface of ovarian cells and involved in mediating ovarian steroidogenesis and ovulation. In addition, it may also affect the follicular development by a complex signal pathway in vertebrates. LHR is also observed in extragonadal tissues, including the reproductive tract, placenta, umbilical cord, and brain, and the putative roles in these tissues are likely related to the binding of LH and hCG (Ziecik et al. 1992; Pakarainen et al. 2007). In teleost, LHR is found in extragonadal tissues, such as the brain, gills, kidneys, and heart (Kwok et al. 2005; Maugars and Schmitz 2006; Rocha et al. 2009; Ohkubo et al. 2013). In the current study, turbot LHR was found to be expressed more abundantly in ovary and less abundant in other tissues, which is in agreement with similar reports in mammals and other fish species (Frazier et al. 1990; Oba et al. 1999a; Rao 2001; Kumar et al. 2001b; Vischer and Bogerd 2003). However, contrary to sea bass and African catfish, the extragonadal LHR expression was remarkable in head kidney and not in liver (Rocha et al. 2007; Vischer and bogerd 2003). The varying LHR expression in diverse extragonadal
123
1648
Fish Physiol Biochem (2014) 40:1639–1650
Fig. 5 Development and types of turbot oocyte in ovarian stage. a Previtellogenesis, arrow indicates nucleoli at the periphery of the germinal vesicle. b Early vitellogenesis, arrow indicates gradually accumulations of yolk granules in the central region of the oocyte. c Late vitellogenesis, arrow indicates the yolk granules almost fill the ooplasm, and the nucleus has not yet
begun to migrate peripherally. d Migratory nucleus, arrow indicates the oocytes, and the yolk granules have attained their maximum size just prior to spawning, and the nucleus is not evident. e Atresia, arrow indicates the oocytes have shrinkage or collapse
tissues may be caused by species-specific, and their significance should be deeply understood via presence of in vivo data on their functionalities. Thus, these results suggest that the turbot LHR is associated with ovarian development and may play a role in female turbot reproduction. The genesis and development of oocytes in teleost fish are a complex physiological event that requires the coordinated action of regulatory molecules that ensure the organization of genetic and nutritional bases for the development of new individuals. Numerous studies have demonstrated that the circulating endocrine and locally acting paracrine and autocrine factors
involve in regulating the various stages of oocyte growth and maturation (van den Hurk and Zhao 2005). Oocyte growth is triggered by gonadotropins, and the subsequent steroidogenic production of estradiol induces vitellogenesis, leading to a noticeable enlargement in oocyte size. Furthermore, gonadotropins involve in regulating the oocyte meiotic resumption and oocyte maturation. Meanwhile, complex hormonal communication between the developing oocyte and its surround follicular cells was observed (Canipari 2000; Magoffin 2005). Most teleost fish species are oviparous and have three main types of ovarian development based on the oocyte’s development (Wallace and Selman 1981; Nagahama and Yamashita 2008). Thus, reproductive strategies and regulation mechanism for oocyte development may differ among teleost fish species. Turbot is a serial spawner, producing multiple egg batches during a reproductive season. Histological observations of the turbot ovary presented here indicated that oocyte maturation undergoes vitellogenesis and similar to other fish species. Moreover, LHR expression was gradually developed from previtellogenic to migratory nucleus stages, and the highest value was observed during the oocyte migratory nucleus stage. Studies on the multiple and group-synchronous spawners Nile tilapia and zebrafish have indicated that LHR expression is mainly correlated with the different phases of follicle development and play a key role in final oocyte maturation and ovulation (Hirai et al. 2002; Kwok et al. 2005). Similar results were observed in European sea bass (Rocha et al. 2009). These results suggested that LHR was involved in the regulation of oocyte development and may stimulate the oocyte maturation and ovulation in turbot during its reproductive cycle.
Fig. 6 Quantitative analyses of LHR mRNA expression in ovarian stages of turbot. The expression level was analyzed by 2-DDCT method, and the expression of LHR in previtellogenesis (Prevtg) was taken as reference for the expression in the other stage. Evtg early vitellogenesis, Latvtg late vitellogenesis, Mignucle migratory nucleus, Atre atresia. Values represent the mean ± SEM of three experiments for each condition. Bars with different superscripts differ (P \ 0.05, n = 3)
123
Fish Physiol Biochem (2014) 40:1639–1650
In conclusion, full-length cDNAs coding for LHR was cloned from the turbot ovary. The cloning and structural characterizations of the LHR provided additional information regarding the conservation of GPCRs among vertebrate classes. Meanwhile, the distribution and expression profiles of LHR confirmed its involvement in oocyte growth, maturation, and final ovulation of turbot. These results strongly suggested that LHR had curial roles in regulating turbot ovarian and follicular development. In addition, FSHR that is another important GtHR should be further investigated. Further information is essential to determine the spatiotemporal expression patterns as well as ligand availability of LHR and FSHR, which will help in understanding the potential roles of GtHRs in the regulation of the fish reproductive cycle. Acknowledgments This study was supported by China Agriculture Research System (CRAS-50), National Natural Science Foundation of China (31302205), Natural Science Foundation of Shandong Province (ZR2012CQ024 and BS2013SW004), and the China Postdoctoral Science Foundation (No. 2012M511559 and 2013T60690). We thank Xinfu Liu and Chunren Gao (Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences) for help in the experiment.
References Akazome Y, Abe T, Mori T (2002) Differentiation of chicken gonad as an endocrine organ: expression of LH receptor, FSH receptor, cytochrome P450c17 and aromatase genes. Reproduction 123:721–728 Alvarez CA, Narayan P, Huang J, Puett D (1999) Characterization of a region of the lutropin receptor extracellular domain near transmembrane helix 1 that is important in ligand-mediated signaling. Endocrinology 140:1775–1782 Andersson E, Schulz RW, Male R, Bogerd J, Patin˜a D, Benedet S, Norberg B, Taranger GL (2013) Pituitary gonadotropin and ovarian gonadotropin receptor transcript levels: seasonal and photoperiod-induced changes in the reproductive physiology of female Atlantic salmon (Salmo salar). Gen Comp Endocrinol 191:247–258 Bao B, Garverick HA (1998) Expression of steroidogenic enzyme and gonadotropin receptor genes in bovine follicles during ovarian follicular waves: a review. J Anim Sci 76:1903–1921 Bogerd J (2007) Ligand-selective determinants in gonadotropin receptors. Mol Cell Endocrinol 260(262):144–152 Bromley PJ, Ravier C, Witthames PR (2000) The influence of feeding regime on sexual maturation, fecundity and atresia in first-time spawning turbot. J Fish Biol 56:264–278 Canipari R (2000) Oocyte-granulosa cell interactions. Hum Reprod Update 6:279–289 Chaffin CL, Vandevoort CA (2013) Follicle growth, ovulation, and luteal formation in primates and rodents: a comparative perspective. Exp Biol Med 238:539–548
1649 Fortune JE (1994) Ovarian follicular growth and development in mammals. Biol Reprod 50:225–232 Frazier AL, Robbins LS, Stork PJ, Sprengel R, Segaloff DL, Cone RD (1990) Isolation of TSH and LH/CG receptor cDNAs from human thyroid: regulation by tissue specific splicing. Mol Endocrinol 4:1264–1276 Girin M, Devauchelle N (1978) De´calage de la pe´riode de reproduction par raccourcissement des cycles photope´riodique et thermique chez des poissons marins. Ann Biol Anim Biochim Biophys 18:1059–1065 Hillier SG (2001) Gonadotropic control of ovarian follicular growth and development. Mol Cell Endocrinol 179:39–46 Hirai T, Oba Y, Nagahama Y (2002) Fish gonadotropin receptors: molecular characterization and expression during gametogenesis. Fish Sci Suppl 68:675–678 Jia YD, Meng Z, Liu XF, Lei JL (2014) Biochemical composition and quality of turbot (Scophthalmus maximus) eggs throughout the reproductive season. Fish Physiol Biochem. doi:10.1007/s10695-014-9908-9 Johnson AL, Bridgham JT, Wagner B (1996) Characterization of a chicken luteinizing hormone receptor (cLH-R) complementary deoxyribonucleic acid, and expression of cLHR messenger ribonucleic acid in the ovary. Biol Reprod 55:304–309 Jones BA (1974) Sexual maturity, fecundity and growth of the turbot Scophthalmus maximus L. J Mar Biol Ass UK 54:109–125 Kobayashi T, Andersen Ø (2008) The gonadotropin receptors FSH-R and LH-R of Atlantic halibut (Hippoglossus hippoglossus), 1: isolation of multiple transcripts encoding full-length and truncated variants of FSH-R. Gen Comp Endocrinol 156:584–594 Kobayashi T, Pakarinen P, Torgersen J, Huhtaniemi I, Andersen Ø (2008) The gonadotropin receptors FSH-R and LH-R of Atlantic halibut (Hippoglossus hippoglossus)-2. Differential follicle expression and asynchronous oogenesis. Gen Comp Endocrinol 156:595–602 Kobe B, Kajava AV (2001) The leucine-rich repeat as a protein recognition motif. Curr Opin Struct Biol 11:725–732 Kumar RS, Ijiri S, Trant JM (2001a) Molecular biology of channel catfish gonadotropin receptors: 1. Cloning of a functional luteinizing hormone receptor and preovulatory induction of gene expression. Biol Reprod 64:1010–1018 Kumar RS, Ijiri S, Tran JM (2001b) Molecular biology of the channel catfish gonadotropin receptors: 2. Complementary DNA cloning, functional expression, and seasonal gene expression of the follicle-stimulating hormone receptor. Biol Reprod 65:710–717 Kwok HF, So WK, Wang Y, Ge W (2005) Zebrafish gonadotropins and their receptors: I. Cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone receptors-evidence for their distinct functions in follicle development. Biol Reprod 72:1370–1381 Levavi-Sivan B, Bogerd J, Man˜ano´s EL, Go´mez A, Lareyre JJ (2010) Perspectives on fish gonadotropins and their receptors. Gen Comp Endocrinol 165:412–437 Liang H, Chen L, Liu Z, Zhou X (2012) Expression of functional follicle-stimulating hormone receptor and luteinizing hormone/chorionic gonadotrophin receptor in oviduct and uterus in prepubertal gilts. Live Sci 148:74–80
123
1650 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2-DDCT method. Methods 25:402–408 Lubzens E, Young G, Bobe J, Cerda` J (2010) Oogenesis in teleosts: how fish eggs are formed. Gen Comp Endocrinol 165:367–389 Magoffin DA (2005) Ovarian theca cell. Inter J Biochem Cell Biol 37:1344–1349 Maugars G, Schmitz M (2006) Molecular cloning and characterization of FSH and LH receptors in Atlantic salmon (Salmo salarL.). Gen Comp Endocrinol 149:108–117 Mcevoy LA (1984) Ovulatory rhythmes and over-ripening of eggs in cultivated turbot, Scophthalmus maximus L. J Fish Biol 24:437–448 McEvoy LA (1989) Reproduction of turbot (Scophthalmus maximus L.) in captivity. Cuard Aera Cienc Mar Semin Estud Galegos 3:9–28 Menon KMJ, Menon B (2012) Structure, function and regulation of gonadotropin receptors-a perspective. Mol Cell Endocrinol 356:88–97 Mittelholzer C, Andersson E, Taranger GL, Consten D, Hirai T, Senthilkumaran B, Nagahama Y, Norberg B (2009) Molecular characterization and quantification of the gonadotropin receptors FSH-R and LH-R from Atlantic cod (Gadus morhua). Gen Comp Endocrinol 160:47–58 Moyle WR, Campbell RK, Myers RV, Bernard MP, Han Y, Wang X (1994) Co-evolution of ligand-receptor pairs. Nature 368:251–255 Moyle WR, Xing Y, Lin W, Cao DH, Myers RV, Kerrigan JE, Bernard MP (2004) Model of glycoprotein hormone receptor ligand binding and signaling. J Biol Chem 279:44442–44459 Mugnier C, Guennoc M, Lebegue E, Fostier A, Breton B (2000) Induction and synchronisation of spawning in cultivated turbot (Scophthalmus maximus L.) broodstock by implantation of a sustained-release GnRH-a pellet. Aquaculture 181:241–255 Nagahama Y, Yamashita M (2008) Regulation of oocyte maturation in fish. Dev Growth Differ 50:S195–S219 Nocillado JN, Elizur A (2008) Neuroendocrine regulation of puberty in fish: insights from the Grey Mullet (Mugil cephalus) model. Mol Reprod Dev 75:355–361 Oba Y, Hirai T, Yoshiura Y, Yoshikuni M, Kawauchi H, Nagahama Y (1999a) Cloning, functional characterization, and expression of a gonadotropin receptor cDNA in the ovary and testis of Amago Salmon (Oncorhynchus rhodurus). Biochem Biophys Res Commun 263:584–590 Oba Y, Hirai T, Yoshiura Y, Yoshikuni M, Kawauchi H, Nagahama Y (1999b) The duality of fish gonadotropin receptors: cloning and functional characterization of a second gonadotropin receptor cDNA expressed in the ovary and testis of Amago Salmon (Oncorhynchus rhodurus). Biochem Biophys Res Commun 265:366–371 Oba Y, Hira T, Yoshiura Y, Kobayashi T, Nagahama Y (2001) Fish gonadotropin and thyrotropin receptors: the evolution of glycoprotein hormone receptors in vertebrates. Comp Biochem Physiol B 129:441–448
123
Fish Physiol Biochem (2014) 40:1639–1650 Ohkubo M, Yabu T, Yamashita M, Shimizu A (2013) Molecular cloning of two gonadotropin receptors in mummichog Fundulus heteroclitus and their gene expression during follicular development and maturation. Gen Comp Endocrinol 184:75–86 Pakarainen T, Ahtiainen P, Zhang FP, Rulli S, Poutanen M, Huhtaniemi I (2007) Extragonadal LH/hCG action-Not yet time to rewrite textbooks. Mol Cell Endocrinol 269:9–16 Rao CV (2001) An overview of the past, present, and future of nongonadal LH/hCG actions in reproductive biology and medicine. Semin Reprod Med 19:7–17 Rocha A, Go´mez A, Zanuy S, Cerda´-Reverter JM, Carrillo M (2007) Molecular characterization of two sea bass gonadotropin receptors: cDNA cloning, expression analysis, and functional activity. Mol Cell Endocrinol 272:63–76 Rocha A, Zanuy S, Carrillo M, Go´me A (2009) Seasonal changes in gonadal expression of gonadotropin receptors, steroidogenic acute regulatory protein and steroidogenic enzymes in the European sea bass. Gen Comp Endocrinol 162:265–275 Sower SA, Freamat M, Kavanaugh SI (2009) The origins of the vertebrate hypothalamic-pituitary-gonadal (HPG) and hypothalamic-pituitary-thyroid (HPT) endocrine systems: new insights from lampreys. Gen Comp Endocrinol 161:20–29 Suquet M, Billard R, Cosson J, Normant Y, Fauvel C (1995) Artificial insemination in turbot (Scophthalmus maximus): determination of the optimal sperm to egg ratio and time of gamete contact. Aquaculture 133:83–90 Tilly JL, Aihara T, Nishimori K, Jia XC, Billig H, Kowalski KI, Perlas EA, Hsueh AJ (1992) Expression of recombinant human follicle-stimulating hormone receptor: speciesspecific ligand binding, signal transduction, and identification of multiple ovarian messenger ribonucleic acid transcripts. Endocrinology 131:799–806 van den Hurk R, Zhao J (2005) Formation of mammalian oocytes and their growth, differentiation and maturation within ovarian follicles. Theriogenology 63:1717–1751 Vischer HF, Bogerd J (2003) Cloning and functional characterization of a gonadal luteinizing hormone receptor complementary DNA from the African Catfish (Clarias gariepinus). Biol Reprod 68:262–271 Wallace RA, Selman K (1981) Cellular and dynamic aspects of oocyte growth in teleosts. Am Zool 21:325–343 Zhang R, Buczko E, Dufau ML (1996) Requirement of cysteine residues in exons 1-6 of the extracellular domain of the luteinizing hormone receptor for gonadotropin binding. J Biol Chem 271:5755–5760 Zhang CQ, Shimada K, Saito N, Kansaku N (1997) Expression of messenger ribonucleic acids of luteinizing Hormone and follicle-stimulating hormone receptors in granulosa and theca layers of chicken preovulatory follicles. Gen Comp Endocrinol 105:402–409 Ziecik AJ, Derecka-Reszka K, Rzucidło SJ (1992) Extragonadal gonadotropin receptors, their distribution and function. Physiol Pharmacol 43:33–49
